Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten"

Transkript

1 Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Im diesem Praktikumsteil sollen homöotische Mutanten von Arabidopsis untersucht werden. Abb 1, Aufbau einer Blüte einer wt Pflanze und die homöotischen Mutanten der Klasse A, B, C und E Die Aufgabe im Praktikum ist es zum einen Pflanzen phänotypisch zu analysieren und eine Genotypisierung der Pflanzen vorzunehmen. In diesem Praktikum wird mit Klasse B-Gen mutierten Pflanzen gearbeitet, daher wird der AP3- bzw. PI-Locus genotypisiert. Dabei werden 2 verschiedene Methoden, CAPS (cleaved amplified polymorphic sequences) und dcaps (derived cleaved amplified polymorphic sequences) verwendet. Es wird mit Pflanzen, die das pi-1 Allel tragen gearbeitet: Abb 2, B-Gen knock-out in Arabidopsis pi-1 Allel, Mutation in 1. Exon führt zu Stopcodon Diese Pflanzen werden mit der CAPS-Methode genotypisiert: 1

2 Abb 3, Nachweis des pi-1 Allels mittels CAPS-Analyse Des Weiteren wird mit Pflanzen, die das ap3-3 Allel tragen gearbeitet: Abb 4, B-Gen knock-out in Arabidopsisap3-3 Allel, Mutation in 1. Exon führt zu Stopcodon Diese Pflanzen werden mit der dcaps-methode genotypisiert: Abb 5, Nachweis des ap3-3 Allels mittels dcaps-analyse 2

3 Nach der Analyse des Genotyps, sollen diese Ergebnisse mit den phänotypischen Analysen verglichen werden und auf die Vererbung des mutanten Allels geschlossen werden (dominant/rezessiv). In einem zweiten Versuchteil soll die Expression der mrna von ap3 und pi in wt Pflanzen und in den Mutanten untersucht werden. Dazu soll RNA isoliert werden, um dann cdna zu synthetisieren. Anhand einer semiquantitativen RT-PCR soll dann die Expression von AP3 und PI in Pflanzen bestimmt werden. Abb 5, Funktionsweise der RT-PCR (Chen et al.1999, Brain Research Protocols) Zusammenfassung Der Praktikumsversuch ist in 2 Versuchsteile gegliedert, die an den 2 Tagen zusammen abgearbeitet werden Teil 1, Analyse des Genotypisierung der Pflanzen 1. DNA-Isolierung aus 5 Pflanzen unbekannten Genotyps und eines Wildtyps 2. PCR mit der DNA aller 6 Pflanzen, zur Amplifikation des AP3- oder PI-Allels 3. Restriktionsverdau der PCR-Produkte 4. Agarose-Gelelektrophorese und Analyse der Genotypen Teil 2, Analyse der Expression von Ap3 und PI 1. RNA-Isolierung aus 2 Pflanzen bekannten Genotyps 2. RNA Konzentrationsbestimmung 3. RNA Gelelektrophorese 4. cdna Synthese aus der isolierten RNA 5. semiquantitative Reverse Transcription-PCR (RT-PCR) 6. Agarose-Gelelektrophorese und Analyse 3

4 Tag 1 1. Einleitung und S1 Belehrung 2. RNA-Isolierung aus 2 Pflanzen bekannten Genotyps 3. RNA Konzentrationsbestimmung 4. RNA Geleletrophorese 5. Morphologische Analyse von 6 Pflanzen unter besonderer Berücksichtigung des Blüten- Phänotyps. 6. DNA-Isolierung aus 5 Pflanzen unbekannten Genotyps und eines Wildtyps (Summe 6 Pflanzen) 7. PCR mit der DNA aller 6 Pflanzen, um das AP3- oder PI-Allel zu amplifizieren Tag 2 8. Restriktionsverdau der PCR-Produkte aus Schritt 5 vom Vortag 9. cdna Synthese aus RNA aus Schritt 3 vom Vortag (nur 5 Gruppen) 10. semiquantitative Reverse Transcriptions-PCR (RT-PCR), um die Expression von AP3 und PI mittels RT-PCR in Pflanzen bekannten Genotyps zu untersuchen. 11. Restriktionsverdau auf Agarose-Gel auftragen und analysieren 12. RT-PCR auf Agarose-Gel auftragen und analysieren 13. Ergebnisse aller Gruppen zusammentragen und analysieren 4

5 I. Vorbereitung Beantworten Sie zur Vorbereitung auf das Praktikum folgende Fragen (schriftliche Beantwortung nicht notwendig): - Was versteht man unter homöotischen Mutationen? - Wie ist eine Arabidopsis-Blüte aufgebaut (Anzahl und Anordung der Organe)? - Was sind die grundlegenden Aussagen des ABC-Modells der Blütenentwicklung und welchen Phänotyp erwarten Sie für eine florale homöotische Mutante der Klasse B? - Wie funktioniert PCR? - Was sind Restriktionsenzyme? Anmerkung: Die Fragen dienen als Hilfestellung zum Protokollschreiben und für das Testat. II. Arbeitsplan Jede Gruppe erhält fünf Pflanzen, die Nachkommen entweder eines geselbsteten Elters sind, der ein mutantes APETALA3 (AP3) oder ein mutantes PISTILLATA (PI)-Allel trägt und ansonsten genotypisch einem Wildtyp entspricht. Die Eltern der bereitgestellten Pflanzen sind also entweder ap3/ap3; PI/PI ( AP3-Heterozygote ) oder AP3/AP3; pi/pi ( PI-Heterozygote ). Außerdem erhält jede Gruppe eine Wildtyp Pflanze als Referenz. Aufgabe im Praktikum ist es - die bereitgestellten Nachkommen phänotypisch zu analysieren und - hinsichtlich des AP3- bzw. PI-Locus zu genotypisieren - RNA zu isolieren, cdna zu synthetisieren und - mittels RT-PCR die Expression von AP3 und PI in Pflanzen bekannten Genotyps zu analysieren - die Ergebnisse aller Gruppen zusammenzutragen und gemeinsam zu analysieren 1. Einleitung und S1 Belehrung Tag 1 2. RNA-Isolierung aus 2 Pflanzen bekannten Genotyps Gruppennumer Genotyp der Pflanzen 1-3 AP3/AP3; PI/PI Wildtyp 4-6 ap3/ap3; PI/PI ap3 homo 7-9 AP3/ap3; PI/PI ap3 hetero AP3/AP3; pi/pi pi homo AP3/AP3; PI/pi pi hetero AP3: wildtypisches AP3-Allel ap3: mutantes AP3-Allel PI: wildtypisches PI-Allel pi: mutantes PI-Allel - Mit einem grünen Plastikmörser Pflanzenmaterial zerkleinern, dabei ab und zu vorsichtig flüssigen Stickstoff dazugeben, damit das Gewebe kalt bleibt, dann die Eppis bis zur weiteren Verarbeitung in flüssigen Stickstoff lagern (SCHON VORBEREITET) 5

6 - 300 µl cell lysis solution (2% SDS, 68 mm sodium citrate, 132 mm citric acid, 1 mm EDTA) dazugeben und schnell für mehrere Sekunden vortexen und Eppi invertieren bis das Gewebe im Puffer homogenisiert ist - 5 Minuten bei Raumtemperatur inkubieren (stehen lassen) µl protein-dna precipitation solution (4 M NaCl, 16 mm sodium citrate, 32 mm citric acid) dazugeben und Eppis invertieren - Für mindestens 10 Minuten bei 4 C (auf Eis) inkubieren. Dann bei 4 C für 10 Minuten zentrifugieren. - Den Überstand sauber in ein neues RNA-Eppi übertragen (Pipette). 300 µl Isopropanol dazugeben und gut mischen durch Invertieren des Eppis. - 4 Minuten bei 4 C zentrifugieren, und den Überstand durch abpipettieren, verwerfen. - Das Pellet mit 600 µl 70% Ethanol waschen (d.h. Zugabe von EtOH und vorsichtig invertieren) und erneut 4 Minuten bei 4 C zentrifugieren. Ethanol sauber und vollständig abpippetieren. - Das Pellet trocknen lassen (offener Deckel, ca 5 min) und anschließend in 26 µl DEPC-Wasser auflösen. - 3 µl 10x DNase Puffer and 1 µl (5 units) DNase I (Roche, DNase I, RNase-free) dazugeben und für 30 Minuten bei 37 C inkubieren (Thermomixer) µl DEPC-Wasser, 50 µl 7.8 M NH 4 Ac ph 6.0 und 400 µl 100% Ethanol dazugeben und gut mischen Minuten bei 4 C zentrifugieren, den Überstand verwerfen und das Pellet mit 600 µl 70% Ethanol waschen, danach 5 Minuten bei 4 C zentrifugieren. - Ethanol sauber und vollständig abpippetieren - Pellet trocknen lassen (offener Deckel, ca 5 min) und 20 µl DEPC-Wasser dazugeben und durch anschnipsen lösen. 3. RNA Konzentrationsbestimmung - 1 µl RNA zusammen mit 99 µl DEPC-Wasser in ein 1,5 ml RNA-Eppi geben - Gut mischen und alles in eine Küvette pipettieren - Photometrische Konzentrationsbestimmung mit DEPC-Wasser als blank 4. RNA Gelelektrophorese Gießen eines Agarose-Gels (wird vom Betreuer durchgeführt) Die Konzentration von Agarose-Gelen wird in weight per volume (w/v) angegeben, das heißt, für ein 1 %iges Gel müssen 1 g Agarose in 100 ml Laufpuffer resuspendiert werden. Durchführung: - Agarose Gel abwiegen, in eine Schott-Flasche geben - Laufpuffer zugeben, mischen - Gemisch in Mikrowelle aufkochen, dabei Flaschendeckel leicht öffnen. Vorsicht: Siedeverzug - Heiße Agaroselösung kurz (5 min) abkühlen lassen, dann in Gelschlitten gießen - Für ein großes Gel 6 µl Ethidiumbromid-Lösung, für ein kleines Gel 2 µl Ethidiumbromid- Lösung zugeben und mit Pipettenspitze in der Lösung verteilen. - Ethidiumbromid ist mutagen, immer blaue Handschuhe tragen, Hautkontakt vermeiden; Gele, die Ethidiumbromid enthalten, nur mit blauen Handschuhen anfassen - Kämme einsetzen - Gel auspolymerisieren lassen (ca min) 6

7 Gelelektrophorese RNA - 1 µl RNA zusammen mit 9 µl DEPC-Wasser in ein 1,5 ml RNA-Eppi geben - 2 µl RNA Ladepuffer dazugeben - Auf ein 1% Agarosegel laden, 6 µl DNA Marker in einen extra Slot dazu geben 5. Morphologische Analyse von 6 Pflanzen unter besonderer Berücksichtigung des Blüten-Phänotyps. - Notieren Sie ihre Beobachtungen. Was erwarten sie bezüglich Anzahl und Anordnung der Blütenorgane im Wildtyp? Weichen Pflanzen von dieser Erwartung ab, wenn ja, inwiefern? 6. DNA-Isolierung aus 5 Pflanzen unbekannten Genotyps und eines Wildtyps (Summe 6 Pflanzen) Wichtige Vorbemerkung: als erstes ist jeder Pflanze ist eine Nummer zuzuordnen (auf den jeweiligen Topf schreiben). Diese Nummer bei der DNA-Isolierung weiter verwenden, um nach der Genotypisierung jede Pflanze eindeutig zu identifizieren. Durchführung: - je ein Blättchen der Pflanzen abschneiden, in 1,5ml-Eppi geben und bis zur weiteren Verarbeitung auf Eis lagern µl DNA-Extraktionspuffer (0,2 M Tris-HCl ph 8, 0,4 M LiCl, 20 mm EDTA ph 8, 1%SDS) zugeben (Pipette) - Blättchen mit Plastikmörser zerkleinern, bis keine größeren Blattbestandteile mehr sichtbar sind, Homogenisat bis zur weiteren Verarbeitung auf Eis lagern - 5 min bei max. rpm zentrifugieren - Überstand (300 µl) in neues 1,5ml-Eppi pipettieren, 300 µl Isopropanol zugeben, gut mischen durch invertieren des Eppis (nicht vortexen) - 10 min bei max. rpm zentrifugieren - Überstand entfernen (abschütten), Eppi kurz auf sauberem Papiertuch vorsichtig abklopfen, 300 µl 70% EtOH zugeben - 5 min bei max. rpm zentrifugieren - Überstand entfernen (abschütten), Eppi gut auf sauberem Papiertuch abklopfen, Eppi so umgedreht stehen lassen (bis der Alkohol auf dem Papiertuch getrocknet ist) - Eppi umdrehen und Pellet bei geöffnetem Eppi-Deckel bei Raumtemperatur weiter trocknen lassen (ca min) - Pellet in 50 µl ddh 2 O aufnehmen (mit Pipettenspitze durchrühren, nicht auf- und abpipettieren) und für mind. 15 min bei 50 C inkubieren (Thermomixer); eventuell durch Anschnippen Pellet weiter resuspendieren 7

8 7. PCR mit der DNA aller 6 Pflanzen, um das AP3- oder PI-Allel zu amplifizieren a) Bestimmung des Genotyps für PI Genotypisierung mittels Cleaved Amplified Polymorphic Sequence (CAPS) PCR Grundlage: verschiedene Allele des gleichen Gens tragen unterschiedlich viele Schnittstellen für ein bestimmtes Restriktionsenzym Sequenz-Ausschnitt aus Wildtyp-PI-Allel:5 -AAA CTA TGG GAT GCT AAG CAT -3 Sequenz-Ausschnitt aus pi-1 Mutante: 5 -AAA CTA TGA GAT GCT AAG CAT -3 Wildtyp Allel trägt Schnittstelle für Restriktionsenzym BseGI (unterstrichen) mutantes Allel: pi-1 EMS-induzierte Punktmutation: TGG (kursiv) TGA; dadurch entsteht vorzeitiges STOP-Codon (trunkiertes Protein ist für mutanten Phänotyp verantwortlich) und: Schnittstelle für BseGI geht verloren Durchführung: a) Amplifikation des entsprechenden DNA-Fragments mittels PCR Wichtig: die Komponenten werden auf Eis zusammengemischt. Das Enzym wird als letztes dazugegeben Ein Reaktionsansatz enthält: Ausgangskonzentration Reaktionspuffer 10fach 1fach dntps 2 mm 0,2 mm Primer pi-1fwd CAPS 5 µm 1 µm (forward Primer) Primer pi-1rev CAPS (reverse Primer) 5 µm 1 µm Konzentration bzw. Menge im Reaktionsansatz taq-polymerase 1 unit/µl 0,75 units DNA-Lösung -- 1,5 µl Gesamtvolumen (mit ddh 2 O auffüllen) µl µl in einem Reaktionsansatz Mastermix X mal der Reaktionsansatz Negativkontrolle, bei der ddh 2 O an Stelle der DNA-Lösung eingesetzt wird, mit ansetzen Da mehrere PCR-Ansätze vorzubereiten sind, kann ein Master-Mix, der alle Reaktionskomponenten für die Einzel-PCRs außer der DNA-Lösung enthält, angesetzt werden; um Pippettierfehler zu korrigieren, wird für den Master-Mix eine Reaktion mehr als eigentlich benötigt angesetzt (6 Pflanzen + 1 Negativkontrolle + 1 Zusatzreaktion) Der Master-Mix wird gut gemischt (vortexen), die einer Einzelreaktion entsprechende Menge wird jeweils auf informativ beschriftete 0,5 ml-eppis verteilt (Gruppennummer 8

9 und Reaktionsansatz), 1,5 µl der DNA-Lösung (bzw. ddh 2 O für die Negativkontrolle) werden zugegeben und die PCR wird gestartet PCR-Programm: 95 C 5 min 95 C 30 sec 58 C 30 sec 35x 72 C 45 sec 72 C 10 min b) Bestimmung des Genotyps für AP3 Genotypisierung mittels derived Cleaved Amplified Polymorphic Sequence (dcaps) PCR Grundlage: Allele werden durch PCR amplifiziert, Primer werden dabei so gewählt, dass bei Amplifikation eines Allels eine Schnittstelle vor einem Sequenzunterschied (z.b. Punktmutation entsteht), im anderen Allel aber nicht Reverse complement Wild-type: GAATAAACCATTTCTTCTCTTTGAATACGTCACTTG ap3-3: GAATAAACCATTTCTTCTCTTTGAATACGTCACTTA MunI: CAATTG ap3-3.rev: GAATAAACCATTTCTTCTCTTTGAATACGTCAATT nach PCR: WT-Allel besitzt Schnittstelle für Mun I (5 -CAA TTG-3 ), wird verdaut mutantes Allel: ap3-3 EMS-induzierte Punktmutation: CAA (kursiv) TAA; dadurch entsteht vorzeitiges STOP-Codon (trunkiertes Protein ist für mutanten Phänotyp verantwortlich) und: Schnittstelle für MunI kann durch PCR nicht eingebaut werden, PCR-Produkt wird nicht verdaut Durchführung: a) Amplifikation des entsprechenden DNA-Fragments mittels PCR Wichtig: die Komponenten werden auf Eis zusammengemischt. Das Enzym wird als letztes dazugegeben Ein Reaktionsansatz enthält: Konzentration bzw. Menge im Reaktionsansatz Reaktionspuffer 1fach 10fach dntps 0,2 mm 2 mm Primer ap3-3fwd dcaps (forward Primer) Primer ap3-3rev dcaps (reverse Primer) 1 µm 5 µm 1 µm 5 µm Ausgangskonzentration taq-polymerase 0,75 units 1 unit/µl DNA-Lösung 1,5 µl -- Gesamtvolumen (mit ddh 2 O auffüllen) 25 µl -- µl in einem Reaktionsansatz Mastermix X mal der Reaktionsansatz 9

10 Negativkontrolle, bei der ddh 2 O an Stelle der DNA-Lösung eingesetzt wird, mit ansetzen Da mehrere PCR-Ansätze vorzubereiten sind, kann ein Master-Mix, der alle Reaktionskomponenten für die Einzel-PCRs außer der DNA-Lösung enthält, angesetzt werden; um Pippettierfehler zu korrigieren, wird für den Master-Mix eine Reaktion mehr als eigentlich benötigt angesetzt (6 Pflanzen + 1 Negativkontrolle + 1 Zusatzreaktion) Der Master-Mix wird gut gemischt (vortexen) die einer Einzelreaktion entsprechende Menge wir jeweils auf informativ beschriftete 0,5 ml-eppis verteilt (Gruppennummer und Reaktionsansatz), 1,5 µl der DNA-Lösung (bzw. ddh 2 O für die Negativkontrolle) werden zugegeben und die PCR wird gestartet PCR-Programm: 95 C 5 min 95 C 30 sec 58 C 30 sec 35x 72 C 45 sec 72 C 10 min Tag 2 8. cdna Synthese aus RNA aus Schritt 3 vom Vortag (nur 5 Gruppen) cdna Nummer RNA 1 AP3/AP3; PI/PI Wildtyp 2 ap3/ap3; PI/PI ap3 homo 3 AP3/ap3; PI/PI ap3 hetero 4 AP3/AP3; pi/pi pi homo 5 AP3/AP3; PI/pi pi hetero Die Abkürzung cdna steht für complementary DNA und ist eine zur RNA komplementäre, einzelsträngige DNA. Der Prozess der Umwandlung von RNA in cdna, die Reverse Transkription, geschieht mittels Enzymen, den Reversen Transkriptasen. Durchführung: 2 µg RNA 1 µl (= 0,5 µg) oligo(dt) 18 primer Mit DEPC-Wasser auf 12,5 µl auffüllen 65 C 5 Minuten, auf Eis, kurz an zentrifugieren, wieder auf Eis 4 µl 5x Reaktionspuffer 0,5 µl Ribolock RNase Inhibitor 2 µl dntp Mix (10 µm) 1 µl Revert Aid H Minus Reverse Transkriptase Mischen, kurz zentrifugieren, 60 Minuten bei 42 C inkubieren Reaktion bei 70 C für 10 Minuten abstoppen Mit 20 µl ddh 2 O verdünnen 9. Restriktionsverdau der PCR-Produkte aus Schritt 5 vom Vortag a) Restriktionsverdau der PCR-Fragmente für die PI-Allel PCR 10

11 1 x Reaktionsansatz Mastermix PCR-Produkt 15 µl X 10 x Reaktionspuffer Tango 1fach konzentrierter Puffer µl Enzym BseGI 0,5 µl Gesamtvolumen 20 µl mit ddh 2 O auffüllen µl Ähnlich wie bei der PCR soll auch hier ein Master-Mix, der alle Reaktions-komponenten mit Ausnahme des PCR-Produkts enthält, angesetzt werden Nach Zugabe des Enzyms und nochmals nach Zugabe des PCR-Produkts Reaktionsansatz gut mischen (vortexen) Inkubation der Reaktion für 1,5 h bei 55 C Zugabe von 5 µl Ladepuffer zur Gesamtreaktion 20 µl dieses Gemisches auf 1 % (w/v) Agarose-Gel auftragen Außerdem pro Gel in separaten Slots auftragen (Proben werden bereitgestellt): Zur Größenabschätzung: 6 µl DNA-Marker Erwartung: Bandengröße für WT-Allel: 320 bp mutantes Allel: 670 bp b) Restriktionsverdau der PCR-Fragmente für das AP3-Allel 1 x Reaktionsansatz Mastermix PCR-Produkt 15 µl X 10 x Reaktionspuffer G 1fach konzentrierter Puffer µl Enzym MunI 0,5 µl Gesamtvolumen 20 µl mit ddh 2 O auffüllen µl Ähnlich wie bei der PCR soll auch hier ein Master-Mix, der alle Reaktionskomponenten mit Ausnahme des PCR-Produkts enthält, angesetzt werden Nach Zugabe des Enzyms und nochmals nach Zugabe des PCR-Produkts Reaktionsansatz gut mischen (vortexen) Inkubation der Reaktion für 1,5 h bei 37 C Zugabe von 5 µl Ladepuffer zur Gesamtreaktion 20 µl dieses Gemisches auf 2,5 % (w/v) Agarose-Gel auftragen Außerdem pro Gel in separaten Slots auftragen (Proben werden bereitgestellt): Zur Größenabschätzung: 6 µl DNA-Marker Erwartung: Bandengröße für WT-Allel: 177 bp mutantes Allel: 208 bp 10. semiquantitative Reverse Transcription-PCR (RT-PCR) Die RT-PCR dient der Abschätzung des Expressionslevels eines Gens in einem bestimmten Gewebe. Dafür wir RNA aus dem entsprechenden Gewebe isoliert und in cdna umgeschrieben. Ausgehend von diesem cdna-pool können dann PCR-Analysen mit verschiedenen, genspezifischen Primern durchgeführt werden. Die Menge des erhaltenen Fragments ist nach Abgleich mit einer internen Kontrolle (APT1) mit der Menge an RNA-Transkript korreliert. 11

12 Jede Gruppe untersucht die Expression von a) APT1 (ADENOSINE PHOSPHOTRANSFERASE1; Haushaltsgen, das in allen Geweben mehr oder weniger gleich stark exprimiert wird) b) AP3 c) PI in Pflanzen mit folgendem Genotyp: cdna Nummer Gruppennumer Genotyp der Pflanzen AP3/AP3; PI/PI Wildtyp ap3/ap3; PI/PI ap3 homo AP3/ap3; PI/PI ap3 hetero AP3/AP3; pi/pi pi homo AP3/AP3; PI/pi pi hetero Durchführung: - jede Gruppe verwendet, wie im Arbeitsplan beschrieben, ein cdna-pool - für diesen Pool werden PCRs durchgeführt, um AP3, PI und APT1 zu amplifizieren; Negativkontrollen für jedes Primerpaar nicht vergessen also 6 PCRs pro Gruppe - Primerpaare für die RT-PCR: (1) AP3fwd RT-PCR; AP3rev RT-PCR (2) PIfwd RT-PCR; PIrev RT-RCR (3) APT1fwd RT-PCR; APT1rev RT-PCR Konzentration bzw. Menge im Reaktionsansatz Reaktionspuffer 1fach 10fach dntps 0,2 mm 2 mm forward Primer 1 µm 5 µm Ausgangskonzentration µl im Reaktionsansatz reverse Primer 1 µm 5 µm taq-polymerase 0,75 units 1 unit/µl cdna-lösung 1 µl -- Gesamtvolumen (mit ddh 2 O auffüllen) 25 µl -- - PCR-Programm: 95 C 5 min 95 C 30 sec 58 C 45 sec 25x 72 C 45 sec 72 C 10 min 11. Restriktionsverdau auf Agarose-Gel auftragen o Welchen Genotyp besitzen die von Ihnen analysierten Pflanzen? Wie ist dieser mit dem Phänotyp korreliert? 12. RT-PCR auf Agarose-Gel auftragen und analysieren - Nach der PCR werden die Reaktionen mit je 6 µl Ladepuffer versetzt, 15 µl dieser Lösung werden auf ein 1%iges Agarose-Gel aufgetragen. - pro Gel 6 µl Marker zur Größenabschätzung mit auftragen 12

13 - Erwartete Bandengrößen: - AP3: 503 bp - PI: 157 bp - APT1: 554 bp a. Ergebnisse aller Gruppen zusammentragen und analysieren (gemeinsame Auswertung) o o o Tragen Sie die Ergebnisse der genotypischen und phänotypischen Analyse aller Gruppen zusammen. Welche Aufspaltung erwarten Sie bei der Selbstung von AP3/ap3- bzw. PI/pi- Eltern? Wie decken sich diese Erwartungen mit dem Ergebnis? Erläutern Sie mögliche Ursachen für eventuelle Abweichungen. Können Sie aus der genotypischen und phänotypischen Analyse der Pflanzen Rückschlüsse auf die Vererbungsform der AP3 oder PI-Allele treffen? Werden die mutanten Allele dominant oder rezessiv vererbt? Begründen Sie ihre Schlussfolgerung. Tragen Sie die Expressionsmuster von AP3 und PI aller Gruppen zusammen. Geben Sie eine mögliche Erklärung für das beobachtete Expressionsmuster an. 13

Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -

Mehr

DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2

Mehr

SCRIPTUM HIGH PRECISE

SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei

Mehr

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet

Mehr

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!

Mehr

Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten

Mehr

Pflanze direkt 2x PCR-Mastermix

Pflanze direkt 2x PCR-Mastermix Datenblatt Artikel-Nr. BS91.322.0250 Artikel-Nr. BS91.322.1250 250 Reaktionen in 20 μl 1250 Reaktionen in 20 μl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern.

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Plasmidisolierung Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Was können Sie lernen? Sie lernen eine ringförmige DNA, ein Plasmid, zu isolieren. Mit diesem

Mehr

Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,

Mehr

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint RFLP als Modell für einen DNA-Fingerprint Teil 1: Restriktionsverdau 1.1: Thermoblock / Wasserbad auf 37 C vorheizen 1.2: Puffer Y+/Tango auftauen und auf Eis stellen 1.3: 4 Proben, RSA I und H 2 O demin.

Mehr

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen

Mehr

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila 01.-04.03.04 Joachim Marhold, Regine Garcia Boy, Natascha Kunert, Cora Mund, Frank Lyko Programm 01.03.04: Präparation genomischer

Mehr

2) Mischen Sie daraufhin das Ligationsprodukt zusammen. Dazu werden 50 µl Zellen und 2 µl Plasmid zusammengegeben

2) Mischen Sie daraufhin das Ligationsprodukt zusammen. Dazu werden 50 µl Zellen und 2 µl Plasmid zusammengegeben Translation of lab protocols Transformation Protocol 1) Stellen Sie die kompetenten Zellen auf Eis 2) Mischen Sie daraufhin das Ligationsprodukt zusammen. Dazu werden 50 µl Zellen und 2 µl Plasmid zusammengegeben

Mehr

Drosophila melanogaster

Drosophila melanogaster Modul biol113 Zellbiologie Drosophila melanogaster Komponenten der angeborenen Immunabwehr Experimente 1) RT (Reverse Transkriptase)-PCR zum Nachweis einer AMP- Expression nach Infektion 1.1 PCR-Reaktion

Mehr

Modifizierte Gene Editor Mutagenese

Modifizierte Gene Editor Mutagenese Modifizierte Gene Editor Mutagenese zur gleichzeitigen Einführung mehrerer Punktmutationen DNA Template Präparation: 2 µg Plasmid DNA (bei 6 kb, sonst entsprechend mehr oder weniger) + 2 µl 2M NaOH, 2

Mehr

3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark

Mehr

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei

Mehr

Blut DNA Mini Kit. Datenblatt. (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen: Farbe: Bio&SELL

Blut DNA Mini Kit. Datenblatt. (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen: Farbe: Bio&SELL Datenblatt Artikel-Nr. BS44.711.0010 Artikel-Nr. BS44.711.0050 Artikel-Nr. BS44.711.0250 10 Präparationen 50 Präparationen 250 Präparationen (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens

Mehr

Methodensammlung des LAG PCR-Nachweis von gentechnisch veränderten Organismen, die von pbr322 abgeleitete Sequenzen enthalten

Methodensammlung des LAG PCR-Nachweis von gentechnisch veränderten Organismen, die von pbr322 abgeleitete Sequenzen enthalten Methodensammlung des LAG PCR-Nachweis von gentechnisch veränderten Organismen, die von pbr322 abgeleitete Sequenzen enthalten erstellt vom Unterausschuß Methodenentwicklung des LAG 1. Zweck und Anwendungsbereich

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

1. Proteinnachweis mit Bradford-Farbreagenz

1. Proteinnachweis mit Bradford-Farbreagenz 1. Proteinnachweis mit Bradford-Farbreagenz 96-well-Platte Pipetten (10, 20 und 200 µl) Pipettenspitzen Proteinvorratslösung (1 mg/ml Albumin in destillierten Wasser) Destilliertes Wasser Bradford Farbreagenz

Mehr

Blut DNA Midi Kit. Datenblatt. (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen: Farbe: Bio&SELL

Blut DNA Midi Kit. Datenblatt. (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen: Farbe: Bio&SELL Datenblatt Artikel-Nr. BS44.721.0010 Artikel-Nr. BS44.721.0050 Artikel-Nr. BS44.721.0250 10 Präparationen 50 Präparationen 250 Präparationen (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183

Mehr

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans AVID X / 1998 Lawsonia intracellularis Seite -1- Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans 1. ALLGEMEINES

Mehr

Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945

Mehr

Plasmid DNA purification

Plasmid DNA purification Plasmid DNA purification Excerpt from user manual - Deutsch - NucleoBond Xtra NucleoBond Xtra NucleoBond Xtra Plus NucleoBond Xtra Plus January 2013 / Rev. 11 Plasmid DNA Purification Deutsch Einleitung

Mehr

AdnaTest ColonCancerDetect

AdnaTest ColonCancerDetect AdnaTest ColonCancerDetect RT-PCR-Nachweis von Darmkrebs-assoziierter Genexpression in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-505 Inhaltsverzeichnis Bestellinformation...

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

AdnaTest EMT-2/StemCell Add-on ProstateDetect

AdnaTest EMT-2/StemCell Add-on ProstateDetect AdnaTest EMT-2/StemCell Add-on ProstateDetect RT-PCR-Nachweis von Prostatakrebs-assoziierter Genexpression in angereicherten Tumorzellen Nur für Forschungszwecke Gebrauchsanweisung T-1-537-PP Inhaltsverzeichnis

Mehr

Protokoll Versuch 1: VDJ-Rekombination in humanen prä-b-zellen

Protokoll Versuch 1: VDJ-Rekombination in humanen prä-b-zellen F2-Praktikum Genetik Protokoll Versuch 1: VDJ-Rekombination in humanen prä-b-zellen Gruppe 4 (Susanne Duncker, Kristin Hofmann) Einleitung Wir untersuchten in diesem Versuch die Effizienz der VDJ-Rekombination

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Molekulargenetische Experimente IV: Plasmidpräparation

Molekulargenetische Experimente IV: Plasmidpräparation Molekulargenetische Experimente IV: Plasmidpräparation Plasmide sind kleine, ringförmige DNA-Moleküle in Bakterien, die in der Lage sind, sich selbst mit Hilfe von Enzymen zu replizieren. Gene, die auf

Mehr

DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics SZTE, Inst. für Med. Biol., Praktikum -Isolierung Zellaufschluss Isolierung genomischer Isolierung von Plasmid Konzentrationsbestimmung der -Lösungen Anhand Absorptionswert

Mehr

Zellbiologie und Physiologie Labormethoden der Biologie

Zellbiologie und Physiologie Labormethoden der Biologie Zellbiologie und Physiologie Labormethoden der Biologie Molekularbiologie I Dr. Stefan Weinl > Molekularbiologie I Plasmidpräparation Transformation Restriktionsverdau Gel-Elektrophorese 1 > Experimenteller

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran

Mehr

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!!

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! aktualisiert, 08.03.2011, Wera Roth1 SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Anleitung für Minigele Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! Glasscheiben ordentlich

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Kolonie-PCR Polymerase

Mehr

AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...

Mehr

Entwicklungsbiologie der Pflanzen biol 117

Entwicklungsbiologie der Pflanzen biol 117 Entwicklungsbiologie der Pflanzen biol 117 WS 2015/2016 Prof. Dr. Margret Sauter und Mitarbeiter Inhaltsverzeichnis Versuchsplan der einzelnen Kurstage 3 Seite Versuch 1 Auftrennung von Proteinen über

Mehr

Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe

Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe Features: - Extraktion von RNA, DNA und Proteinen aus der gleichen Probe - Für kleine und große Mengen von Probe - Gleichzeitiges

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli

Mehr

peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben.

peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. Best.-Nr. 30-2110 100 ml 30-2120 200 ml 30-2130 500 ml Lagerung: Lichtgeschützt bei 4 C für

Mehr

Zellbiologie und Physiologie Labormethoden der Biologie

Zellbiologie und Physiologie Labormethoden der Biologie Zellbiologie und Physiologie Labormethoden der Biologie > Molekularbiologie I Plasmidpräparation Molekularbiologie I Transformation Gel-Elektrophorese Dr. Stefan Weinl > Plasmid-Isolierung aus E. coli

Mehr

Typische Fragen für den Gehschul-Teil: Typ 1: Mengen und Konzentrationen:

Typische Fragen für den Gehschul-Teil: Typ 1: Mengen und Konzentrationen: Die Gehschule ist ein Teil der Biochemischen Übungen für das Bakkalaureat LMBT. Aus organisatorischen Gründen wird dieser Test gleichzeitig mit der Prüfung aus Grundlagen der Biochemie angeboten. Das Abschneiden

Mehr

SingleQuant Assay Kit

SingleQuant Assay Kit GEBRAUCHSANLEITUNG SingleQuant Assay Kit Kit für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39226) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010

Mehr

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli 1 Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli Organisatorisches: Termine: 24.10.2014; 7.11.2014, 14.11.2014 Beginn: 8.15 Uhr im Seminarraum 124, Philosophenweg 12 Am Beginn

Mehr

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) PCR-Nachweis der pfmv / CTP / EPSPS-Genkassette in transgenen Kulturpflanzen

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) PCR-Nachweis der pfmv / CTP / EPSPS-Genkassette in transgenen Kulturpflanzen Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) PCR-Nachweis der pfmv / CTP / EPSPS-Genkassette in transgenen Kulturpflanzen AM009 Erstellt vom Unterausschuss Methodenentwicklung

Mehr

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil 2 Inhaltsverzeichnis Sicherheitshinweise DNA-Analytik 1 Arbeitshinweise DNA-Analytik 2 Gießen von Agarosegelen 3 Isolierung genomischer DNA 4 Isolierung

Mehr

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Bachelorkurs Evolutionsbiologie II WS 2016/17 Woche 2, Experiment 1: Insertions/Deletions Polymorphismus in D.

Bachelorkurs Evolutionsbiologie II WS 2016/17 Woche 2, Experiment 1: Insertions/Deletions Polymorphismus in D. Experiment 1: Insertions/Deletions Polymorphismus in D. melanogaster Eine der häufigsten Formen von molekularer Variabilität sind Insertionen bzw. Deletionen (abgekürzt: InDels). D.h. dass unterschiedliche

Mehr

Methodensammlung des LAG PCR-Nachweis der p35s / pat - Genkassette in transgenen Kulturpflanzen

Methodensammlung des LAG PCR-Nachweis der p35s / pat - Genkassette in transgenen Kulturpflanzen Methodensammlung des LAG PCR-Nachweis der p35s / pat - Genkassette in transgenen Kulturpflanzen erstellt vom Unterausschuß Methodenentwicklung des LAG Status: verabschiedet 1 Zweck und Anwendungsbereich

Mehr

ORIGINS-Project Laboratory Manuals. free educational use as long as unmodified. version_de. (c) the ORIGINS team

ORIGINS-Project Laboratory Manuals. free educational use as long as unmodified. version_de. (c) the ORIGINS team ORIGINS-Project Laboratory Manuals free educational use as long as unmodified version_de (c) the ORIGINS team Restriktion von DNA Pipette (gelb, 20:200), Pipettenspitzen Eppendorfgefäße Gestell Eisbox

Mehr

Produktinformation Saturn-2D REDOX Labeling Kit

Produktinformation Saturn-2D REDOX Labeling Kit Saturn-2D REDOX Labeling Kit Produktinformation Saturn-2D REDOX Labeling Kit Produkt-Nr. PR34, PR35 NH DyeAGNOSTICS GmbH Weinbergweg 23 D-06120 Halle Deutschland Technischer Support Fon: +49 (0) 345-2799

Mehr

(Nur für die Forschung) Bei Kontakt mit Augen oder Haut sofort mit viel Wasser abspülen!

(Nur für die Forschung) Bei Kontakt mit Augen oder Haut sofort mit viel Wasser abspülen! Datenblatt Artikel-Nr. 56.200.0010 10 Aufreinigungen 56.200.0050 50 Aufreinigungen 56.200.0250 250 Aufreinigungen (Nur für die Forschung) Sicherheitsanweisungen Bitte gehen Sie mit allen Materialien und

Mehr

Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 -

Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 - Inhaltsverzeichnis 1 Theoretischer Hintergrund - 2-1.1 Die Komponenten der PCR - 2-1.2 Das Verfahren der PCR - 3-1.3 Die Gelelektrophorese - 5-2 Material und Methoden - 6-3 Ergebnisse - 7-3.1 Ergebnisse

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein Transformation des Expressionsstammes

Mehr

Charakterisierung von Transkripten mittels RT-PCR

Charakterisierung von Transkripten mittels RT-PCR Charakterisierung von Transkripten mittels RT-PCR Versuchsleiter: Ulrike Gerischer Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 18.11 22.11.2002 Protokoll testiert: WS02 Universität Ulm Inhaltsverzeichnis

Mehr

Aufreiningung der DNA aus dem Nukleosomenleiter-Beispiel Isolierung von RNA aus Milzzellen

Aufreiningung der DNA aus dem Nukleosomenleiter-Beispiel Isolierung von RNA aus Milzzellen 1 2 Biochemisches Praktikum: Nukleinsäuren Teil 2 Bsp. I Bsp. II Aufreiningung der DNA aus dem Nukleosomenleiter-Beispiel Isolierung von RNA aus Milzzellen I. Lehrinhalte: Phenolextraktion zur Aufreinigung

Mehr

Experiment Isolierung, Aktivität und Hemmung der Carboanhydrase

Experiment Isolierung, Aktivität und Hemmung der Carboanhydrase Experiment Isolierung, Aktivität und emmung der Carboanhydrase 1 Aufgabe: Partnerarbeit Bilden ie selbständig Zweiergruppen. tudieren ie zuerst die Einleitung. Legen ie das Material bereit. Bereiten ie

Mehr

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Bernhard Strigel Gymnasium Kollegstufe/ Jahrgang: 2007/ 2009 Memmingen Leistungskurs: Biologie Kollegiat: Stefanie Funk Facharbeit Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Abgegeben

Mehr

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR)

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) GVO-Screening Kit Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) I. Einführung Die Gentechnik stellt die Landwirtschaft vor neue Herausforderungen. Einerseits eröffnet

Mehr

S-Dis Hotstart Polymerase

S-Dis Hotstart Polymerase Datenblatt Artikel-Nr. BS91.219.0200 Artikel-Nr. BS91.219.1000 200 Units 1000 Units (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen: Farbe: 1 Beschreibung Die

Mehr

MPP Multiplex 2x PCR-Mastermix

MPP Multiplex 2x PCR-Mastermix Datenblatt Artikel-Nr. BS91.522.0250 250 Reaktionen in 20µl Artikel-Nr. BS91.522.1250 1250 Reaktionen a 20µl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

PCR-Nachweis der pssuara / bar - Genkassette in transgenen Kulturpflanzen

PCR-Nachweis der pssuara / bar - Genkassette in transgenen Kulturpflanzen Methodensammlung des LAG PCR-Nachweis der pssuara / bar - Genkassette in transgenen Kulturpflanzen erstellt vom Unterausschuß Methodenentwicklung des LAG Status: verabschiedet 1. Zweck und Anwendungsbereich

Mehr

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Arbeitsblatt 1 Analyse von DNA 1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Bevor Sie anfangen: Alle Reagenzien müssen vor Gebrauch vollständig aufgetaut sein und durchmischt

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Molekulare Klonierung Praktikum

Molekulare Klonierung Praktikum Molekulare Klonierung Praktikum 2013 Praktikumsaufgabe Ligation 1. Zusammensetzung des Ligationsreaktions-ansatzes : 1 l Vektor DNA 1 l Insert DNA 2 l 10X Ligase Puffer 15 l destillertes Wasser 1 l Ligase

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik Qualitative PCR zum Nachweis transgener Kartoffeln mit verändertem Stärkestoffwechsel oder Schädlingsresistenz Erstellt vom Unterausschuss

Mehr

Identifizierung positiver Klone aus einer λ-phagenbibliothek

Identifizierung positiver Klone aus einer λ-phagenbibliothek Identifizierung positiver Klone aus einer λ-phagenbibliothek Betreuer: Elke Muth-Köhne und Nora Cavara Beginn des Versuchs: 9.00 Uhr im Praktikumssaal NBCF 04 Nord 1. Theoretischer Hintergrund 1.1 Screening

Mehr

SERVA Streptavidin Agarose Resin Agarosematrix zur Affinitätsreinigung von biotinylierten Biomolekülen

SERVA Streptavidin Agarose Resin Agarosematrix zur Affinitätsreinigung von biotinylierten Biomolekülen GEBRAUCHSANLEITUNG SERVA Streptavidin Agarose Resin Agarosematrix zur Affinitätsreinigung von biotinylierten Biomolekülen (Kat.-Nr. 42177) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg

Mehr

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet

Mehr

Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise

Mehr

Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen

Mehr

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C F1-Praktikum Genetik Protokoll Versuch 2: Nachweis der Funktion von Promotor- und Enhancer-Sequenzen mittels Reportergen-Assay Gruppe 8, Manfred Depner & Susanne Duncker Einführung Um die Funktion von

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

Nukleinsäuren (Prof. Stradal)

Nukleinsäuren (Prof. Stradal) 26.11. 30.11.2012 Nukleinsäuren (Prof. Stradal) 1 Laborbiologie: Biomoleküle Versuchswoche DNA Lernziele sind die Kenntnis: des molekularen Aufbaus und der wichtigsten Eigenschaften der Nukleinsäurebasen,

Mehr

Funktionelle Genomik. praktische Anwendungen

Funktionelle Genomik. praktische Anwendungen Funktionelle Genomik praktische Anwendungen Schmelzpunkt der DNA Einzelsträngige DNA absorbiert UV-Licht effektiver SYBR Green fluoresziert nur wenn es an doppelsträngiger DNA bindet Fluoreszenz erhöht

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

PCD Europe, Krefeld, Jan 2007. Auswertung von Haemoccult

PCD Europe, Krefeld, Jan 2007. Auswertung von Haemoccult Auswertung von Haemoccult Ist das positiv? Nein! Ja! Im deutschen Krebsfrüherkennungsprogramm haben nur etwa 1 % der Frauen und 1,5 % der Männer ein positives Haemoccult -Ergebnis, da dieser Test eine

Mehr

Molekularbiologie II. Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung BIOCHEMISCHES ANFÄNGERPRAKTIKUM

Molekularbiologie II. Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung BIOCHEMISCHES ANFÄNGERPRAKTIKUM V 1.8 Molekularbiologie II BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung Abteilung für Biochemie und Molekularbiologie,

Mehr

7 Anhang. Tabelle I: Zusammensetzung der Restriktionsansätze.

7 Anhang. Tabelle I: Zusammensetzung der Restriktionsansätze. 7 Anhang Tabelle I: Zusammensetzung der Restriktionsansätze. Reagenz Konzentration Volumen je Endkonzentration der Stammlösung Reaktionansatz Reaktionspuffer 10x NEB-Puffer 2 1.50 µl 1x MseI 4 U/µl 0.30

Mehr

RealLine DNA Extraction 2

RealLine DNA Extraction 2 RealLine Pathogen Diagnostic Kits Gebrauchsinformation RealLine DNA Extraction 2 KIT FÜR DIE EXTRAKTION VON DNA AUS KLINISCHEN PROBEN In-vitro Diagnostikum RealLine DNA-Extraction 2 VBC8897 96 Tests gültig

Mehr

aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT

aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1 aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1. Hinweise zu Membranen a. Nitrocellulose b. PVDF (alternativ) 2. Aufbau des Transfers a. Naßblot b. Semi-dry (alternativ) 3. Färben und Dokumentation

Mehr

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik. PCR- Nachweis von E. coli B- und BL21- Stämmen

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik. PCR- Nachweis von E. coli B- und BL21- Stämmen Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik PCR- Nachweis von E. coli B- und BL21- Stämmen Erstellt vom Unterausschuss Methodenentwicklung der LAG, März 2005 1. Zweck und Anwendungsbereich

Mehr

Mycobacterium paratuberculosis

Mycobacterium paratuberculosis BACTOTYPE PCR Amplification Kit Mycobacterium paratuberculosis Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Zellzyklus- und neuronale Gene in Trichoplax adhaerens S. Sagasser Praktikanten: Patrick Reinke und Jan Kleveman Betreuerin: Karolin von der Chevallerie

Mehr