Ein Blick in die Zukunft, Entwicklung neuer Testverfahren zum Nachweis von Salmonellen und Campylobacter. Dr. Janin Stratmann-Selke

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Ein Blick in die Zukunft, Entwicklung neuer Testverfahren zum Nachweis von Salmonellen und Campylobacter. Dr. Janin Stratmann-Selke"

Transkript

1 Ein Blick in die Zukunft, Entwicklung neuer Testverfahren zum Nachweis von Salmonellen und Campylobacter Dr. Janin Stratmann-Selke

2 Salmonellen und Campylobacter als Erreger von Lebensmittelinfektionen Salmonellen Campylobacter Salmonellen und Campylobacter stellen die Spitzenreiter unter den bakteriellen Erregern von Lebensmittelinfektionen beim Menschen dar alle infizierten Nutztierarten können Keimträger sein ohne klinische Erscheinungen zu zeigen nach Infektion durch Konsum erregerhaltiger Lebensmittel kann es beim Menschen, abhängig vom Alter und Immunstatus, zu schweren Durchfallerkrankungen kommen

3 Salmonellen und Campylobacter als Erreger von Lebensmittelinfektionen Eintrag von Erregern in Lebensmittel und somit Reduktion von Lebensmittelinfektionen kann nur durch eine optimale Diagnostik erzielt werden - vorbeugender Verbraucherschutz und Qualitätssicherung

4 ...die hier vorgestellten Arbeiten sind Teile des Projekts Phage Display basierte Verfahren zum direkten und indirekten Nachweis von Salmonella und Campylobacter species im Schwein In Kooperation mit der Technischen Universität Braunschweig und der Stiftung Tierärztliche Hochschule Hannover, gefördert aus Mitteln des Bundesministeriums für Bildung und Forschung im Rahmen des BioProfil Projektes Funktionelle Genomanalyse Identifizierung immunogener und oberflächenassozierter Antigene Isolierung von rekombinanten Antikörpern und Peptiden mittels Phage Display Peptid-Capture PCR zum Nachweis von Salmonellen avisierte Produkte sowie von Campylobacter jejuni und C. coli in Kot und Gülle Kompetitive ELISA zum Nachweis von Antikörpern gegen Salmonellen sowie gegen C. jejuni und C. coli in Serum und Fleischsaft

5 Entwicklung neuer Testsysteme zum indirekten Erregernachweis (ELISA) die zur Zeit verwendeten Testsysteme zum serologischen (indirekten) Nachweis von Salmonellen basieren auf LPS als Test-Antigen (Lipopolysaccharid der äußeren Membran) wenig definiertes Antigen Kreuzreaktionen falsch positive Ergebnisse, vor allem bei älteren Tieren es gibt bis dato kein kommerziell erhältliches Testsystem für den serologischen Nachweis von Campylobacter bei Nutztieren Etablierung neuer Testverfahren, basierend auf definierten Antigenen Etablierung tierartübergreifender Testsysteme - kompetitiver ELISA

6 Schritt für Schritt zum neuen Test Auswahl des geeigneten Antigens Identifizierung spezifischer Antigene über vergleichende Proteomanalyse mittels 2-dimensionaler Gelektrophorese GKNNHTRAAQ QCWKPNSSNN QRHPWQQGG TTCHQKARKL RRQWRAHHCS SLKAPTWKHQ WR... Kultivierung des Erregers Präparation der Oberflächenproteine (potentielle Antigene) Darstellung der Oberflächenproteine - nach Vergleich Auswahl potentieller Antigene Identifikation über Sequenzierung

7 Schritt für Schritt zum neuen Test Herstellung des ausgewählten Antigens Über die Sequenzierung ist ein Rückschluss auf das Antigen codierende Gen möglich dies kann dann in ein Expressionssystem eingefügt werden und so rekombinant durch E. coli exprimiert werden anschließend erfolgt die Aufreinigung und der Einsatz als Testantigen MGKNNHTRAAQQC WKPNSSNNQRHPW QQGGTTCHQKARKL RRQWRAHHCSSLKA PTWKHQWR... Proteinsequenz ATGGGTAAAAATAATCATACT CGTGCTGCTCAACAATGTTG GAAACCTAATTCTTCTAATAA TCAACGTCATCCTTGGCAACA AGGTGGTACTACTTGTCATCA AAAAGCTCGTAAACTTCGTC GTCAATGGCGTGCTCATCATT GTTCTTCTCTTAAAGCTCCTA CTTGGAAACATCAA... codierendes Gen Einschleusen des Gens in E. coli und Expression des Antigens

8 Schritt für Schritt zum neuen Test Eignungsprüfung des rekombinant hergestellten Antigens das rekombinante Antigen wird auf ELISA Platten gecoatet und mit verschiedenen Kontrollseren, sowie mit Patientenseren auf seine Eignung als Testantigen zum indirekten Erregernachweis überprüft nur infektionsrelevante, immunogene und spezifische Proteine eignen sich als Antigene ist diese Entwicklungsphase positiv abgeschlossen, so schließt sich für einen tierartspezifischen Test die Validierung an für einen tierartübergreifenden Test, sowie für höchste Sensitivität & Spezifität des Tests wird anschließend ein kompetitiver ELISA etabliert die gemessene Farbintensität ist direkt proportional zur Antikörperaktivität des Patientenserums

9 Schritt für Schritt zum neuen Test Etablierung eines kompetitiven ELISA für einen kompetitiven ELISA benötigt man zusätzlich einen Antikörper, der monospezifisch für das Antigen ist einen monospezifischen Antikörper kann man z.b. über Antikörper- Phage Display isolieren dieser konkurriert mit den Antikörpern in der Probe um die Bindung an das Antigen bei einem hohen Antikörpergehalt in der Probe wird der zweite Antikörper verdrängt da man die Bindung des monospezifischen Antikörpers nachweist, kann das Testsystem tierartübergreifend zum indirekten Erregernachweis genutzt werden

10 Schritt für Schritt zum neuen Test... positives Patientenserum negatives Patientenserum die Antigen-Bindungsstellen werden über die im Serum enthaltenen Antikörper besetzt der markierte Detektionsantikörper findet keinen Bindungspartner die Differenz der Farbintensität zwischen Eichkurve und getestetem Serum ist direkt proportional zur Antikörperaktivität kein Farbumschlag die Antigen-Bindungsstellen bleiben frei und der kompetitive monospezifische Antikörper bindet der markierte Detektionsantikörper kann binden es kommt zum Farbumschlag monospezifischer Antikörper Serum-Antikörper markierter Detektionsantikörper

11 ... der neue Test ein kompetitiver Test ermöglicht die (indirekte) tierartübergreifende Diagnose relevanter Erreger dies spielt vor allem bei Zoonoseerregern wie Campylobacter und Salmonellen eine wichtige Rolle in Hinsicht auf den vorbeugenden und nachhaltigen Verbraucherschutz sowie die Qualitätssicherung von Lebensmitteln tierischen Ursprungs eine sichere Diagnostik führt zur Reduktion von Lebensmittelinfektionen beim Menschen durch Verminderung des Erregereintrags in Lebensmittel tierischen Ursprungs

12 die Entwicklung neuer Testverfahren wird gefördert von: sie findet statt in Kooperation mit:

13 Schritt für Schritt zum neuen Test vielen Dank für ihre Aufmerksamkeit...

Erfahrungsbericht zur Eignung verschiedener ELISA Kits zum Nachweis von Antikörpern gegen Aviäre Influena für das Routinelabor

Erfahrungsbericht zur Eignung verschiedener ELISA Kits zum Nachweis von Antikörpern gegen Aviäre Influena für das Routinelabor Erfahrungsbericht zur Eignung verschiedener ELISA Kits zum Nachweis von Antikörpern gegen Aviäre Influena für das Routinelabor Dr. Hans-C. Philipp Lohmann Tierzucht GmbH Veterinär-Labor Abschnede 64 27472

Mehr

Rekombinante Antikorperfragmente fur die. Zoonosediagnostik

Rekombinante Antikorperfragmente fur die. Zoonosediagnostik Rekombinante Antikorperfragmente fur die Zoonosediagnostik Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades eines Doktors

Mehr

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke PCR-ELISA Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke Luitgardis Seigner und Stefan Knabel * Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz * Ehemaliger

Mehr

Neue diagnostische Verfahren zum Nachweis von Erregern Lebensmittelbedingter Infektionen

Neue diagnostische Verfahren zum Nachweis von Erregern Lebensmittelbedingter Infektionen FEDERAL INSTITUTE FOR RISK ASSESSMENT Neue diagnostische Verfahren zum Nachweis von Erregern Lebensmittelbedingter Infektionen Burkhard Malorny Moderne Erregerdiagnostik: Der Wettlauf gegen die Zeit Ziel:

Mehr

Vergleich von diagnostischen Methoden zum Nachweis der Koi-Herpesvirus

Vergleich von diagnostischen Methoden zum Nachweis der Koi-Herpesvirus Vergleich von diagnostischen Methoden zum Nachweis der Koi-Herpesvirus Herpesvirus-Infektion (KHV-I) Fischgesundheitsdienst Dr. Kerstin Böttcher, Dr. Grit Bräuer Vergleich von diagnostischen Methoden zum

Mehr

Titer. französisch titre: Feingehalt

Titer. französisch titre: Feingehalt Serologie Testverfahren (in der Mikrobiologie und Virologie) zur Bestimmung spezifischer Antikörper im Serum oder in anderen Körperflüssigkeiten gegen infektiöse Erreger Titer französisch titre: Feingehalt

Mehr

Einflußfaktoren auf die serologische Einzeltierdiagnostik der Paratuberkulose mittels ELISA

Einflußfaktoren auf die serologische Einzeltierdiagnostik der Paratuberkulose mittels ELISA Einflußfaktoren auf die serologische Einzeltierdiagnostik der Paratuberkulose mittels ELISA Heike Köhler Bundesforschungsanstalt für Viruskrankheiten der Tiere, Standort Jena NRL Paratuberkulose Diagnostik

Mehr

Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin

Mehr

Actinobacillus pleuropneumoniae Infektion, Verbesserung der Diagnostik

Actinobacillus pleuropneumoniae Infektion, Verbesserung der Diagnostik Actinobacillus pleuropneumoniae Infektion, Verbesserung der Diagnostik Dr. Sylvia Baier, LWK Niedersachsen, Schweinegesundheitsdienst, Dr. Jens Brackmann, LWK Niedersachsen, Institut für Tiergesundheit

Mehr

4.5. Ergebnisse der Expression und Aufreinigung von rekombinanten Proteinen aus Escherichia coli

4.5. Ergebnisse der Expression und Aufreinigung von rekombinanten Proteinen aus Escherichia coli 4.5. Ergebnisse der Expression und Aufreinigung von rekombinanten Proteinen aus Escherichia coli Für die Auswertung des ELISAs wurden Positivkontrollen benötigt. Dazu wurde einem Teil der Tiere subcutan

Mehr

Technische Einflüsse auf serologische Ergebnisse

Technische Einflüsse auf serologische Ergebnisse Borreliose-Serologie Copyright: Uta Everth 1 Die Lyme Borreliose gewinnt zunehmend an Bedeutung. Geschätzte Erkrankungshäufigkeiten für Zentral-Europa gehen bis zu 237/100.000 Einwohner und in einigen

Mehr

Herstellung und Selektion rekombinanter Antikörper

Herstellung und Selektion rekombinanter Antikörper Herstellung und Selektion rekombinanter Antikörper Für jeden Topf ein Deckel Sintox 16.04.2015 16.04.15 Sintox 1 Inhalte Begriffsklärungen Rekombinant Lymphozyten Antikörper und Antigene Somatische Hypermutation

Mehr

Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin

Mehr

Phage-Display. Übersicht. Allgemeine Einführung Phage M13 Vektoren Bibliotheken Selektionsablauf Anwendungsmöglichkeiten.

Phage-Display. Übersicht. Allgemeine Einführung Phage M13 Vektoren Bibliotheken Selektionsablauf Anwendungsmöglichkeiten. Phage-Display Thomas Haarmann AG Dietrich Methodenseminar Biochemie II 20.01. und 10.02.2009 Übersicht Allgemeine Einführung Phage M13 Vektoren Bibliotheken Selektionsablauf Anwendungsmöglichkeiten Phage-Display

Mehr

BLOCK 9. Dengue Fieber/ ELISA. N.Brandl 2008

BLOCK 9. Dengue Fieber/ ELISA. N.Brandl 2008 BLOCK 9 Dengue Fieber/ ELISA N.Brandl 2008 Versuchsaufbau 1. 2. 3. 4. 5. 6. 7. 8. 1. Coaten und Blocken 2. Waschen (3x) 3. Patientenserum (30min) 4. Waschen (3x) 5. Detektionsantikörper (30min) 6. Waschen

Mehr

Immunoassays http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/elisa.html

Immunoassays http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/elisa.html Immunoassays http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/elisa.html Fanden erstmal in den 50er Jahren Verwendung Zuerst nur radioaktive Markierungen für Immunoassays Ab den 70er Jahren

Mehr

Allgemeine Produktbeschreibung Spezifisches IgE

Allgemeine Produktbeschreibung Spezifisches IgE Allgemeine Produktbeschreibung Spezifisches IgE Produkt- und Verfahrensbeschreibung Der Nachweis von spezifischem IgE in Serum oder Plasma basiert auf dem Prinzip eines Enzymimmunoassays zur quantitativen

Mehr

Vom His-tag zur ChIP-Analyse

Vom His-tag zur ChIP-Analyse Die verschiedenen Methoden der Affinitätsreinigung von Proteinen Vom His-tag zur ChIP-Analyse Felix Steinbacher Hochschule München BOD8 Hochreine Proteine In vielen Bereichen der Industrie, Medizin und

Mehr

Immunologie: Primärantikörper

Immunologie: Primärantikörper Immunologie: Primärantikörper Monoklonale Antikörper maßgeschneidert von der Peptid- oder Antigensynthese über die Antikörperproduktion zur Konjugation mit Detektionsreagenzien Die angebotenen Programme

Mehr

HER2-Diagnostik. Ein Leitfaden für Brustkrebs-Patientinnen

HER2-Diagnostik. Ein Leitfaden für Brustkrebs-Patientinnen HER2-Diagnostik Ein Leitfaden für Brustkrebs-Patientinnen Was ist HER2? HER2 vielfach auch als erbb2 oder HER2/neu bezeichnet ist ein Eiweiß bzw. Proteinbaustein an der Oberfläche von Zellen (Rezeptor).

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

BEIJING WANTAI: HEPATITIS E DIAGNOSTIK

BEIJING WANTAI: HEPATITIS E DIAGNOSTIK BEIJING WANTAI: HEPATITIS E DIAGNOSTIK Wantai HEV-IgM ELISA Wantai HEV-IgG ELISA Wantai HEV-Total-Antikörper ELISA Wantai HEV-Ag ELISA Plus Wantai HEV-IgM SCHNELLTEST Hepatitis E Hepatitis E, bis anhin

Mehr

. = Standardabweichung, berechnet aus Ergebnissen, die unter Vergleichsbedingungen erhalten worden sind.

. = Standardabweichung, berechnet aus Ergebnissen, die unter Vergleichsbedingungen erhalten worden sind. RESOLUTION OIV/OENO 427/2010 Geändert Durch OIV-COMEX 502-2012 1 Definitionen der Verfahrenskriterien Richtigkeit r = Grad der Übereinstimmung zwischen dem aus einer großen Serie von Testergebnissen erhaltenen

Mehr

Salmonella spp. Campylobacter spp. Fokus Schwein

Salmonella spp. Campylobacter spp. Fokus Schwein Salmonella spp. Campylobacter spp. Fokus Schwein Roger Stephan Institut für Lebensmittelsicherheit und -hygiene Vetsuisse-Fakultät Universität Zürich, Schweiz www.ils.uzh.ch Facts 70% aller Erkrankungen

Mehr

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32 Inhaltsverzeichnis 1. Einleitung... 9 1.1 Posttranslationale Modifikationen... 10 1.2 N-Glykosylierung... 11 1.3 O-Glykosylierung... 12 1.4 Veränderungen der Glykosylierung bei der Tumorentstehung... 13

Mehr

Wasserchemie Modul 7

Wasserchemie Modul 7 Wasserchemie Modul 7 Prinzip eines heterogenen Enzyme ELISA Enzyme Linked Immuno Sorbent Assay Was sind Antikörper Antikörper (Immunoglobuline) sind Eiweißstoffe stoffe,, die Tiere und Menschen zur Abwehr

Mehr

Herstellung monoklonaler und polyklonaler Antikörper gegen 1,4-Benzodiazepine zum empfindlichen Nachweis in biologischem Probenmaterial

Herstellung monoklonaler und polyklonaler Antikörper gegen 1,4-Benzodiazepine zum empfindlichen Nachweis in biologischem Probenmaterial Herstellung monoklonaler und polyklonaler Antikörper gegen 1,4-Benzodiazepine zum empfindlichen Nachweis in biologischem Probenmaterial Den naturwissenschaftlichen Fakultäten der Friedrich-Alexander-Universität

Mehr

Die Schweine-Salmonellen-Verordnung und der SALMOTYPE PigScreen ELISA

Die Schweine-Salmonellen-Verordnung und der SALMOTYPE PigScreen ELISA Die Schweine-Salmonellen-Verordnung und der SALMOTYPE PigScreen ELISA Schroeder C., Kramer T., Seifert S., Sasse O., Gabert J. Labor Diagnostik GmbH Leipzig I. Leipziger Labor Diagnostik Symposium Leipzig,

Mehr

Richtlinie zur Feststellung und Überwachung des PRRS-Status von Schweinebeständen (PRRS-Richtlinie) Rd. Erl. des MLU vom 27.

Richtlinie zur Feststellung und Überwachung des PRRS-Status von Schweinebeständen (PRRS-Richtlinie) Rd. Erl. des MLU vom 27. Richtlinie zur Feststellung und Überwachung des PRRS-Status von Schweinebeständen (PRRS-Richtlinie) Rd. Erl. des MLU vom 27. Februar 2004 Anlagen 1. Einleitung Das PRRS-Virus wurde Anfang der 90-iger Jahre

Mehr

4.1. Herstellung, Aufreinigung und Nachweis eines CD33-spezifischen IgM-Antikörpers

4.1. Herstellung, Aufreinigung und Nachweis eines CD33-spezifischen IgM-Antikörpers ERGEBNISSE 30 4. Ergebnisse 4.1. Herstellung, Aufreinigung und Nachweis eines CD33-spezifischen IgM-Antikörpers 4.1.1. Herstellung und Aufreinigung des Antikörpers CD33-spezifische IgM-Antikörper wurden

Mehr

Gebrauchsinformation BABESIA-ELISA DOG

Gebrauchsinformation BABESIA-ELISA DOG Gebrauchsinformation BABESIA-ELISA DOG Test zum Nachweis von Antikörpern gegen den Erreger der Babesiose beim Hund, Babesia canis In-vitro Diagnostikum für Hunde Bestandteile des Kits: 1 Mikrotiterplatte,

Mehr

Nachweis von BHV-1-Antikörpern aus (Tank)milchproben

Nachweis von BHV-1-Antikörpern aus (Tank)milchproben Nachweis von BHV-1-Antikörpern aus (Tank)milchproben Martin Beer Bundesforschungsanstalt für Viruskrankheiten der Tiere Insel Riems Friedrich-Löffler-Institute Institut für Virusdiagnostik NRL für BHV-1

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

Vorkommen von APP- Erregern in norddeutschen Ferkelerzeugerbeständen. Dr. Heinrich Wilkes Fachtierarzt für Schweine Vet-Team-Reken

Vorkommen von APP- Erregern in norddeutschen Ferkelerzeugerbeständen. Dr. Heinrich Wilkes Fachtierarzt für Schweine Vet-Team-Reken Vorkommen von APP- Erregern in norddeutschen Ferkelerzeugerbeständen Dr. Heinrich Wilkes Fachtierarzt für Schweine Vet-Team-Reken Vet-Team Verbund Veterinärmedizin 4.0 3 Agenda Situationsbeschreibung APP-Problematik

Mehr

Nachweis von Antikörpern gegen porzine Influenza A Viren Ergebnisse eines Ringtests Untersuchungen von Feldproben. V. Herwig, C. Laue, R.

Nachweis von Antikörpern gegen porzine Influenza A Viren Ergebnisse eines Ringtests Untersuchungen von Feldproben. V. Herwig, C. Laue, R. Nachweis von Antikörpern gegen porzine Influenza A Viren Ergebnisse eines Ringtests Untersuchungen von Feldproben V. Herwig, C. Laue, R. Dürrwald Haemagglutinationshemmungstest Nachweis von Antikörpern

Mehr

600 ALLERGENE. EINFACHE ANWENDUNG. LAS Liquid Allergen System

600 ALLERGENE. EINFACHE ANWENDUNG. LAS Liquid Allergen System 600 ALLERGENE. EINFACHE ANWENDUNG. LAS Liquid Allergen System DST Das Liquid Allergen System ist ein ELISA-System zur In-vitro Diagnostik allergenspezifischer IgE- und IgG 4 -Antikörper in Serum oder Plasma.

Mehr

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1 Variabilität von Antikörpern 1 Rezeptoren bzw. Antikörper eines noch undifferenzierten B-Lymphocyten: a) Schreiben Sie die Anzahl der variablen Exons je Chromosom auf. b) Berechnen Sie die mögliche Anzahl

Mehr

Monitoring von Resistenzen in Österreich

Monitoring von Resistenzen in Österreich Monitoring von Resistenzen in Österreich Peter Much Österreichische Agentur für Gesundheit und Ernährungssicherheit Bereich Daten, Statistik, Risikobewertung Symposium Antibiotikaresistenz in der Lebensmittelkette

Mehr

Antikörper. 2.1 Grundlagen

Antikörper. 2.1 Grundlagen Antikörper 2 2.1 Grundlagen Antikörper sind Glykoproteine, die von Wirbeltieren gebildet werden, um den Organismus vor eingedrungenen, körperfremden Substanzen zu schützen. Die fremde Substanz bindet an

Mehr

Gebrauchsinformation. Neospora-p38 ELISA Cattle

Gebrauchsinformation. Neospora-p38 ELISA Cattle Gebrauchsinformation Neospora-p38 ELISA Cattle Test zum Nachweis von IgG-Antikörpern gegen den Erreger Neospora caninum bei Rindern In-vitro Diagnostikum für Tiere Bestandteile des Kits: 1 Mikrotiterplatte,

Mehr

Aufklärung von lebensmittelbedingten Krankheitsausbrüchen: Die Umsetzung der AVV Zoonosen Lebensmittelkette in den Bundesländern

Aufklärung von lebensmittelbedingten Krankheitsausbrüchen: Die Umsetzung der AVV Zoonosen Lebensmittelkette in den Bundesländern BUNDESINSTITUT FÜR RISIKOBEWERTUNG Aufklärung von lebensmittelbedingten Krankheitsausbrüchen: Die Umsetzung der AVV Zoonosen Lebensmittelkette in den Bundesländern Dr. Heidi Wichmann-Schauer Aufklärung

Mehr

4 Diskussion DISKUSSION

4 Diskussion DISKUSSION 4 Diskussion Um die therapeutischen Mechanismen von IVIG bei der Behandlung von Autoimmunerkrankungen zu verstehen und darüber hinaus auch neue Erkenntnisse über die Pathogenese der Erkrankungen zu erlangen,

Mehr

ARBEITSTECHNIKEN IN DER PROTEINCHEMIE. Immunologie

ARBEITSTECHNIKEN IN DER PROTEINCHEMIE. Immunologie ARBEITSTECHNIKEN IN DER PROTEINCHEMIE Immunologie Wichtige Grundbegriffe der Immunologie: Antigen: Körperfremdes Agens, welches beim Eindringen in den Organismus eine Immunantwort hervorruft (z.b. Fremdproteine,

Mehr

Rekombinante Antikörper

Rekombinante Antikörper Frank Breitling und Stefan Dübel 2008 AGI-Information Management Consultants May be used for personal purporses only or by libraries associated to dandelon.com network. Rekombinante Antikörper Technische

Mehr

Stiftung zur Förderung der Erforschung von Ersatz- und Ergänzungsmethoden zur Einschränkung von Tierversuchen. Projektbeispiel

Stiftung zur Förderung der Erforschung von Ersatz- und Ergänzungsmethoden zur Einschränkung von Tierversuchen. Projektbeispiel Stiftung zur Förderung der Erforschung von Ersatz- und Ergänzungsmethoden zur Einschränkung von Tierversuchen Mainzer Landstraße 55, 60329 Frankfurt am Main www.stiftung-set.de Projektbeispiel Entwicklung

Mehr

Peptid vermittelte capture -PCR zum Nachweis von Mycobacterium avium subspecies paratuberculosis aus Milch

Peptid vermittelte capture -PCR zum Nachweis von Mycobacterium avium subspecies paratuberculosis aus Milch Peptid vermittelte capture -PCR zum Nachweis von Mycobacterium avium subspecies paratuberculosis aus Milch Janin Stratmann, Gerald-F. Gerlach Institut für Mikrobiologie, Zentrum für Infektionsmedizin,

Mehr

Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken

Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken S. Adebahr 1, M. Henke 1, R. Mertelsmann 2, G. Niedermann 1, M. Trepel 2,3 1 Klinik für Strahlenheilkunde, Universitätsklinikum

Mehr

Versuch 5: ELISA (Serumtitration)

Versuch 5: ELISA (Serumtitration) Versuch 5: ELISA (Serumtitration) Lernziele: 1) Definition der Begriffe Antigen, Antikörper, Epitop, Paratop, Affinität, Avidität 2) Monoklonale und polyklonale Antikörper 3) Praktische Durchführung einer

Mehr

Vergleich Borrelia-ELISA unterschiedlicher Testhersteller mit Immunoblot: Hochspezifische, aber niedrig-sensitive Tesverfahren

Vergleich Borrelia-ELISA unterschiedlicher Testhersteller mit Immunoblot: Hochspezifische, aber niedrig-sensitive Tesverfahren Vergleich Borrelia-ELISA unterschiedlicher Testhersteller mit Immunoblot: Hochspezifische, aber niedrig-sensitive Tesverfahren Dr. med. Armin Schwarzbach Facharzt für Laboratoriumsmedizin Mitglied der

Mehr

Das Bayerische Landesamt für Gesundheit und Lebensmittelsicherheit (LGL)

Das Bayerische Landesamt für Gesundheit und Lebensmittelsicherheit (LGL) Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Das Bayerische Landesamt für Gesundheit und Lebensmittelsicherheit (LGL) Nachweis von Infektiösen Fortpflanzungsstörungen beim Schwein K.-H.

Mehr

Wochenbericht vom 5.7.99 16.7.99, 03.01.00 04.02.00 Infektionsimmunologie

Wochenbericht vom 5.7.99 16.7.99, 03.01.00 04.02.00 Infektionsimmunologie Wochenbericht vom 5.7.99 16.7.99, 03.01.00 04.02.00 Infektionsimmunologie Nils Volkening Ziel der Untersuchung ist die quantitative Angabe der nachgewiesenen Antikörper gegen z.b. CMV, HSV, VZV, jeweils

Mehr

Western-Analyse Protein-Elektrophorese ELISA Protein-Chip

Western-Analyse Protein-Elektrophorese ELISA Protein-Chip Western-Analyse Protein-Elektrophorese ELISA Protein-Chip DNA-RNA RNA-Protein Die Struktur der DNA Ebene der Proteinstruktur Die Gruppen der Aminosäuren Darstellung Räumliche R Proteinstrukturen (Röntgen

Mehr

Ausgewählte Zoonoseerreger in Lebensmitteln 1. Salmonellen

Ausgewählte Zoonoseerreger in Lebensmitteln 1. Salmonellen Ausgewählte Zoonoseerreger in Lebensmitteln 1. Salmonellen Salmonellennachweise aus Lebensmittelproben (ohne Konsumeier)Salmonellenuntersuchungen und -nachweise in Lebensmitteln 2005 Lebensmittelgruppe

Mehr

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch

Mehr

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Q-Fieber in der Schweiz: Seroprävalenz beim Kleinwiederkäuer und Risikoabschätzung für den Menschen

Q-Fieber in der Schweiz: Seroprävalenz beim Kleinwiederkäuer und Risikoabschätzung für den Menschen Q-Fieber in der Schweiz: Seroprävalenz beim Kleinwiederkäuer und Risikoabschätzung für den Menschen Untertitel, Autoren etc. J. Hunninghaus, I. Magkouras, M.M. Wittenbrink, G. Schüpbach Jahreskonferenz

Mehr

Die Labordiagnose der Virushepatitis

Die Labordiagnose der Virushepatitis Seite 1 von 6 Die Labordiagnose der Virushepatitis Die primär hepatotropen Erreger HepatitisAVirus (HAV) HepatitisBVirus (HBV) HepatitisCVirus (HCV) HepatitisDVirus (HDV) (HepatitisDeltaVirus) HepatitisEVirus

Mehr

BfR stuft den massiven Einsatz von Antibiotika in der Tierproduktion als bedenklich ein

BfR stuft den massiven Einsatz von Antibiotika in der Tierproduktion als bedenklich ein Antibiotikaresistente Keime auf Hähnchenfleisch-Proben sind nichts Neues BfR stuft den massiven Einsatz von Antibiotika in der Tierproduktion als bedenklich ein Berlin (10. Januar 2012) - Eine Stichprobe

Mehr

Immunhistochemische Färbung F Immunfluoreszenz. Vortrag Immunologie am von Christopher Tollrian

Immunhistochemische Färbung F Immunfluoreszenz. Vortrag Immunologie am von Christopher Tollrian Immunhistochemische Färbung F und Immunfluoreszenz Vortrag Immunologie am 22.05.2009 von Christopher Tollrian Inhalt Grundlagen Immunhistochemische Färbung Immunfluoreszenz Proben-Vorbereitung Methoden

Mehr

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61 Tier-Biotechnologie Inhaltsverzeichnis Vorwort. 9 Mitarbeiter. 10 Einführung in die Tier-Biotechnologie. 11 Teil I: Zellkultur- und Bioverfahrenstechniken. 23 1 Kultivierung tierischer Zellen. 25 1.1 Voraussetzungen

Mehr

Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum.

Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum. Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum. Kurzdarstellung Die sichere Diagnose einer Borrelieninfektion stellt die Laboratoriumsmedizin trotz

Mehr

Neues aus dem Mastitislabor Referentin: Susanne Schönfeld

Neues aus dem Mastitislabor Referentin: Susanne Schönfeld Neues aus dem Mastitislabor Referentin: Susanne Schönfeld Gliederung 1. PCR: Möglichkeiten und Grenzen bei der Detektion von Mastitiserregern 2. Integrierte tierärztliche Bestandsbetreuung als Instrument

Mehr

Paradigmenwechsel in der KSP-Bekämpfung. K. Depner

Paradigmenwechsel in der KSP-Bekämpfung. K. Depner Paradigmenwechsel in der KSP-Bekämpfung K. Depner Paradigmenwechsel ach Th. S. Kuhn*: ein radikaler Bruch in der Wissenschaft enn allgemein anerkannte Verfahren, die für eine gewisse eit einer Gemeinschaft

Mehr

Anlage zur Akkreditierungsurkunde D-PL-18348-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-18348-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-18348-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 02.07.2013 bis 01.07.2018 Ausstellungsdatum: 13.08.2013 Urkundeninhaber:

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -

Mehr

Abkürzungsverzeichnis. 1. Einleitung 1. 2. Material und Methoden 8

Abkürzungsverzeichnis. 1. Einleitung 1. 2. Material und Methoden 8 Inhaltsverzeichnis I Abkürzungsverzeichnis VI 1. Einleitung 1 1.1 Stabilisierung von Makromolekülen 1 1.2 Natürliche Umgebungen von Proteinen 4 1.3 Künstliche Umgebungen von Proteinen 5 1.4 Ziel der vorliegenden

Mehr

Auszug aus dem Strukturierten Qualitätsbericht

Auszug aus dem Strukturierten Qualitätsbericht Auszug aus dem Strukturierten Qualitätsbericht gemäß 137 Abs. 3 Satz 1 Nr. 4 SGB V für das Berichtsjahr 2010 Institut für Virologie B-37 Institut für Virologie B-37.1 Allgemeine Angaben : Institut für

Mehr

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase Folie GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse Erste Lernphase: Aneignungsphase Erarbeiten Sie in Ihrer Expertengruppe die Inhalte eines der vier Textabschnitte (2.1, 2.2, 3.1, 3.2).

Mehr

Teilprojekt: Microbial Source Tracking Technologiezentrum Wasser Abteilung Umweltbiotechnologie & Altlasten C. Stoll, Dr. A. Tiehm Ziele Mikrobiologisches Monitoring am Standort - Mikroorganismen im Kulturverfahren

Mehr

SAP Business ByDesign bei TECHNOCLONE. Einleitung TECHNOCLONE DAS PROJEKT FULCRUM CONSULTING. SAP Business ByDesign

SAP Business ByDesign bei TECHNOCLONE. Einleitung TECHNOCLONE DAS PROJEKT FULCRUM CONSULTING. SAP Business ByDesign SAP Business ByDesign bei TECHNOCLONE Einleitung TECHNOCLONE DAS PROJEKT FULCRUM CONSULTING SAP Business ByDesign Forum Business Software & Management Steyr 2013 SAP Business ByDesign bei TECHNOCLONE Einleitung

Mehr

Immunserologie III. ELISA, Western-blot, Dot-blot

Immunserologie III. ELISA, Western-blot, Dot-blot Immunserologie III. ELISA, Western-blot, Dot-blot Universität ität Pécs, Medizinische Fakul ultät Institut für Immunologie und Biotechnologie ie ELISA 1. - Grundlagen o Enzyme o Linked o Immuno o Sorbent

Mehr

Prävalenz bei ambulanten Patienten mit ambulant erworbener Pneumonie nach Erreger

Prävalenz bei ambulanten Patienten mit ambulant erworbener Pneumonie nach Erreger Produktnummer: IF1250M Rev. I Leistungsmerkmale Nicht für den Vertrieb in den USA ERWARTETE WERTE Patienten mit ambulant erworbener Pneumonie Zwei externe Prüfer untersuchten den Focus Chlamydia MIF IgM

Mehr

Mikrobiologisches Grundpraktikum: Ein Farbatlas

Mikrobiologisches Grundpraktikum: Ein Farbatlas Steve K. Alexander / Dennis Strete Mikrobiologisches Grundpraktikum: Ein Farbatlas Deutsche Bearbeitung von Erika Kothe Aus dem Amerikanischen von Hans W. Kothe und Erika Kothe Ein Imprint von Pearson

Mehr

Untersuchung der inkriminierten Lebensmittel durch die Untersuchungsämter. Andrea Gervelmeyer

Untersuchung der inkriminierten Lebensmittel durch die Untersuchungsämter. Andrea Gervelmeyer BUNDESINSTITUT FÜR RISIKOBEWERTUNG Untersuchung der inkriminierten Lebensmittel durch die Untersuchungsämter Andrea Gervelmeyer Fachgruppe 44 Aufklärung von Ausbrüchen Lebensmittel-Erfassungsbogen Untersuchungsamt

Mehr

Histokompatibilität: tibilität die Verträglichkeit i zwischen Spenderu. Empfängergeweben bei Organtransplantation. Beruht auf

Histokompatibilität: tibilität die Verträglichkeit i zwischen Spenderu. Empfängergeweben bei Organtransplantation. Beruht auf HLA Typisierung Universitätität Pécs, Medizinische Fakul ultät Institut für Immunologie und Biotechnologie ie Histokompatibilität Histokompatibilität: tibilität die Verträglichkeit i zwischen Spenderu.

Mehr

Erfahrungen mit PC-gestützter Untersuchung von Blut- und Ohrstanzproben im Pool auf BVDV mit VIROTYPE BVDV

Erfahrungen mit PC-gestützter Untersuchung von Blut- und Ohrstanzproben im Pool auf BVDV mit VIROTYPE BVDV Erfahrungen mit PC-gestützter Untersuchung von Blut- und Ohrstanzproben im Pool auf BVDV mit VIROTYPE BVDV Blut Untersuchungszahlen Ohrstanzen 2007 2008 mit rt PCR nach Hoffmann 116.204 Plasma- oder Serumproben

Mehr

Hantavirus-Diagnostik

Hantavirus-Diagnostik Hantavirus-Diagnostik A. Lucht, D. Münstermann, R. Geisel --------------------------------------------- Labor Dr. Krone & Partner Medizinaluntersuchungsstelle Bad Salzuflen, Herford Hanta-Virusstruktur

Mehr

Immunologische Methoden und Enzymassays

Immunologische Methoden und Enzymassays Immunologische Methoden und Enzymassays 1. Antikörper (Ak) Aufbau, Struktur monoklonale und polyklonale Ak 2. Immunpräzipitation 3. Affinitätschromatographie 4. Immundetektion 5. Immunblot 6. Immunhistochemie

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Ein Test. Viel Gründe.

Ein Test. Viel Gründe. Ein Test. Viel Gründe. FlockChek Aviäre Influenza MultiS-Screen Ak Testkit 12. Gefügelfachtagung Stendal Dr. Christina Boss IDEXX GmbH, Ludwigsburg 1 2008 IDEXX Laboratories, Inc. All rights reserved.

Mehr

Rekombinante Antikörper Eine vollkommen neue Ära für Therapie und Diagnostik

Rekombinante Antikörper Eine vollkommen neue Ära für Therapie und Diagnostik Rekombinante Antikörper Eine vollkommen neue Ära für Therapie und Diagnostik Annette Hufnagel und Kerstin Brettschneider Überall in der Medizin und der Biotechnologie sind die molekularen Alleskönner anzutreffen.

Mehr

Unterscheidung von vakzinierten und infizierten Schweinebeständen durch Salmonellaspezifische

Unterscheidung von vakzinierten und infizierten Schweinebeständen durch Salmonellaspezifische Unterscheidung von vakzinierten und infizierten Schweinebeständen durch Salmonellaspezifische Antikörper mittels SALMOTYPE Pig STM-WCE ELISA Jörg Lehmann 1, Thomas Lindner 2, Thomas Kramer 1, Matthias

Mehr

Antibiotikaresistenz: Interventionen (preharvest- level) Gertraud Schüpbach

Antibiotikaresistenz: Interventionen (preharvest- level) Gertraud Schüpbach Antibiotikaresistenz: Interventionen (preharvest- level) Gertraud Schüpbach Inhalt des Vortrags Hintergrund Antibiotikaresistenz Mögliche Interventionen Landwirtschaftsbetrieb Tierarztpraxis Lebensmittel

Mehr

HIV Diagnostik und Symptome

HIV Diagnostik und Symptome HIV Diagnostik und Symptome 1. 2. 3. 4. 1 Diagnostik Klinische Stadien Symptome AIDS definierende Krankheiten (2 Bsp.) 4.1 Enzephalopatie - PML 4.2 cerebrale Toxoplasmose 4.3 Tuberkulose 1 Diagnostik -

Mehr

Fachverlag Köhler Giessen VETERINÄRMEDIZIN

Fachverlag Köhler Giessen VETERINÄRMEDIZIN VETERINÄRMEDIZIN Kälteanpassung \bi\ Listeria monocytogenes: Klonierung, D^Ä-Sequenzanalyse und Funktionsstudien der Gene CS/JL, CS/JLB und flar aus dem Wildtypstamm Listeria monocytogenes EGD Eva-Maria

Mehr

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Seminar Molekulare Diagnostik 2011 30. November 2011, Wien AnDiaTec Kernkompetenz Entwicklung und Produktion

Mehr

Bestimmung der Salmonellenantikörperkonzentration. Serumproben. Dr. Simone Jäsert

Bestimmung der Salmonellenantikörperkonzentration. Serumproben. Dr. Simone Jäsert Zentrallabor des Landeskontrollverbandes Sachsen Anhalt Bestimmung der Salmonellenantikörperkonzentration in Fleischsaft- und Serumproben Dr. Simone Jäsert Das Zentrallabor Zentral labor I Referenzlabor

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Interpretation von serologischen Befunden

Interpretation von serologischen Befunden Interpretation von serologischen Befunden Cédric Hirzel Berner Infektiologie Symposium 2014 Hausärztliche serologische Fragen Borreliose EBV HBV Interpretation von serologischen Befunden Epstein Barr Virus

Mehr

Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers

Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers Praktikum Biochemie Einführung in die Molekularbiologie Bettina Siebers Rekombinante Expression einer Esterase aus Pseudomonas aeruginosa in E. coli Polyacrylamide Gelelektrophorese (PAGE) Denaturierende

Mehr

Tuberkulose. Rasche Diagnostik von. Tuberkulose und ihrer Resistenzen. Diese Testsysteme dürfen in Ihrem Labor nicht fehlen!

Tuberkulose. Rasche Diagnostik von. Tuberkulose und ihrer Resistenzen. Diese Testsysteme dürfen in Ihrem Labor nicht fehlen! Tuberkulose Rasche Diagnostik von Tuberkulose und ihrer Resistenzen Diese Testsysteme dürfen in Ihrem Labor nicht fehlen! Unsere molekulargenetischen Testsysteme für ein effizientes und die anschließende

Mehr

Ausgewählte Zoonoseerreger in Lebensmitteln 1. Salmonellen

Ausgewählte Zoonoseerreger in Lebensmitteln 1. Salmonellen Ausgewählte Zoonoseerreger in Lebensmitteln 1. Salmonellen Salmonellennachweise aus Lebensmittelproben (ohne Konsumeier)Salmonellenuntersuchungen und -nachweise in Lebensmitteln 2005 Lebensmittelgruppe

Mehr

Immunologie: Primärantikörper

Immunologie: Primärantikörper Immunologie: Primärantikörper Polyklonale Antikörper maßgeschneidert von der Peptid- oder Antigensynthese über die Antikörperproduktion zur Konjugation mit Detektionsreagenzien Die angebotenen Programme

Mehr

Gebrauchsinformation für FLU ORIMM U N-Influenza

Gebrauchsinformation für FLU ORIMM U N-Influenza CE I LABOṚ ~'~ DR MERK Gebrauchsinformation für FLU ORIMM U N-Influenza Indirekter Immunfluoreszenztest (IFT) für Influenza A oder B Best.-Nr.: FI-100, FI-200, FI-110, FI-120 Diagnostische Bedeutung Ein

Mehr

Fruchtbarkeitsstörungen. Fruchtbarkeitsstörungen durch Virusinfektionen

Fruchtbarkeitsstörungen. Fruchtbarkeitsstörungen durch Virusinfektionen Tierärzte-Konferenzen 26., 27. und 29. Januar 2009 Fruchtbarkeitsstörungen durch Virusinfektionen Gezielte Diagnostik und abgeleitete Maßnahmen Dr. Gabriele Schagemann Boehringer Ingelheim Vetmedica GmbH

Mehr

312/AB XXIII. GP. Dieser Text wurde elektronisch übermittelt. Abweichungen vom Original sind möglich.

312/AB XXIII. GP. Dieser Text wurde elektronisch übermittelt. Abweichungen vom Original sind möglich. 312/AB XXIII. GP - Anfragebeantwortung 1 von 5 312/AB XXIII. GP Eingelangt am 04.04.2007 BM für Gesundheit, Familie und Jugend Anfragebeantwortung Frau Präsidentin des Nationalrates Mag a. Barbara Prammer

Mehr

Enterovirus/Parechovirus Infektionen. Daniela Huzly Institut für Virologie Freiburg

Enterovirus/Parechovirus Infektionen. Daniela Huzly Institut für Virologie Freiburg Enterovirus/Parechovirus Infektionen Daniela Huzly Institut für Virologie Freiburg Virologie Beide gehören zur Familie der PICORNAVIRIDAE Enteroviren werden traditionell unterteilt in: Poliovirus 1 3 Echoviren

Mehr

Chlamydia MIF IgG. Leistungsmerkmale. Produktnummer: IF1250G Rev. J. Nicht für den Vertrieb in den USA

Chlamydia MIF IgG. Leistungsmerkmale. Produktnummer: IF1250G Rev. J. Nicht für den Vertrieb in den USA Produktnummer: IF1250G Rev. J Leistungsmerkmale Nicht für den Vertrieb in den USA ERWARTETE WERTE Patienten mit ambulant erworbener Pneumonie Zwei externe Prüfer untersuchten den Focus Chlamydia MIF IgM

Mehr