Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Größe: px
Ab Seite anzeigen:

Download "Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR"

Transkript

1 Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher Material: wie bei der konventionellen PCR aber zusätzlich eine Sonde (Taqman probe) Labortechniken (2) Funktionsweise der Hydrolyse-Sonden 1. die synthetische Einheit der Taq-Polymerase synthetisiert den Gegenstrang 2. die Taq-Polymerase stößt auf die Sonde, die anschließend durch die Nuklease-Einheit der Taq-Polymerase hydrolysiert wird 3. durch die räumliche Trennung von Reporter und Quencher entsteht ein Fluoreszenzsignal, das proportional zu der Menge an PCR-Produkt zunimmt

2 Amplifikationskurve (linear linear) Plateau exponientiell Realtime-PCR linear konventionelle PCR Labortechniken (2) Amplifikationskurve (linear log) threshold (Schwellenwert) threshold cycle C t (Zyklus, bei dem die Amplifikationskurve den Schwellenwert kreuzt)

3 Amplifikationskurve (linear log) Standards Anzahl Moleküle Labortechniken (2) Standardgerade (C t vs. log c 0 ) Effektivität = 10 (-1/slope) -1 (100% Eff. bei einer Steigung von -3,34) C t = m log(c) + b c = 10 (C t-b)/m

4 Bericht (Report) Labortechniken (2) 7300 Realtime PCR System

5 7300 Realtime PCR System - Schublade Labortechniken (2) Pyrosequencing-Reaktion (1) 1. PCR mit einem biotinyliertem Primer Biotin 2. Denaturierung des PCR-Amplifikates Biotin 3. Binden des biotinylierten DNA-Stranges an Streptavidin-Kügelchen Kügelchen Biotin Streptavidin Sequenzierungsprimer

6 Pyrosequencing-Reaktion (2) Labortechniken (2) Film ab!

7 PyroMark ID Labortechniken (2) PyroMark ID - Cartridgehalterung

8 PyroMark ID Einheit für Mikrotiterplatte Mikrosatellitenanalyse

9 Genom Viele höhere Organismen besitzen während der Hauptphase ihrer Entwicklung einen diploiden Chromosomensatz, d.h. die Zellen enthalten jedes Chromosom in zweifacher Ausfertigung (eines von jedem Elternteil). Dabei handelt es sich in der Regel nicht um identische Kopien: Zwar passen beide hinsichtlich Form, Struktur und der Abfolge der Genorte genau zueinander - darum spricht man von homologen (gleichartigen) Chromosomen die Gene selbst jedoch können in verschiedenen Ausführungen (Allelen) vorliegen. Kodierende/ nicht kodierende Bereiche

10 Mikrosatelliten nicht kodierende, repetitive DNA-Sequenzen (Bsp.: CACACACACA) wiederholter Abschnitt: 2-6 Basenpaare Anzahl der Wiederholungen= stark variabel (hohe Mutationsrate): - Beeinflussung der Gesamtlänge des MS - geeignet als Genmarker Anwendung Vaterschaftsnachweis, Bestimmung des Verwandtschaftsgrades Kopplungsanalyse Genomkartierung, u.a.

11 Beispiel: Vaterschaftsnachweis Primer Suche nach einem MS im Genom flankierende Sequenzen beidseits des MS= Primer einmalig an diesem einen Locus=> funktionieren für jedes Individuum einer Spezies forward- Primer GATCTCTCTCTGTCTTATCTACACACACACACACACACACACAC ACACACACACACACACACACACACAGAGCTTTGGCCCTCCG AAGAGTTCTCTCAGGGCTAAGAAAGGACGAGGTTGATGTCT GAACACCTAACAAAGCGTAACCTCGTCCTTTCTTAGCC reverse-primer

12 Verfahren 1. Der DNA- Abschnitt, der den MS enthält, wird mittels PCR amplifiziert (Primer) 2. Die Größe des Amplifikats hängt ab von der Anzahl der Wdh. innerhalb des MS 3. Das Amplifikat wird auf ein Gel aufgetragen und eine Gelelektrophorese durchgeführt (Auftrennung der DNA- Fragmente nach Größe) 4. Normalerweise: 2 Allele für alle MS gibt es einen Unterschied i.d. Anzahl der Wiederholungen zwischen diesen beiden Allelen, erscheinen 2 separate Banden auf dem Gel

13 In vitro- Ergebnisse heterozygot homozygot Multiplex- PCR Längenstandard Null- Allel QTL- Analyse Phänotyp: Zusammenspiel verschiedener Gene unterschiedlich starker Einfluß der jeweiligen Gene Ziel: Identifikation der Gene mit möglichst großem Einfluß Beispiel Krankheitsresistenz: Phänotyp= resistente/ empfindliche Tiere

14 Rolle der Mikrosatelliten bei der QTL- Analyse Klärung des Erbganges: Taucht ein Mikrosatellit stets bei Tieren mit einem bestimmten Phänotyp auf, ist davon auszugehen, daß ein für diesen Phänotyp verantwortliches Gen gemeinsam mit dem Mikrosatellit vererbt wird (Kopplung) Da Lokalisation der Mikrosatelliten bekannt => ungefähre Lokalisation des relevanten Gens auf dem Chromosom Prüfung: Welche Gene liegen in diesem Bereich des Chromosoms? Vielen Dank für die Aufmerksamkeit!

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion

Mehr

DNA-Fingerprint. (Syn. DNA Profiling)

DNA-Fingerprint. (Syn. DNA Profiling) DNA-Fingerprint (Syn. DNA Profiling) Dient dazu Individuen genetisch zu unterscheiden Dazu braucht man genetischen Polymorphismus (Bsp. Blutgruppen-Polymorphismus/Landsteiner). Als Polymorphismus ( Vielgestaltigkeit

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase Folie GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse Erste Lernphase: Aneignungsphase Erarbeiten Sie in Ihrer Expertengruppe die Inhalte eines der vier Textabschnitte (2.1, 2.2, 3.1, 3.2).

Mehr

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter. Novartis Schullabor

SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter. Novartis Schullabor SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter Novartis Schullabor 2014 Herausgeber Novartis Pharma AG, CH-4002 Basel Kontaktadresse: Novartis Pharma AG Dr. Gesche Standke Dr. Christiane

Mehr

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems

Mehr

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Seminar Molecular Computing Bild: http://creatia2013.files.wordpress.com/2013/03/dna.gif Andreas Fehn 11. Juli 2013 Gliederung 1. Problemstellung

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

DNA versus RNA. RNA Instabilität

DNA versus RNA. RNA Instabilität DNA versus RNA DNA stellt den eigentlichen Speicher genetischer Information dar, während RNA als Informationsüberträger und katalytisch in der Proteinbiosynthese agiert. Warum dient DNA und nicht RNA als

Mehr

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP Informationsveranstaltung Heimtierfuttermittel PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln C. Haldemann, ALP Grundidee des Nachweises von GVOs mittels PCR Die Bestimmung genveränderter

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats Das humane Genom satellites and single repeats protein coding & non-protein coding mobile (transposable) DNA elements Alle Genome sind individuell, selbst jene eineiiger Zwillinge! 1 Variationen im humanen

Mehr

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom HAMBURG SCHOOL OF FOOD SCIENCE Institut für Lebensmittelchemie Universität Hamburg, AiF/

Mehr

Gentechnik in Lebens- und Futtermitteln

Gentechnik in Lebens- und Futtermitteln BfR - Jubiläum FEDERAL INSTITUTE FOR RISK ASSESSMENT Gentechnik in Lebens- und Futtermitteln Dr. Jutta Zagon Produktidentität, Rückverfolgbarkeit und Neuartige Lebensmittel Thielallee 88-92, 14195 Berlin

Mehr

Chromosomendarstellung und -identifizierung

Chromosomendarstellung und -identifizierung Chromosomendarstellung und -identifizierung Bei den 46 Chromosomen des Menschen unterscheidet man 22 homologe Autosomenpaare und 2 Geschlechtschromosomen, das homologe XX-Paar im weiblichen und das nicht-homologe

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Molekularbiologische Methoden

Molekularbiologische Methoden Molekularbiologische Methoden im Lebensmittel-Labor Dr. rer. nat. Armin Pahl LADR GmbH MVZ Dr. Kramer & Kollegen 04152 803-0 www.ladr.de DNA 1866 Gregor Mendel veröffentlicht seine Versuche über Pflanzen-Hybriden,

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

MOLEKULARBIOLOGISCHE METHODEN

MOLEKULARBIOLOGISCHE METHODEN 45 MOLEKULARBIOLOGISCHE METHODEN Die Technik der DNA-Rekombination, auch als Gentechnik bezeichnet, erlaubt die Isolierung von DNA-Abschnitten (genomische oder cdna), deren Sequenzbestimmung, Modifikation

Mehr

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen Molekulare Spurenanalytik und Abstammungsbegutachtung Spurenanalytik Ziel: Identifikation Also die Zuordnung einer bestimmten Spur zu einer bestimmten Person! Denn Spuren bei einer forensischen Untersuchung

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

Molekulargenetische Diagnostik und genetische Beratung bei vererbten neurologischen Krankheiten

Molekulargenetische Diagnostik und genetische Beratung bei vererbten neurologischen Krankheiten Molekulargenetische Diagnostik und genetische Beratung bei vererbten neurologischen Krankheiten M. Hergersberg Institut für Medizinische Genetik der Universität Zürich Originalarbeit Summary Hergersberg

Mehr

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei

Mehr

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Überblick Einleitung und Zielstellung Was ist ein Marker? Analyse mit Mikrosatelliten-Markern

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen.

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. Kapitel 9 Genetische Variation Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. 9a Genetische Variation

Mehr

Grundlagen der Vererbung beim Hund

Grundlagen der Vererbung beim Hund Grundlagen der Vererbung beim Hund Züchterstammtisch: 10. August 2013 Referentin: Diana Ringpfeil Tätigkeit: Tierärztin Mail: Ringpfeil@arcor.de Referent: Kay Rostalski Diana Ringpfeil, Tierärztin, Kay

Mehr

Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien

Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring Elisabeth Haring Naturhistorisches Museum Wien Sieben Jahre genetisches Monitoring der niederösterreichisch-steirischen

Mehr

Molekulargenetische Abstammungsbegutachtung

Molekulargenetische Abstammungsbegutachtung Molekulargenetische Abstammungsbegutachtung 1 Lernziele - Schwerpunkte Sinn und Bedeutung der Abstammungsbegutachtung (am Beispiel des Hundes) Ablauf, Durchführung und Auswertung der Mikrosatelliten-Analyse

Mehr

Lokalisation von Genen

Lokalisation von Genen Lokalisation von Genen Lernziele Kernpunkte zur Prüfung Lernziele/Kernpunkte: Die Methoden zur Kartierung von Genen (genetisch oder physikalisch) können erläutert werden. Die Bedeutung von Genkarten und

Mehr

Erstellt vom Unterausschuss Methodenentwicklung der LAG, März 2006 Status: verabschiedet

Erstellt vom Unterausschuss Methodenentwicklung der LAG, März 2006 Status: verabschiedet Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Real-Time PCR zur quantitativen Bestimmung gentechnisch veränderter Rapslinien mit dem 35S/pat-Genkonstrukt Erstellt vom Unterausschuss

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR

GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR Experimentierkit für den Biologieunterricht in der Oberstufe an Gymnasien Lehrerhandbuch Entwickelt in Zusammenarbeit mit dem Oberschulamt

Mehr

3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark

Mehr

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet

Mehr

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung In Zusammenarbeit mit Katharina Mumm, Alexander Prange Gewinnung des Hefe - Bakterienisolates

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen

Mehr

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Unter Next Generation Sequencing (NGS) werden verschiedene neue Technologien zusammengefasst, die nicht auf kapillar basierenden Sequenzierautomaten beruhen. Das 1990 ins Leben

Mehr

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA 3 Ergebnisse 3.1 Isolierung von leukozytärer Gesamt-RNA Um Ausgangsmaterial zur Isolierung von CD44-RNA zu erhalten, wurde aus einem Buffy coat (siehe Abschnitt Materialen und Methoden ) der Leukozytenanteil

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO)

PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO) Nr.: V-011 PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO) Egert, Michael, Dr. (LUFA Nord-West Institut für Futtermittel, Oldenburg); Einleitung Die Gentechnik eröffnet für die

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34 Ergebnisse 34 3 Ergebnisse 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC 3.1.1 Nachweis auf RNA-Ebene Zum Nachweis der Transkription des y + -Systems in kutanen Zellen, wurden

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Kapitel 3. Populationsgenetik: Gene und ihre Frequenzen

Kapitel 3. Populationsgenetik: Gene und ihre Frequenzen 701-245-00L Pop - & Evol biol - 25 - Kap. 3: Populationsgenetik Kapitel 3 Populationsgenetik: Gene und ihre Frequenzen 3.1 Populationsgenetik Mikroevolutive Prozesse bilden die Grundlage allen Evolutionsgeschehens.

Mehr

3.1.1 Bedeutung und Häufigkeit von DNA-Polymorphismen und ihre Darstellung mittels genetischer Marker: RFLP-Marker, SSLP-Marker und IRS-PCR-Marker

3.1.1 Bedeutung und Häufigkeit von DNA-Polymorphismen und ihre Darstellung mittels genetischer Marker: RFLP-Marker, SSLP-Marker und IRS-PCR-Marker III. Ergebnisse 3.1 Segregationsanalyse von DNA-Polymorphismen 3.1.1 Bedeutung und Häufigkeit von DNA-Polymorphismen und ihre Darstellung mittels genetischer Marker: RFLP-Marker, SSLP-Marker und IRS-PCR-Marker

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

2. DNA-Fingerprinting

2. DNA-Fingerprinting Obwohl die Untersuchung von Mikrosatelliteninstabilität und LOH nicht Ziel der vorliegenden Arbeit war, kann es im Rahmen der Vaterschaftsbegutachtung dazu kommen, dass von einem verstorbenen Putativvater

Mehr

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke PCR-ELISA Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke Luitgardis Seigner und Stefan Knabel * Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz * Ehemaliger

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Polymerase-Kettenreaktion (PCR) Die Polymerase-Kettenreaktion (englisch Polymerase Chain Reaction, PCR) ist eine

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

Teilprojekt: Microbial Source Tracking Technologiezentrum Wasser Abteilung Umweltbiotechnologie & Altlasten C. Stoll, Dr. A. Tiehm Ziele Mikrobiologisches Monitoring am Standort - Mikroorganismen im Kulturverfahren

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

SNPs, Indels, VNTRs. Gründe für ein Interesse an der genetischen Diversität

SNPs, Indels, VNTRs. Gründe für ein Interesse an der genetischen Diversität Genetische Diversität: SNPs, Indels, VNTRs Gründe für ein Interesse an der genetischen Diversität Aufklärung der Geschichte von Populationen (Migrationen, demographische Ereignisse) Forensik / Aussagen

Mehr

Forensische Genetik. Universitätsklinikum Essen. Institut für Rechtsmedizin. Forensische Spurenanalytik und Abstammungsbegutachtung

Forensische Genetik. Universitätsklinikum Essen. Institut für Rechtsmedizin. Forensische Spurenanalytik und Abstammungsbegutachtung Universitätsklinikum Essen Institut für Rechtsmedizin Forensische Genetik Forensische Spurenanalytik und Abstammungsbegutachtung Prof. Dr. rer. nat. Micaela Poetsch Forensische Spurenanalytik Ziel: Identifikation

Mehr

1.Theoretischer Hintergrund

1.Theoretischer Hintergrund 1.Theoretischer Hintergrund Die Molekularbiologie oder Molekulargenetik befasst sich mit den zellulären Vorgängen bei der Vervielfältigung, Übertragung und Expression des genetischen Materials. Bei der

Mehr

"Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II)

Gentechnik II - Identifizierungsmethoden (Biologie Sek. II) Inhalt und Einsatz im Unterricht "Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II) Diese DVD behandelt das Unterrichtsthema "Gentechnik" für die Sekundarstufe II. Das DVD-Hauptmenü bietet folgende

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Thüringer Landesanstalt für Landwirtschaft

Thüringer Landesanstalt für Landwirtschaft Thüringer Landesanstalt für Landwirtschaft Quantitative Bestimmung transgener Bestandteile in Pflanzen, Saatgut und Futtermitteln Dr. S. Domey März 2008 Thüringer Ministerium für Landwirtschaft, Naturschutz

Mehr

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert

Mehr

Chromosomen & Populationsgenetik (1)

Chromosomen & Populationsgenetik (1) Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: 1 Karyogramme Chromosomen & Populationsgenetik (1) Bestimmen Sie den Karyotyp der folgenden

Mehr

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61 Tier-Biotechnologie Inhaltsverzeichnis Vorwort. 9 Mitarbeiter. 10 Einführung in die Tier-Biotechnologie. 11 Teil I: Zellkultur- und Bioverfahrenstechniken. 23 1 Kultivierung tierischer Zellen. 25 1.1 Voraussetzungen

Mehr

Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Definition: Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: Einführung Übung Bitte bereiten Sie folgende Probleme vor der Übung am Mittwoch. Die Klausur

Mehr

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Stefan-Marcel Loitsch, Christian von Mallinckrodt, Tim Hirche, Thomas OF Wagner Pneumologie und Allergologie, Medizinische Klinik

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Gentechnik: Dem genetischen Fingerabdruck auf der Spur Das komplette Material finden Sie hier: School-Scout.de 8.-11. Schuljahr Dipl.-Bio.

Mehr

Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur

Mehr

Funktionelle Genomik. praktische Anwendungen

Funktionelle Genomik. praktische Anwendungen Funktionelle Genomik praktische Anwendungen Schmelzpunkt der DNA Einzelsträngige DNA absorbiert UV-Licht effektiver SYBR Green fluoresziert nur wenn es an doppelsträngiger DNA bindet Fluoreszenz erhöht

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

Themenblock Moderne Methoden in der. Vortrag: Markergestützte Selektion (MAS)

Themenblock Moderne Methoden in der. Vortrag: Markergestützte Selektion (MAS) Klaus Pillen, Markergestützte Selektion in der Pflanzenzüchtung, Magdeburg, 14.10.2010 1 Dialogreihe Innovationsfeld Pflanze Themenblock Moderne Methoden in der Pflanzenforschung und züchtung Vortrag:

Mehr

AGES-Webribo. Systematik in Clostridium difficile PCR-Ribotyping. Alexander Indra

AGES-Webribo. Systematik in Clostridium difficile PCR-Ribotyping. Alexander Indra AGES-Webribo Systematik in Clostridium difficile PCR-Ribotyping Alexander Indra AGES-Institut für medizinische Mikrobiologie und Hygiene Wien Nationale Referenzzentrale für Clostridium difficile Clostridium

Mehr

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 IV. Ergebnisse 90 2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 Die Konstruktion einer isogenen Toxinmutante des Stx2-produzierenden EHEC- Stamm O157:H7 86-24

Mehr

DNA-Test zur Rassebestimmung bei Windhunden

DNA-Test zur Rassebestimmung bei Windhunden DNA-Test zur Rassebestimmung bei Windhunden Dr. Barbara Wimmer, Eurofins Medigenomix GmbH www.eurofins.com Wer wir sind - Eurofins Scientific Gruppe 150 Labore in 30 Ländern in Europa, USA, Asien & Südamerika

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Diagnostische Verfahren in der Mikrobiologie: Realität oder Science-Fiction?

Diagnostische Verfahren in der Mikrobiologie: Realität oder Science-Fiction? Diagnostische Verfahren in der Mikrobiologie: Realität oder Science-Fiction? Dr. med. vet. Vladimira Hinić Klinische Mikrobiologie Universitätspital Basel 1 1. Automation in der klinischen Mikrobiologie

Mehr