Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus"

Transkript

1 Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Seminar Molekulare Diagnostik November 2011, Wien

2 AnDiaTec Kernkompetenz Entwicklung und Produktion von breit-reaktiven, sensitiven und gleichzeitig robusten Nachweisverfahren für schwierig zu detektierende RNA-Viren

3 Punktmutationen Genomdiversität von RNA-Viren generiert während Replikation des RNA-Genoms RNA-Polymerasen ohne Proofreading-Aktivität Unterscheidung im Genom der Nachkommenviren im Vergleich zum Elternvirus nach 1 Replikationszyklus um 1-30 Nukleotide Unterschiede zw. verschiedenen RNA-Virusfamilien je nach Replikationssystem und Genomstrukturierung Genetische Rekombination/ Gen. Re-Assortment Bei Infektion einer Wirtszelle durch zwei nahe verwandte Viren Auch Rekombination zwischen viraler und zellulärer Nukleinsäure Hervorragende Adaptation an den Wirt Breite Detektion dieser Viren sehr schwierig

4 Genomdiversität von RNA-Viren Porcines Reproduktives und Respiratorisches Syndrom Virus (PRRSV) Evolutionsrate: 7.3 x 10-2 Austausche pro Nukleotid und Jahr Humanes Enterovirus 71 (EV71) Evolutionsrate: 4.5 x 10-3 Austausche pro Nukleotid und Jahr Humanes Immundefizienz-Virus I (HIV I) Evolutionsrate: 4.0 x 10-3 Austausche pro Nukleotid und Jahr Caliciviren (u.a. best. Noroviren) Evolutionsrate: ~ 3.1 x 10-3 Austausche pro Nukleotid und Jahr Flaviviren (z.b. Classical Swine Fever Virus (CSFV)) Evolutionsrate: 2.0 x 10-3 Austausche pro Nukleotid und Jahr Hepatitis C Virus (HCV) Evolutionsrate: 1.1 x 10-3 Austausche pro Nukleotid und Jahr

5 Hepatitis-C-Virus Sequenzanalyse

6 Lösungsansätze AnDiaTec Primer ACGTAAGGCGATTGACTTAGCCGATGGCTAGCTAAGCCTAGCAT Primer mit Spacer Affinität des Spacers zum DNA-backbone Hohe Sensitivität des Primers Keine unspezifische Bindung

7 Lösungsansätze AnDiaTec Primer ACGTAAGGCGATTGACTTAGCCGATGGCTAGCTAAGCCTAGCAT Sehr kurzer Primer (11 16 Nukleotide) Erhöhung der Bindungsaffinität des Primers durch Modifikationen am 5 - und 3 -Ende Keine unspezifische Bindung Gute Sensitivität

8 Lösungsansätze AnDiaTec Primer 1 Probe Primer 2 ACGTAAGGCGATTGACTT GCCGATGGCTAGCTAAGCCTAGCAT ACGTAAGGCGATTGACTT GCCGATGGCTAGCT AGCCTAGCAT Multiplex-System zur Detektion der unterschiedlichen Stämme Gezielte Auswahl von Primern, die parallel an das Template binden können keine Interferenz zwischen Primern/ Sonden Screening-Methode zur Identifizierung geeigneter Primer/ Sonden Hohe Sensitivität Breite Reaktivität und langzeitig stabileres Verfahrens

9 Zielsetzung HCV-Diagnostik Breit reaktives Screening-Verfahren Quantifizierender Nachweis von HCV Genotypisierendes Assay

10 Relevanz Screening-Verfahren/ Quantifizierung Breit reaktives Verfahren für eine sichere Detektion aller Feldstämme Quantifizierung für Kontrolle des Therapie-Verlaufs Problematik Perfekte Abstimmung von Primern und Sonden Mögliche Beeinträchtigung der PCR-Effizienz (charakterisiert über die lineare Regressionslinie) Abbruch der Linearität nach einem bestimmten Zyklus der PCR Linearität nur in engem Amplifikationsbereich Quantifizierung wäre dadurch nur bedingt möglich

11 Screening-Verfahren/ Quantifizierung Ergebnisse Wettbewerber Kit R 2 = POS NEG 34 R 2 = AnDiaTec Kit POS 461 3* NEG A ve rage C t V alu e Stratagene Av Ct 7500 Fast Dx Av Ct Dilution * 3 Proben als richtig-positiv identifiziert

12 Relevanz Genotypisierung V.a. Unterscheidung zwischen Genotyp 1 (a/b) vs. Genotypen 2-6 Information relevant zur Therapie-Entscheidung (Dosierung PEG- IFNα + Ribavirin Therapie-Dauer) und Aussicht auf Erfolg Problematik Keine eindeutigen Genotyp-spezifischen Basenaustausche Keine eindeutigen Genotyp-spezifischen Basenaustausche Auch hier muss mit mehr als einem Primer-/Sondenpaar gearbeitet werden Mögliche Kreuz-Reaktivitäten und dadurch falsche Differenzierungsergebnisse Falsche Therapie-Entscheidung Probleme mit Ringversuchszertifikaten und Akkreditierung des Labors für HCV-Diagnostik

13 AnDiaTec Testformate Screening-Verfahren CE-Markierung erteilt Quantifizierende Kitversion CE-Markierung kurz vor Abschluss Differenzierendes Assay - Evaluierungsphase

14 Vielen Dank für Ihre Aufmerksamkeit!

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems

Mehr

Neuigkeiten bei CMV / Herpes Panel, Enterovirus 68 Ausbruch in Nordamerika

Neuigkeiten bei CMV / Herpes Panel, Enterovirus 68 Ausbruch in Nordamerika Neuigkeiten bei CMV / Herpes Panel, Influenza / respiratorische Viren, sowie Enterovirus 68 Ausbruch in Nordamerika Dr. Johannes Kehle Seminar Molekulare Diagnostik 2014 Hotel Fleming s Wien-Westbahnhof

Mehr

Auszug aus dem Strukturierten Qualitätsbericht

Auszug aus dem Strukturierten Qualitätsbericht Auszug aus dem Strukturierten Qualitätsbericht gemäß 137 Abs. 3 Satz 1 Nr. 4 SGB V für das Berichtsjahr 2010 Institut für Virologie B-37 Institut für Virologie B-37.1 Allgemeine Angaben : Institut für

Mehr

Während der Synthese synthetisiert die Polymerase den neuen Strang in 5 3 Richtung und bewegt sich in 3 5 -Richtung am Matrizenstrang entlang:

Während der Synthese synthetisiert die Polymerase den neuen Strang in 5 3 Richtung und bewegt sich in 3 5 -Richtung am Matrizenstrang entlang: 4.4 Replikation und PCR Ablauf der Replikation in vivo: Die Replikation wird von einer DNA-abhängigen DNA- Polymerase katalysiert. Jede DNA-Polymerase synthetisiert den neuen Strang in 5 3 Richtung, hierzu

Mehr

HIV-1 NAT-Testversager durch Mutationen

HIV-1 NAT-Testversager durch Mutationen HIV-1 NAT-Testversager durch Mutationen Dr. B. Müller, NAT-Labor, Hagen Aktueller Fall in Österreich vom 28.02.2013 Diagnostische Fensterspende Folie 2 Überblick Prävalenz bei Neuspendern100.000 Untersuchungen:

Mehr

Molekulargenetischer Nachweis und Genotypisierung von HPV

Molekulargenetischer Nachweis und Genotypisierung von HPV Molekulargenetischer Nachweis und Genotypisierung von HPV Dr. Sabine Sussitz-Rack Institut für Labordiagnostik und Mikrobiologie Vorstand: Prim. Prof. DDr. Pranav Sinha Humanes Papillomavirus HPV HPV ist

Mehr

Diagnostik der akuten HIV Infektion: Reicht der HIV Screening Test oder braucht es eine PCR?

Diagnostik der akuten HIV Infektion: Reicht der HIV Screening Test oder braucht es eine PCR? Diagnostik der akuten HIV Infektion: Reicht der HIV Screening Test oder braucht es eine PCR? PD Dr. Jürg Böni Institut für Medizinische Virologie Nationales Zentrum für Retroviren Universität Zürich Die

Mehr

cobas T HSV 1/2 Test Erweiterung Ihres STI Menüs mit Dual-Target Detektion für zuverlässige Befunde

cobas T HSV 1/2 Test Erweiterung Ihres STI Menüs mit Dual-Target Detektion für zuverlässige Befunde cobas T HSV 1/2 Test Erweiterung Ihres STI Menüs mit Dual-Target Detektion für zuverlässige Befunde Zuverlässige HSV 1/2 Ergebnisse, zukunftssicher Herpes simplex Viren zählen zu den am häufigsten sexuell

Mehr

Unsere Testparameter für Ihr PCR-Labor

Unsere Testparameter für Ihr PCR-Labor Unsere Testparameter für Ihr PCR-Labor Tests für die in-vitro-diagnostik CE-IVD validierte Analyse von der Probenaufarbeitung bis zur Ergebnisausgabe Parameter Testtypus Analysesystem Probenmaterial Testspezifikationen

Mehr

zur Differentialdiagnose bei Rheuma

zur Differentialdiagnose bei Rheuma Molekulare l Analyse von HLA B27 zur Differentialdiagnose bei Rheuma Dr. Maria Haß Seminar Molekulare Diagnostik 2014 Bio Products, Wien HLA System Humanes Leukozytenantigen, = Haupthistokompatibilitätskomplex

Mehr

Fallstricke in der HIV-Diagnostik. Elisabeth Puchhammer-Stöckl Department für Virologie Medizinische Universität Wien

Fallstricke in der HIV-Diagnostik. Elisabeth Puchhammer-Stöckl Department für Virologie Medizinische Universität Wien Fallstricke in der HIV-Diagnostik Elisabeth Puchhammer-Stöckl Department für Virologie Medizinische Universität Wien HIV-Infektion: Diagnostik- Zeitverlauf Nach Pilcher et al, 2004 HIV-Infektion: Diagnostik-

Mehr

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke PCR-ELISA Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke Luitgardis Seigner und Stefan Knabel * Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz * Ehemaliger

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin - Status und Zukunft PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin

Mehr

Entwicklung eines sensitiven Nachweisverfahrens für Hepatitis E- Viren in Rohwurstprodukten und Leberwurst

Entwicklung eines sensitiven Nachweisverfahrens für Hepatitis E- Viren in Rohwurstprodukten und Leberwurst BUNDESINSTITUT FÜR RISIKOBEWERTUNG Entwicklung eines sensitiven Nachweisverfahrens für Hepatitis E- Viren in Rohwurstprodukten und Leberwurst Dr. Eva Trojnar Dr. Kathrin Szabo Hepatitis E in Deutschland

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Nachweis von Antikörpern gegen porzine Influenza A Viren Ergebnisse eines Ringtests Untersuchungen von Feldproben. V. Herwig, C. Laue, R.

Nachweis von Antikörpern gegen porzine Influenza A Viren Ergebnisse eines Ringtests Untersuchungen von Feldproben. V. Herwig, C. Laue, R. Nachweis von Antikörpern gegen porzine Influenza A Viren Ergebnisse eines Ringtests Untersuchungen von Feldproben V. Herwig, C. Laue, R. Dürrwald Haemagglutinationshemmungstest Nachweis von Antikörpern

Mehr

Die Diagnostik der Koi-Herpesvirus-Infektion

Die Diagnostik der Koi-Herpesvirus-Infektion Die Diagnostik der Koi-Herpesvirus-Infektion Sven M. Bergmann und Dieter Fichtner Institut für Infektionsmedizin Nationales Referenzlabor für Fischkrankheiten Verbreitung der Infektion mit dem KHV Klinisches

Mehr

Wichtige Aspekte der Qualitätskontrolle in der Infektionsserologie. Ilka Richert, Bio-Rad Laboratories GmbH

Wichtige Aspekte der Qualitätskontrolle in der Infektionsserologie. Ilka Richert, Bio-Rad Laboratories GmbH Wichtige Aspekte der Qualitätskontrolle in der Infektionsserologie Ilka Richert, Bio-Rad Laboratories GmbH Hepatitis B Serokonversion Infektionsserologische Tests Sensitivität Spezifität Richtig pos. Ergebnisse

Mehr

Entwicklung und Validierung der VIROTYPE BVDV real-time RT-PCR

Entwicklung und Validierung der VIROTYPE BVDV real-time RT-PCR Entwicklung und Validierung der real-time RT-PCR Gaunitz C, Engemann C, Labitzke M, Schroeder C, Kühn TE, Gabert, J Labor Diagnostik GmbH Leipzig Gliederung Testprinzip Testprotokoll Testcharakteristik

Mehr

Athanasios Makristathis. Klinische Abteilung für Mikrobiologie Klinisches Institut für Labormedizin

Athanasios Makristathis. Klinische Abteilung für Mikrobiologie Klinisches Institut für Labormedizin Molekulare H. pylori-diagnostik im Stuhl; Erfahrungen im pädiatrischen Bereich Athanasios Makristathis Klinische Abteilung für Mikrobiologie Klinisches Institut für Labormedizin 1 Molekulare Verfahren

Mehr

Preise für Mikroorganismen

Preise für Mikroorganismen Die Preiskategorie wird in jedem Datenblatt eines Stammes aufgeführt. Alle Preise sind Nettopreise. Preise für Mikroorganismen Lieferform Preiskategorien 1 2 3 4 5 6 Gefriergetrocknet (Ampulle) 80,00 80,00

Mehr

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie Pathologie und Prädiktion - neue Aspekte Paradigmenwechsel in der Pathologie -Pathologe zentraler Lotse bei der individuellen Therapieentscheidung -Gewebeuntersuchung nicht nur aus diagnostischen sondern

Mehr

Influenza des Schweines

Influenza des Schweines Influenza des Schweines Historie: - erstmals beobachtet 1918 in USA, China, Ungarn - zeitgleich mit der Pandemie beim Menschen (> 20 Mill. Tote) - Virus-Subtyp H1N1 - Übertragung sehr wahrscheinlich vom

Mehr

Virusinfektionen bei Urlaubsrückkehrern

Virusinfektionen bei Urlaubsrückkehrern Virusinfektionen bei Urlaubsrückkehrern Virusinfektionen bei Urlaubsrückkehrern Stephan Aberle Klinisches Institut für Virologie Medizinische Universität Wien ÖGTP-Fortbildung 30.1.2007 Hanta Pulmonary

Mehr

Diagnostik der Norovirusinfektionen beim Menschen und aus Abstrichen und Lebensmittelproben

Diagnostik der Norovirusinfektionen beim Menschen und aus Abstrichen und Lebensmittelproben Diagnostik der Norovirusinfektionen beim Menschen und aus Abstrichen und Lebensmittelproben Norovirus allgemein Familie der Caliciviridae humanpathogen: Norovirus, Sapovirus nicht humanpathogen: Lagovirus,

Mehr

Sapoviren Bedeutung in Deutschland

Sapoviren Bedeutung in Deutschland Sapoviren Bedeutung in Deutschland Marina Höhne Robert Koch-Institut, Berlin Konsiliarlabor für Noroviren 26.03.2015, REMMDI 2015 Ursachen von Gastroenteritiden in Deutschland, 2001 bis 2014 350.000 Labor-bestätigte

Mehr

Stand der molekularen Resistenzbestimmung - sind die Methoden schon routinetauglich?

Stand der molekularen Resistenzbestimmung - sind die Methoden schon routinetauglich? Stand der molekularen Resistenzbestimmung - sind die Methoden schon routinetauglich? Peter Heisig Pharmazeutische Biologie und Mikrobiologie Universität Hamburg PH2008, UniHH 1 Vor- und Nachteile genetischer

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Update Hepatitis C was bringen die neuen Medikamente für unsere KlientInnen? Welche neuen Erkenntnisse gibt es zu Testing und Behandlung?

Update Hepatitis C was bringen die neuen Medikamente für unsere KlientInnen? Welche neuen Erkenntnisse gibt es zu Testing und Behandlung? Update Hepatitis C was bringen die neuen Medikamente für unsere KlientInnen? Welche neuen Erkenntnisse gibt es zu Testing und Behandlung? Philip Bruggmann Arud Testen und Screenen Nichterkennung einer

Mehr

Virusgenome und virale Replikationsstrategien

Virusgenome und virale Replikationsstrategien Virusgenome und virale Replikationsstrategien Hans-Georg Kräusslich, Abteilung Virologie http://virology.hyg.uni-heidelberg.de 2. Mai 2006 Grundzüge der viralen Replikation Genomaufbau und Replikationsstrategien

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

MVZ Mikrobiologie & UKE. Hepatitisdiagnostik

MVZ Mikrobiologie & UKE. Hepatitisdiagnostik MVZ Mikrobiologie & UKE Hepatitisdiagnostik Hepatitisviren Virus Familie Struktur Genom Genotypen chron. Infektion HAV Picornaviren 27nm ohne Hülle ss(+)rna, 7.5kb 7 (I-VII) nein HBV Hepadnaviren 45nm

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Ein Blick in die Zukunft, Entwicklung neuer Testverfahren zum Nachweis von Salmonellen und Campylobacter. Dr. Janin Stratmann-Selke

Ein Blick in die Zukunft, Entwicklung neuer Testverfahren zum Nachweis von Salmonellen und Campylobacter. Dr. Janin Stratmann-Selke Ein Blick in die Zukunft, Entwicklung neuer Testverfahren zum Nachweis von Salmonellen und Campylobacter Dr. Janin Stratmann-Selke Salmonellen und Campylobacter als Erreger von Lebensmittelinfektionen

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

LMU. Picornaviren. - nicht segmentiert - Ikosaedrisches NC - umhüllt - ES RNA (+)

LMU. Picornaviren. - nicht segmentiert - Ikosaedrisches NC - umhüllt - ES RNA (+) LMU Picornaviren - nicht segmentiert - Ikosaedrisches NC - umhüllt - ES RNA (+) RNA-Viren - Einteilung (+) Strang RNA-Viren LMU Picornaviridae: Enterovirus polio, coxsackie, echo Rhinovirus human rhino

Mehr

Hantavirus-Diagnostik

Hantavirus-Diagnostik Hantavirus-Diagnostik A. Lucht, D. Münstermann, R. Geisel --------------------------------------------- Labor Dr. Krone & Partner Medizinaluntersuchungsstelle Bad Salzuflen, Herford Hanta-Virusstruktur

Mehr

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten Hilden (10. Januar 2012) - QIAGEN hat von zwei US-amerikanischen Biotechnologieunternehmen weltweit exklusive

Mehr

Virologische Diagnostik von Hantavirusinfektionen

Virologische Diagnostik von Hantavirusinfektionen Virologische Diagnostik von Hantavirusinfektionen Jörg Hofmann Institut für Medizinische Virologie Charite Universitätsklinikum Berlin Nationales Konsiliarlabor für Hantaviren Gerrit Dou, Der Arzt. 1653,

Mehr

Titer. französisch titre: Feingehalt

Titer. französisch titre: Feingehalt Serologie Testverfahren (in der Mikrobiologie und Virologie) zur Bestimmung spezifischer Antikörper im Serum oder in anderen Körperflüssigkeiten gegen infektiöse Erreger Titer französisch titre: Feingehalt

Mehr

BVDV-Diagnostik Diagnostik anhand von Ohrstanzproben ELISA und Real time RT-PCR im Vergleich

BVDV-Diagnostik Diagnostik anhand von Ohrstanzproben ELISA und Real time RT-PCR im Vergleich BVDV-Diagnostik Diagnostik anhand von Ohrstanzproben ELISA und Real time RT-PCR im Vergleich R. Fux 1, C. Baudy 1, I. Moßbrugger 1, M. Hellwig 2, R. Birlbauer 2 und G. Wolf 1 1 Institut für Medizinische

Mehr

Epstein-Barr-Virus-Infektion: Möglichkeiten und Grenzen der serologischen Diagnostik von Reaktivierungen und chronischen Verläufen

Epstein-Barr-Virus-Infektion: Möglichkeiten und Grenzen der serologischen Diagnostik von Reaktivierungen und chronischen Verläufen Epstein-Barr-Virus-Infektion: Möglichkeiten und Grenzen der serologischen Diagnostik von Reaktivierungen und chronischen Verläufen Dr. Claudia Wolff Viramed Biotech AG 1 Akute EBV-Primärinfektion Erster

Mehr

Hepatitis C: Was gibt es Neues?

Hepatitis C: Was gibt es Neues? Hepatitis C: Was gibt es Neues? Heiner Wedemeyer Medizinische Hochschule Hannover 1 37 Jähriger Patient, Fibrose HCV-Genotyp 3a, HCV-RNA >800.000 IU/ml Z.n. PEG-IFN/RBV, Abbruch bei starken Nebenwirkungen

Mehr

Analytik Jena Life Science

Analytik Jena Life Science Analytik Jena Life Science Systemanbieter für die Molekularbiologie Neue Wege in der mobilen Erregerdiagnostik Inhalt - Einleitung - Die Aufgabenstellung - Salmonellen in der Nahrungsmittelindustrie -

Mehr

VIROTYPE PRRSV Gebrauchsinformation

VIROTYPE PRRSV Gebrauchsinformation V1_2012-04-16 VIROTYPE PRRSV Gebrauchsinformation Real-time Multiplex RT-PCR Testkit zum Nachweis von EU-, NA- und HP-PRRS-Viren in vitro-diagnostikum für Schweine Die deutsche Gebrauchsinformation ist

Mehr

58. Jahrestagung der deutschen STD-Gesellschaft

58. Jahrestagung der deutschen STD-Gesellschaft 58. Jahrestagung der deutschen STD-Gesellschaft 17.-19. September 2009 Bochum Neues zur Chlamydien Diagnostik T. Meyer Institut für Medizinische Mikrobiologie, Virologie und Hygiene Universitätsklinikum

Mehr

Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1

Mehr

Einsatz einer Rinder-spezifischen Internen Kontrolle im Rahmen des BVDV-Nachweises mittels real-time RT-PCR aus Ohrgewebe

Einsatz einer Rinder-spezifischen Internen Kontrolle im Rahmen des BVDV-Nachweises mittels real-time RT-PCR aus Ohrgewebe Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Einsatz einer Rinder-spezifischen Internen Kontrolle im Rahmen des BVDV-Nachweises mittels real-time RT-PCR aus Ohrgewebe AVID-Workshop BVD-Ohrstanzendiagnostik

Mehr

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus Aus dem Institut für Virologie der Tierärztlichen Hochschule Hannover und dem Institut für Virusdiagnostik des Friedrich-Loeffler-Instituts, Insel Riems Etablierung, Validierung und praktische Anwendung

Mehr

Molekulare Epidemiologie viraler Erregr (Robert Koch Institut)

Molekulare Epidemiologie viraler Erregr (Robert Koch Institut) Molekulare Epidemiologie viraler Erregr (Robert Koch Institut) Rotavirus Konsiliarlabor Norovirus Konsiliarlabor Astrovirus Picornavirus (HAV) Adenovirus HCV Enterovirus NRZ/RRL-WHO Aichivirus PD Dr. Eckart

Mehr

QIAsymphony DSP Virus/Pathogen Kit

QIAsymphony DSP Virus/Pathogen Kit QIAsymphony DSP Virus/Pathogen Kit Die QIAsymphony DSP Virus/Pathogen Kits sind nur für den Gebrauch mit dem QIAsymphony SP vorgesehen. Die QIAsymphony DSP Virus/Pathogen Kits enthalten die Reagenzien

Mehr

Roche Personalisierte Medizin Die Behandlungen auf die Patienten zuschneiden. April 2012

Roche Personalisierte Medizin Die Behandlungen auf die Patienten zuschneiden. April 2012 Roche Personalisierte Medizin Die Behandlungen auf die Patienten zuschneiden April 2012 Gesundheitswesen Personalisierte Medizin bei Roche Vorteile für Patienten, Ärzte und Kostenträger Einzigartige Positionierung

Mehr

Chlamydia MIF IgG. Leistungsmerkmale. Produktnummer: IF1250G Rev. J. Nicht für den Vertrieb in den USA

Chlamydia MIF IgG. Leistungsmerkmale. Produktnummer: IF1250G Rev. J. Nicht für den Vertrieb in den USA Produktnummer: IF1250G Rev. J Leistungsmerkmale Nicht für den Vertrieb in den USA ERWARTETE WERTE Patienten mit ambulant erworbener Pneumonie Zwei externe Prüfer untersuchten den Focus Chlamydia MIF IgM

Mehr

Evidenzbasierte Diagnostik

Evidenzbasierte Diagnostik Seminar Allgemeinmedizin 2011 Evidenzbasierte Diagnostik A. Sönnichsen Beurteilung eines diagnostischen Tests: Sensitivität Prozentsatz der Test-positiven von allen Erkrankten Spezifität Prozentsatz der

Mehr

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle Angefertigt am Fachbereich 08 - Biologie und Chemie in Zusammenarbeit mit dem Institut für Medizinische Virologie am Fachbereich 11- Medizin der Justus-Liebig-Universität Gießen Die antivirale Therapie

Mehr

PCV-2 in Zellkulturen. Problem bei der Etablierung neuer Erregernachweise?

PCV-2 in Zellkulturen. Problem bei der Etablierung neuer Erregernachweise? PCV-2 in Zellkulturen Problem bei der Etablierung neuer Erregernachweise? Dienstsitz Berlin Invalidenstraße 60 10557 Berlin Standort Frankfurt/Oder Gerhard-Neumann-Straße 2/3 15236 Frankfurt (Oder) Landeslabor

Mehr

Etablierung der NIPD-RHD in Innsbruck

Etablierung der NIPD-RHD in Innsbruck Etablierung der NIPD-RHD in Innsbruck Erste Stolpersteine: Kitbeschreibung Erster kommerziell erhältlicher Kit Testung der Rhesus D Exons: 5, 7, und 10 Kontrolle durch Mais DNA CE Zertifikat RICHTLINE

Mehr

FluoroCycler : Die smarte Offensive. Seminar Molekulare Diagnostik 27. November 2013, Wien, David Hain, Hain Lifescience GmbH, Nehren

FluoroCycler : Die smarte Offensive. Seminar Molekulare Diagnostik 27. November 2013, Wien, David Hain, Hain Lifescience GmbH, Nehren FluoroCycler : Die smarte Offensive Seminar Molekulare Diagnostik 27. November 2013, Wien, David Hain, Hain Lifescience GmbH, Nehren Wer wir sind Hain Lifescience ist ein Unternehmen mit über 25-jähriger

Mehr

04.02.2015. Atemwegserkrankungen. Entstehung von Atemwegserkrankungen

04.02.2015. Atemwegserkrankungen. Entstehung von Atemwegserkrankungen Atemwegserkrankungen Entstehung von Atemwegserkrankungen 1 Die Atemluft gelangt über die oberen Atemwege (Nase, Maul, Rachen) in die unteren Atemwege (Kehlkopf, Luftröhre), schließlich in die Lunge, und

Mehr

PCR-RESISTENZTESTUNG BEI H. PYLORI: BEST OF IM VERGLEICH PUTTINGER MARIA-CHRISTINA BSC., OA DR. HALABI MILO, WALDHÖR KARIN

PCR-RESISTENZTESTUNG BEI H. PYLORI: BEST OF IM VERGLEICH PUTTINGER MARIA-CHRISTINA BSC., OA DR. HALABI MILO, WALDHÖR KARIN PCR-RESISTENZTESTUNG BEI H. PYLORI: BEST OF IM VERGLEICH PUTTINGER MARIA-CHRISTINA BSC., OA DR. HALABI MILO, WALDHÖR KARIN HELICOBACTER PYLORI Warren and Marshall 1983 gramnegatives einfach gebogenes oder

Mehr

Flensburg University of Applied Sciences. FH Flensburg Fachbereich Technik

Flensburg University of Applied Sciences. FH Flensburg Fachbereich Technik Flensburg University of Applied Sciences Flensburg University of Applied Sciences Structure Number of Students 3,700 Department of Business 3 Bachelor, 3 Master Department of Technology 9 Bachelor, 3 Master

Mehr

Aufgaben des Nationalen Referenzzentrums für Influenza. B. Schweiger Robert Koch-Institut, Berlin

Aufgaben des Nationalen Referenzzentrums für Influenza. B. Schweiger Robert Koch-Institut, Berlin Aufgaben des Nationalen Referenzzentrums für Influenza B. Schweiger Robert Koch-Institut, Berlin Aufgaben des NRZ Influenza Nachweis, Typisierung und Subtypisierung der zirkulierenden Influenzaviren Antigene

Mehr

Erfahrungen mit PC-gestützter Untersuchung von Blut- und Ohrstanzproben im Pool auf BVDV mit VIROTYPE BVDV

Erfahrungen mit PC-gestützter Untersuchung von Blut- und Ohrstanzproben im Pool auf BVDV mit VIROTYPE BVDV Erfahrungen mit PC-gestützter Untersuchung von Blut- und Ohrstanzproben im Pool auf BVDV mit VIROTYPE BVDV Blut Untersuchungszahlen Ohrstanzen 2007 2008 mit rt PCR nach Hoffmann 116.204 Plasma- oder Serumproben

Mehr

Linking Transcription to the Metabolic State

Linking Transcription to the Metabolic State Towards Systems Biology of the Chloroplast under Stress: Linking Transcription to the Metabolic State Dissertation Zur Erlangung des Akademischen Grades Doktor der Naturwissenschaften (Dr. rer. nat.) Fakultat

Mehr

Rekombinante Wirkstoffe! 9. Vorlesung!

Rekombinante Wirkstoffe! 9. Vorlesung! Rekombinante Wirkstoffe! 9. Vorlesung! Prof. Dr. Theo Dingermann Ins2tut für Pharmazeu2sche Biologie Goethe- Universität Frankfurt Dingermann@em.uni- frankfurt.de Hepatitiden als Hauptindikation für rekombinante

Mehr

Vergleich von diagnostischen Methoden zum Nachweis der Koi-Herpesvirus

Vergleich von diagnostischen Methoden zum Nachweis der Koi-Herpesvirus Vergleich von diagnostischen Methoden zum Nachweis der Koi-Herpesvirus Herpesvirus-Infektion (KHV-I) Fischgesundheitsdienst Dr. Kerstin Böttcher, Dr. Grit Bräuer Vergleich von diagnostischen Methoden zum

Mehr

6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13002-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13002-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13002-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 21.03.2013 bis 20.03.2018 Urkundeninhaber: gerbion GmbH & Co. KG

Mehr

artus HCV QS-RGQ Kit Leistungsmerkmale Januar 2014 Sample & Assay Technologies Nachweisgrenze (LOD) Angaben zur Version

artus HCV QS-RGQ Kit Leistungsmerkmale Januar 2014 Sample & Assay Technologies Nachweisgrenze (LOD) Angaben zur Version artus HCV QS-RGQ Kit Leistungsmerkmale artus HCV QS-RGQ Kit, Version 1, 4518363, 4518366 Angaben zur Version Dieses Dokument sind die artus HCV QS-RGQ Kit Leistungsmerkmale, Version 1, R3. Prüfen Sie vor

Mehr

Vorlesung. Virologie

Vorlesung. Virologie Vorlesung Allgemeiner Teil Geschichtlicher Überblick Virus: Definition, Aufbau, Einteilung Virusvermehrung / Replikation Pathogenese / Zellschädigung Immortalisierung / Transformation Kurzversion: Immunologie

Mehr

Zusammenfassung. 1 Einleitung. 2 Material & Methoden. 1.1 Hepatitis B Virus (HBV) 1.2 Adeno-Assoziierte Viren (AAV) 1.3 Das humane Immunsystem

Zusammenfassung. 1 Einleitung. 2 Material & Methoden. 1.1 Hepatitis B Virus (HBV) 1.2 Adeno-Assoziierte Viren (AAV) 1.3 Das humane Immunsystem Zusammenfassung 1 Einleitung 1.1 Hepatitis B Virus (HBV) 1.1.1 Epidemiologie des humanen HBV 1.1.2 Partikelaufbau des HBV 1.1.3 Hüllproteine 1.1.4 Genomorganisation 1.1.5 Replikationszyklus 1.2 Adeno-Assoziierte

Mehr

Therapieoptionen Hepatitis B

Therapieoptionen Hepatitis B Therapieoptionen Hepatitis B Interferon alpha Viral entry Uncoating Nuclear import Assembly & budding cccdna HBsAg ER Positive strand synthesis Removal of pregenome Lamivudin Adefovir Entecavir Tenofovir

Mehr

Prävalenz bei ambulanten Patienten mit ambulant erworbener Pneumonie nach Erreger

Prävalenz bei ambulanten Patienten mit ambulant erworbener Pneumonie nach Erreger Produktnummer: IF1250M Rev. I Leistungsmerkmale Nicht für den Vertrieb in den USA ERWARTETE WERTE Patienten mit ambulant erworbener Pneumonie Zwei externe Prüfer untersuchten den Focus Chlamydia MIF IgM

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Grundlagen Virologie J. Kühn

Grundlagen Virologie J. Kühn Grundlagen Virologie J. Kühn Virosphäre Häufigkeit von Viren wird dramatisch unterschätzt ca. 3x10 9 Viruspartikel/l Meerwasser ca. 4x10 30 Viruspartikel in den Ozeanen dies entspricht ca. 8x10 8 Tonnen

Mehr

Hepatitis E Harald H. Kessler, Dosch-Symposium, Velden, Juni 2015

Hepatitis E Harald H. Kessler, Dosch-Symposium, Velden, Juni 2015 Hepatitis E Fallpräsentation (1) 39-jähriger Patient mit Hodgkin-Lymphom Therapie: Response Adjusted Therapy AVBD (Doxyrubuicin, Vincristin, Bleomycin, Dacarbizin) Progression Salvage-Therapie Ifosfamid,

Mehr

... zu HIV*: * Human Immunodeficiency Virus (menschliches Immunschwäche-Virus)

... zu HIV*: * Human Immunodeficiency Virus (menschliches Immunschwäche-Virus) Testverfahren... Stand August 2012... zu HIV*: * Human Immunodeficiency Virus (menschliches Immunschwäche-Virus) Der Antikörpernachweis (die Nachweismethode): Gegen viele Bestandteile des HIV bildet das

Mehr

Enterovirus/Parechovirus Infektionen. Daniela Huzly Institut für Virologie Freiburg

Enterovirus/Parechovirus Infektionen. Daniela Huzly Institut für Virologie Freiburg Enterovirus/Parechovirus Infektionen Daniela Huzly Institut für Virologie Freiburg Virologie Beide gehören zur Familie der PICORNAVIRIDAE Enteroviren werden traditionell unterteilt in: Poliovirus 1 3 Echoviren

Mehr

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Wolfgang Hulla KFJ-Sital / SMZ-Süd, Wien Grundlagen Historischer Ausgangspunkt Anwendungen und klinische Relevanz Methodik Auswertung

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Traditionelle und innovative Impfstoffentwicklung

Traditionelle und innovative Impfstoffentwicklung Traditionelle und innovative Impfstoffentwicklung Reingard.grabherr@boku.ac.at Traditionelle Impfstoffentwicklung Traditionelle Impfstoffentwicklung Louis Pasteur in his laboratory, painting by A. Edelfeldt

Mehr

Lebererkrankungen & Hämophilie Spektrum und Diagnostik der Leberambulanz

Lebererkrankungen & Hämophilie Spektrum und Diagnostik der Leberambulanz Hämophilie-Symposium Homburg 2008 Lebererkrankungen & Hämophilie Spektrum und Diagnostik der Leberambulanz Dr. med. Frank Grünhage Medizinische Klinik II Ambulanz für Hepatologie Lebererkrankungen & Hämophilie

Mehr

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie HIV-Infektion und AIDS Seminar aus funktioneller Pathologie Retroviren des Menschen Lentiviren von Primaten Das Virion des HI-Virus schematisch und elektronenmikroskopisch Virale Gene Bindungssequenzen

Mehr

Infektion mit dem Zytomegalievirus (CMV) in der Schwangerschaft. CMV-Serologie: IgM, IgG und Avidität? Christoph Koidl April 2013

Infektion mit dem Zytomegalievirus (CMV) in der Schwangerschaft. CMV-Serologie: IgM, IgG und Avidität? Christoph Koidl April 2013 Infektion mit dem Zytomegalievirus (CMV) in der Schwangerschaft CMV-Serologie: IgM, IgG und Avidität? Christoph Koidl April 2013 Einleitung-Systematik - Familie: Herpesviridae - Subfamilie: Betaherpesvirinae

Mehr

Die Labordiagnose der Virushepatitis

Die Labordiagnose der Virushepatitis Seite 1 von 6 Die Labordiagnose der Virushepatitis Die primär hepatotropen Erreger HepatitisAVirus (HAV) HepatitisBVirus (HBV) HepatitisCVirus (HCV) HepatitisDVirus (HDV) (HepatitisDeltaVirus) HepatitisEVirus

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Virologie 2.0 von Roche Diagnostics. Die neue Dimension an Sicherheit und Zuverlässigkeit

Virologie 2.0 von Roche Diagnostics. Die neue Dimension an Sicherheit und Zuverlässigkeit Virologie 2.0 von Roche Diagnostics Die neue Dimension an Sicherheit und Zuverlässigkeit Das ist Virologie 2.0 von Roche Diagnostics Sicherheit Die neuen Technologie-Designs (Dual-Probe und Dual-Target)

Mehr

BMELV- Projekt: Innovatives Barrieresystem gegen Aviäre Influenza für die Freilandhaltung Statusbericht

BMELV- Projekt: Innovatives Barrieresystem gegen Aviäre Influenza für die Freilandhaltung Statusbericht BMELV Projekt: Innovatives Barrieresystem gegen Aviäre Influenza für die Freilandhaltung Statusbericht Projektpartner: Bauer, J.:, Technische Universität München Haidn, B.: Bayerische Landesanstalt für

Mehr

Molekulare Diagnostik in der Dermato-Onkologie: Wie? Wann? Warum? Was? Und was kostet es?

Molekulare Diagnostik in der Dermato-Onkologie: Wie? Wann? Warum? Was? Und was kostet es? Molekulare Diagnostik in der Dermato-Onkologie: Wie? Wann? Warum? Was? Und was kostet es? Ralf Gutzmer Klinik für Dermatologie, Allergologie und Venerologie Haut- Tumor- Zentrum Hannover Wann+Warum? Wenn

Mehr

Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin

Mehr

Virale Infektionen Infektionsmuster. Zellbiologische Definitionen

Virale Infektionen Infektionsmuster. Zellbiologische Definitionen Virale Infektionen Zellbiologische Definitionen 1. Infektion: Eintritt eines Replikations-fähigen viralen Genoms in die Zelle. Die Infektion kann aber muss nicht zur Vermehrung des Virus führen. Epitheliale

Mehr

Infektmarker im schweizerischen Blutspendedienst Dr. phil. nat. Caroline Tinguely, Labor Infektmarker IRB SRK AG / nationales Referenzlabor B-CH SRK

Infektmarker im schweizerischen Blutspendedienst Dr. phil. nat. Caroline Tinguely, Labor Infektmarker IRB SRK AG / nationales Referenzlabor B-CH SRK Infektmarker im schweizerischen Blutspendedienst Dr. phil. nat. Caroline Tinguely, Labor Infektmarker IRB SRK AG / nationales Referenzlabor B-CH SRK Seite 1 Übersicht Blutspendewesen und Rotes Kreuz Gesetz

Mehr

RNA-guided editing of bacterial genomes using CRISPR-Cas systems

RNA-guided editing of bacterial genomes using CRISPR-Cas systems RNA-guided editing of bacterial genomes using CRISPR-Cas systems Wenyan Jiang, David Bikard, David Cox, Feng Zhang, and Luciano A. Marraffini Nature Biotechnology, 31, 233 239, 2013 Nadja Kleisch Biotechnologie,

Mehr

Ein Test. Viel Gründe.

Ein Test. Viel Gründe. Ein Test. Viel Gründe. FlockChek Aviäre Influenza MultiS-Screen Ak Testkit 12. Gefügelfachtagung Stendal Dr. Christina Boss IDEXX GmbH, Ludwigsburg 1 2008 IDEXX Laboratories, Inc. All rights reserved.

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

Dr. Mathilde Kutilek Österreichisch-Iranische Ärztegesellschaft 13.11.2010

Dr. Mathilde Kutilek Österreichisch-Iranische Ärztegesellschaft 13.11.2010 Dr. Mathilde Kutilek Österreichisch-Iranische Ärztegesellschaft 13.11.2010 Hepatitis Labor: GOT = Glutamat-Oxalacetat-Transaminase = AST = Aspertat-Aminotransferase GPT = Glutamat-Pyrovat-Transaminase

Mehr