Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR"

Transkript

1 Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher Material: wie bei der konventionellen PCR aber zusätzlich eine Sonde (Taqman probe) Labortechniken (2) Funktionsweise der Hydrolyse-Sonden 1. die synthetische Einheit der Taq-Polymerase synthetisiert den Gegenstrang 2. die Taq-Polymerase stößt auf die Sonde, die anschließend durch die Nuklease-Einheit der Taq-Polymerase hydrolysiert wird 3. durch die räumliche Trennung von Reporter und Quencher entsteht ein Fluoreszenzsignal, das proportional zu der Menge an PCR-Produkt zunimmt

2 Amplifikationskurve (linear linear) Plateau exponientiell Realtime-PCR linear konventionelle PCR Labortechniken (2) Amplifikationskurve (linear log) threshold (Schwellenwert) threshold cycle C t (Zyklus, bei dem die Amplifikationskurve den Schwellenwert kreuzt)

3 Amplifikationskurve (linear log) Standards Anzahl Moleküle Labortechniken (2) Standardgerade (C t vs. log c 0 ) Effektivität = 10 (-1/slope) -1 (100% Eff. bei einer Steigung von -3,34) C t = m log(c) + b c = 10 (C t-b)/m

4 Bericht (Report) Labortechniken (2) 7300 Realtime PCR System

5 7300 Realtime PCR System - Schublade Labortechniken (2) Pyrosequencing-Reaktion (1) 1. PCR mit einem biotinyliertem Primer Biotin 2. Denaturierung des PCR-Amplifikates Biotin 3. Binden des biotinylierten DNA-Stranges an Streptavidin-Kügelchen Kügelchen Biotin Streptavidin Sequenzierungsprimer

6 Pyrosequencing-Reaktion (2) Labortechniken (2) Film ab!

7 PyroMark ID Labortechniken (2) PyroMark ID - Cartridgehalterung

8 PyroMark ID Einheit für Mikrotiterplatte Mikrosatellitenanalyse

9 Genom Viele höhere Organismen besitzen während der Hauptphase ihrer Entwicklung einen diploiden Chromosomensatz, d.h. die Zellen enthalten jedes Chromosom in zweifacher Ausfertigung (eines von jedem Elternteil). Dabei handelt es sich in der Regel nicht um identische Kopien: Zwar passen beide hinsichtlich Form, Struktur und der Abfolge der Genorte genau zueinander - darum spricht man von homologen (gleichartigen) Chromosomen die Gene selbst jedoch können in verschiedenen Ausführungen (Allelen) vorliegen. Kodierende/ nicht kodierende Bereiche

10 Mikrosatelliten nicht kodierende, repetitive DNA-Sequenzen (Bsp.: CACACACACA) wiederholter Abschnitt: 2-6 Basenpaare Anzahl der Wiederholungen= stark variabel (hohe Mutationsrate): - Beeinflussung der Gesamtlänge des MS - geeignet als Genmarker Anwendung Vaterschaftsnachweis, Bestimmung des Verwandtschaftsgrades Kopplungsanalyse Genomkartierung, u.a.

11 Beispiel: Vaterschaftsnachweis Primer Suche nach einem MS im Genom flankierende Sequenzen beidseits des MS= Primer einmalig an diesem einen Locus=> funktionieren für jedes Individuum einer Spezies forward- Primer GATCTCTCTCTGTCTTATCTACACACACACACACACACACACAC ACACACACACACACACACACACACAGAGCTTTGGCCCTCCG AAGAGTTCTCTCAGGGCTAAGAAAGGACGAGGTTGATGTCT GAACACCTAACAAAGCGTAACCTCGTCCTTTCTTAGCC reverse-primer

12 Verfahren 1. Der DNA- Abschnitt, der den MS enthält, wird mittels PCR amplifiziert (Primer) 2. Die Größe des Amplifikats hängt ab von der Anzahl der Wdh. innerhalb des MS 3. Das Amplifikat wird auf ein Gel aufgetragen und eine Gelelektrophorese durchgeführt (Auftrennung der DNA- Fragmente nach Größe) 4. Normalerweise: 2 Allele für alle MS gibt es einen Unterschied i.d. Anzahl der Wiederholungen zwischen diesen beiden Allelen, erscheinen 2 separate Banden auf dem Gel

13 In vitro- Ergebnisse heterozygot homozygot Multiplex- PCR Längenstandard Null- Allel QTL- Analyse Phänotyp: Zusammenspiel verschiedener Gene unterschiedlich starker Einfluß der jeweiligen Gene Ziel: Identifikation der Gene mit möglichst großem Einfluß Beispiel Krankheitsresistenz: Phänotyp= resistente/ empfindliche Tiere

14 Rolle der Mikrosatelliten bei der QTL- Analyse Klärung des Erbganges: Taucht ein Mikrosatellit stets bei Tieren mit einem bestimmten Phänotyp auf, ist davon auszugehen, daß ein für diesen Phänotyp verantwortliches Gen gemeinsam mit dem Mikrosatellit vererbt wird (Kopplung) Da Lokalisation der Mikrosatelliten bekannt => ungefähre Lokalisation des relevanten Gens auf dem Chromosom Prüfung: Welche Gene liegen in diesem Bereich des Chromosoms? Vielen Dank für die Aufmerksamkeit!

Die Erbinformation ist in Form von Chromosomen = Kopplungsgruppen organisiert

Die Erbinformation ist in Form von Chromosomen = Kopplungsgruppen organisiert Die Erbinformation ist in Form von Chromosomen = Kopplungsgruppen organisiert Chromosom Chromatin Ausschnitt aus DNA-Doppelhelix Nukleosomen (Chromatin) Chromatinfaden höherer Ordnung Teil eines Chromosoms

Mehr

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase Folie GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse Erste Lernphase: Aneignungsphase Erarbeiten Sie in Ihrer Expertengruppe die Inhalte eines der vier Textabschnitte (2.1, 2.2, 3.1, 3.2).

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems

Mehr

Integron und Integrase

Integron und Integrase Integron und Integrase Ein Versuch zum Nachweis von Antibiotikaresistenzen. Ein NUGI-Projekt am Albert-Einstein-Gymnasium, Wiblingen These Der Einsatz von Antibiotika führt zu einer erhöhten Resistenzbildung

Mehr

Restriktion und Gentechnik

Restriktion und Gentechnik Restriktion und Gentechnik Einteilung 1.) Restriktion - Restriktionsenzyme - Southern Blotting 2.)Gentechnik - sticky ends - blunt ends Restriktion Grundwerkzeuge der Gentechnik - Restriktionsenzymanalyse

Mehr

DNA-Analytik. Beispiel: Nachweis von gentechnisch veränderten Lebensmitteln

DNA-Analytik. Beispiel: Nachweis von gentechnisch veränderten Lebensmitteln DNA-Analytik Beispiel: Nachweis von gentechnisch veränderten Lebensmitteln rdna PCR mrna RT-PCR Protein (Enzym) Immunochemie Produkt Stoffanalytik 1. Extraktion der DNA aus den Lebensmitteln 2. DNA liegt

Mehr

Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid

Mehr

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Learn4Med. Ein Gen steuert die Haarfarbe einer Katze. Es gibt ein Allel (also eine Version) für ein schwarzes Fell und ein Allel für rote Haare.

Learn4Med. Ein Gen steuert die Haarfarbe einer Katze. Es gibt ein Allel (also eine Version) für ein schwarzes Fell und ein Allel für rote Haare. 1. Mendelsche Regeln Bei Mendel ist ein Gen als Teil des Erbmaterials definiert, der für die Ausbildung eines bestimmten Merkmals verantwortlich ist. Gibt es für dieses Gen verschiedene Ausprägungen, nennt

Mehr

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Seminar Molecular Computing Bild: http://creatia2013.files.wordpress.com/2013/03/dna.gif Andreas Fehn 11. Juli 2013 Gliederung 1. Problemstellung

Mehr

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Diskrete dynamische Systeme in der Populationsgenetik Hofbauer J., und Sigmund K.: Evolutionary Games and Population Dynamics, Cambridge

Diskrete dynamische Systeme in der Populationsgenetik Hofbauer J., und Sigmund K.: Evolutionary Games and Population Dynamics, Cambridge Diskrete dynamische Systeme in der Populationsgenetik Hofbauer J., und Sigmund K.: Evolutionary Games and Population Dynamics, Cambridge Dominik Urig Saarbrücken, den 10.01.2012 Inhaltsangabe 1 Biologische

Mehr

Gentechnik in Lebens- und Futtermitteln

Gentechnik in Lebens- und Futtermitteln BfR - Jubiläum FEDERAL INSTITUTE FOR RISK ASSESSMENT Gentechnik in Lebens- und Futtermitteln Dr. Jutta Zagon Produktidentität, Rückverfolgbarkeit und Neuartige Lebensmittel Thielallee 88-92, 14195 Berlin

Mehr

DNA-Fingerprint. (Syn. DNA Profiling)

DNA-Fingerprint. (Syn. DNA Profiling) DNA-Fingerprint (Syn. DNA Profiling) Dient dazu Individuen genetisch zu unterscheiden Dazu braucht man genetischen Polymorphismus (Bsp. Blutgruppen-Polymorphismus/Landsteiner). Als Polymorphismus ( Vielgestaltigkeit

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Molekularbiologische Laboruntersuchungen. Labormedizinvorlesung Krisztina Káldi

Molekularbiologische Laboruntersuchungen. Labormedizinvorlesung Krisztina Káldi Molekularbiologische Laboruntersuchungen Labormedizinvorlesung 03.04.2017 Krisztina Káldi Ziel der molekularbiologischen Laboruntersuchungen Untersuchungen der DNA-Struktur und der Expression von RNA 3,2

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Zellzyklus G 1 Phase: postmitotische Phase oder Präsynthesephase Zelle beginnt wieder zu wachsen

Mehr

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP Informationsveranstaltung Heimtierfuttermittel PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln C. Haldemann, ALP Grundidee des Nachweises von GVOs mittels PCR Die Bestimmung genveränderter

Mehr

DNA versus RNA. RNA Instabilität

DNA versus RNA. RNA Instabilität DNA versus RNA DNA stellt den eigentlichen Speicher genetischer Information dar, während RNA als Informationsüberträger und katalytisch in der Proteinbiosynthese agiert. Warum dient DNA und nicht RNA als

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

Mendel Gregor Mendel (*1822, 1884)

Mendel Gregor Mendel (*1822, 1884) Mendel Gregor Mendel (*1822, 1884) Mendels Vererbungsregeln 1. Mendel sche Regel Kreuzt man zwei reinerbige Rassen, die sich in einem Allelpaar unterscheiden, so sind die Nachkommen die erste Filialgeneration

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

Grundlagen der Vererbungslehre

Grundlagen der Vererbungslehre Grundlagen der Vererbungslehre Zucht und Fortpflanzung Unter Zucht verstehen wir die planvolle Verpaarung von Elterntieren, die sich in ihren Rassemerkmalen und Nutzleistungen ergänzen zur Verbesserung

Mehr

1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli:

1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli: 1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli: Übung 7 - DnaA bindet an 13 bp DNA Sequenz (DnaA Box, 5 Wiederholungen bei E. coli) im oric ori wird in AT reicher

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter. Novartis Schullabor

SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter. Novartis Schullabor SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter Novartis Schullabor 2014 Herausgeber Novartis Pharma AG, CH-4002 Basel Kontaktadresse: Novartis Pharma AG Dr. Gesche Standke Dr. Christiane

Mehr

Merkmal "Amelogenin" ist geschlechtsspezifisch, für eine zusätzliche Kontrolle des Ergebnisses.

Merkmal Amelogenin ist geschlechtsspezifisch, für eine zusätzliche Kontrolle des Ergebnisses. Vaterschaftstest 1. Methode Ausgangspunkt Ausgangspunkt der Untersuchung ist die Erstellung des genetischen Profils ("Fingerprints"), der bei jedem Mensch einzigartig ist. Hierfür werden sogenannte STR

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Gregor Mendel. Gregor Mendel

Gregor Mendel. Gregor Mendel Gregor Mendel * 1822 in Brünn Studium der Physik, Mathematik u. Naturwissenschaften an der Univ. Wien Rückkehr nach Brünn in das Augustinerkloster 1857: Beginn der Experimente zur Vererbung 1865: Publikation

Mehr

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei

Mehr

Pinschertage der OG Bonn Grundlagen der Zucht

Pinschertage der OG Bonn Grundlagen der Zucht Pinschertage der OG Bonn 31.05. - 01.06.2008 Grundlagen der Zucht von Ralf Wiechmann Der Phänotyp Ist die Gesamtheit der wahrnehmbaren Merkmale eines Organismus. das äußere Erscheinungsbild das Aussehen,

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Tutorium SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Tutorium SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Tutorium SS 2016 Fragen für die Tutoriumsstunde 5 (27.06. 01.07.) Mendel, Kreuzungen, Statistik 1. Sie bekommen aus

Mehr

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom HAMBURG SCHOOL OF FOOD SCIENCE Institut für Lebensmittelchemie Universität Hamburg, AiF/

Mehr

Molekularbiologische Methoden

Molekularbiologische Methoden Molekularbiologische Methoden im Lebensmittel-Labor Dr. rer. nat. Armin Pahl LADR GmbH MVZ Dr. Kramer & Kollegen 04152 803-0 www.ladr.de DNA 1866 Gregor Mendel veröffentlicht seine Versuche über Pflanzen-Hybriden,

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben

Mehr

Grundlagen der Vererbung beim Hund

Grundlagen der Vererbung beim Hund Grundlagen der Vererbung beim Hund Züchterstammtisch: 10. August 2013 Referentin: Diana Ringpfeil Tätigkeit: Tierärztin Mail: Ringpfeil@arcor.de Referent: Kay Rostalski Diana Ringpfeil, Tierärztin, Kay

Mehr

Chromosomendarstellung und -identifizierung

Chromosomendarstellung und -identifizierung Chromosomendarstellung und -identifizierung Bei den 46 Chromosomen des Menschen unterscheidet man 22 homologe Autosomenpaare und 2 Geschlechtschromosomen, das homologe XX-Paar im weiblichen und das nicht-homologe

Mehr

Molekulare Genetik und Zellbiologie. Versuch 5 Präparation und Amplifikation menschlicher DNA. DNA Fingerprint VNTR-Analyse

Molekulare Genetik und Zellbiologie. Versuch 5 Präparation und Amplifikation menschlicher DNA. DNA Fingerprint VNTR-Analyse Molekulare Genetik und Zellbiologie Versuch 5 Präparation und Amplifikation menschlicher DNA DNA Fingerprint VNTR-Analyse Menschliche Genom 3000 Mb Gene und Gen-verwandte Sequenzen 900 Mb (30%) Extragene

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

Typ eines Gens oder jede Abweichung der DNA-Sequenz eines Gens. Heterozygot verschiedene Allele in der Zygote (= diploide Zelle)

Typ eines Gens oder jede Abweichung der DNA-Sequenz eines Gens. Heterozygot verschiedene Allele in der Zygote (= diploide Zelle) Die Klausur besteht aus insgesamt 11 Seiten (1 Deckblatt + 10 Seiten). Bitte geben Sie auf jeder Seite Ihren Namen oben rechts an. Bei der Korrektur können nur solche Seiten berücksichtigt werden, die

Mehr

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke PCR-ELISA Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke Luitgardis Seigner und Stefan Knabel * Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz * Ehemaliger

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Regeln zur Vererbung Autosomal rezessiv: - Merkmal tritt auf in Nachkommen nicht betroffener Eltern

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung In Zusammenarbeit mit Katharina Mumm, Alexander Prange Gewinnung des Hefe - Bakterienisolates

Mehr

Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183

Mehr

Multiplex-Teste in der Virologie neue Antworten, aber auch neue Fragen

Multiplex-Teste in der Virologie neue Antworten, aber auch neue Fragen 18.08.2011 Multiplex-Teste in der Virologie neue Antworten, aber auch neue Fragen Jürgen Rissland Institut für Virologie/Staatliche Medizinaluntersuchungsstelle Struktur Multiplex-Verfahren: Technik und

Mehr

Sinnvoller Umgang mit DNA-Tests

Sinnvoller Umgang mit DNA-Tests Sinnvoller Umgang mit DNA-Tests - Eine Zuchtmethode - - Kleine Hundepopulation - Helga Eichelberg Welpenstatistik Eingetragene Welpen 2006 2005 2004 Pinscher 384 237 246 ca. 80 Würfe Zwerge 197 250 251

Mehr

Erstellt vom Unterausschuss Methodenentwicklung der LAG, März 2006 Status: verabschiedet

Erstellt vom Unterausschuss Methodenentwicklung der LAG, März 2006 Status: verabschiedet Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Real-Time PCR zur quantitativen Bestimmung gentechnisch veränderter Rapslinien mit dem 35S/pat-Genkonstrukt Erstellt vom Unterausschuss

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats Das humane Genom satellites and single repeats protein coding & non-protein coding mobile (transposable) DNA elements Alle Genome sind individuell, selbst jene eineiiger Zwillinge! 1 Variationen im humanen

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

Molekulargenetische Diagnostik und genetische Beratung bei vererbten neurologischen Krankheiten

Molekulargenetische Diagnostik und genetische Beratung bei vererbten neurologischen Krankheiten Molekulargenetische Diagnostik und genetische Beratung bei vererbten neurologischen Krankheiten M. Hergersberg Institut für Medizinische Genetik der Universität Zürich Originalarbeit Summary Hergersberg

Mehr

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Einführung in die Grundlagen der Genetik Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Molekularbiologische Grundlagen Die Zelle ist die grundlegende, strukturelle und funktionelle

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -

Mehr

Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur

Mehr

Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien

Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring Elisabeth Haring Naturhistorisches Museum Wien Sieben Jahre genetisches Monitoring der niederösterreichisch-steirischen

Mehr

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen Molekulare Spurenanalytik und Abstammungsbegutachtung Spurenanalytik Ziel: Identifikation Also die Zuordnung einer bestimmten Spur zu einer bestimmten Person! Denn Spuren bei einer forensischen Untersuchung

Mehr

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Überblick Einleitung und Zielstellung Was ist ein Marker? Analyse mit Mikrosatelliten-Markern

Mehr

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran

Mehr

Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA

Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA Von der Naturwissenschaftlichen Fakultät der Technischen Universität Carolo-Wilhelmina zu

Mehr

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel).

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel). Mendelsche Regeln 1 + 2 (1) Merkmale wie die Blütenfarbe können dominant-rezessiv oder intermediär vererbt werden. Bei einem intermediären Erbgang wird die Merkmalsausprägung von beiden Allelen (z. B.

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

Der Genetische Fingerabdruck von heute erklärt - Mit kleinen Übungsaufgaben.

Der Genetische Fingerabdruck von heute erklärt - Mit kleinen Übungsaufgaben. Der Genetische Fingerabdruck von heute erklärt - Mit kleinen Übungsaufgaben. Im unteren Bild sieht man ein Beispiel eines modernen genetischen Fingerabdruckes. Man sieht eine Menge bunter Spitzen mit Nummern.

Mehr

3 Ergebnisse. 3.1 Mutationen im MYBPC3-Gen. 28 Ergebnisse

3 Ergebnisse. 3.1 Mutationen im MYBPC3-Gen. 28 Ergebnisse 28 Ergebnisse 3 Ergebnisse 3.1 Mutationen im MYBPC3-Gen Bei einem Patientenkollektiv von insgesamt 46 unverwandten Patienten mit dilatativer Kardiomyopathie (DCM) wurde eine systematische Mutationssuche

Mehr

DiversiLab TM Schnelle und reproduzierbare Stammtypisierung

DiversiLab TM Schnelle und reproduzierbare Stammtypisierung DIVERSILABTM DiversiLab TM Schnelle und reproduzierbare Stammtypisierung 2/24 Weshalb Stammtypisierung? Eine Stammtypisierung dient nicht zur Identifizierung eines Erregers sondern um abzuklären, ob zwei

Mehr

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch (Fotos vom 6. März 2013 Molekularbiologisches Praktikum 12 G-Kurs Biologie Herr Korne - am KOMM Homburg/Saar unter Anleitung von Frau Dr. Amoroso)

Mehr

Genetik einmal anders erklårt:

Genetik einmal anders erklårt: Genetik einmal anders erklårt: Die Gene sind an allem Schuld! Warum sind manche Menschen groä und andere klein, manche haben blondes, glattes andere gelocktes, braunes Haar? Die Gene sind an allem Schuld.

Mehr

PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO)

PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO) Nr.: V-011 PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO) Egert, Michael, Dr. (LUFA Nord-West Institut für Futtermittel, Oldenburg); Einleitung Die Gentechnik eröffnet für die

Mehr

Genetische Epidemiologie. Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation

Genetische Epidemiologie. Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation Genetische Epidemiologie Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation Definition A science that deals with etiology, distribution, and control of disease in groups

Mehr

Lokalisation von Genen

Lokalisation von Genen Lokalisation von Genen Lernziele Kernpunkte zur Prüfung Lernziele/Kernpunkte: Die Methoden zur Kartierung von Genen (genetisch oder physikalisch) können erläutert werden. Die Bedeutung von Genkarten und

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

Gentechnik/Gentechnologie

Gentechnik/Gentechnologie Gentechnik/Gentechnologie Bei zelltechnischen Verfahren werden Gene wenn überhaupt, dann nur im Gesamtverband, also als ganzes Genom verschoben oder kombiniert. Bei Gentechnologischen Verfahren wird in

Mehr

F2 aus der Kreuzung mit der ersten Mutante: 602 normal, 198 keine Blatthaare

F2 aus der Kreuzung mit der ersten Mutante: 602 normal, 198 keine Blatthaare Klausur Genetik Name: Matrikelnummer: Sie haben 90 Minuten Zeit zur Bearbeitung der 23 Fragen (z. T. mit Unterpunkten). Insgesamt sind 42 Punkte zu vergeben. Die Klausur gilt als bestanden, falls 21 Punkte

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen

Mehr

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen.

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. Kapitel 9 Genetische Variation Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. 9a Genetische Variation

Mehr