NATURA. Lösungen. Qualifikationsphase. bearbeitet von. Horst Bickel Anna Büntge Inka Montero Carsten Schmidt Petra Stock

Größe: px
Ab Seite anzeigen:

Download "NATURA. Lösungen. Qualifikationsphase. bearbeitet von. Horst Bickel Anna Büntge Inka Montero Carsten Schmidt Petra Stock"


1 NATURA Qualifikationsphase bearbeitet von Horst Bickel Anna Büntge Inka Montero Carsten Schmidt Petra Stock Lösungen Ernst Klett Verlag Stuttgart Leipzig

2 Auflage Alle Drucke dieser Auflage sind unverändert und können im Unterricht nebeneinander verwendet werden Die letzte Zahl bezeichnet das Jahr des Druckes Das Werk und seine Teile sind urheberrechtlich geschützt Jede Nutzung in anderen als den gesetzlich zugelassenen Fällen bedarf der vorherigen schriftlichen Einwilligung des Verlages Hinweis 52 a UrhG: Weder das Werk noch seine Teile dürfen ohne eine solche Einwilligung eingescannt und in ein Netzwerk eingestellt werden Dies gilt auch für Intranets von Schulen und sonstigen Bildungseinrichtungen Fotomechanische oder andere Wiedergabeverfahren nur mit Genehmigung des Verlages Ernst Klett Verlag GmbH, Stuttgart 215 Alle Rechte vorbehalten wwwklettde Redaktion: Rolf Strecker Mediengestaltung: Ingrid Walter A

3 Methoden Modelle unterstützen die Forschung (Seite 15) A1 Erläutern Sie anhand Abb 6 den Vorgang der Modellierung am Beispiel der DNA-Strukturaufklärung Die Daten der DNA wurden ausgewertet und führten zu Modellvorstellungen An diesem Beispiel zeigt sich, dass auch Fehlinterpretationen zu Modellen führen die korrigiert und verändert werden (Pauling) oder sich bestätigen Diese führte zu neuen Untersuchungen (Rosalind Franklin), deren Daten zu veränderten Modellen führen Die Planung neuer Experimente und weiterer Ergebnisse müssen das Modell bestätigen A2 Beschreiben Sie den Kurvenverlauf in Abb 7 und erläutern Sie die einzelnen Abschnitte 1 bis 4 unter dem Aspekt der Populationsgröße von Räubern und Beute an einem Beispiel Bei diesen Modelldaten sind die Individuenzahlen gegen die Zeit aufgetragen Die Kurvenverläufe der Beute- und Räuberindividuen verändert sich zeitlich verzögert Der Anstieg der Beutetiere führt mit einer zeitlichen Verzögerung zu einem Anstieg der Räuber (Phase 1 und 2) Der Kurvenverlauf der Beutetiere sinkt mit zunehmender Räuberanzahl (Phase 3) In Phase 4 sinkt dann die Anzahl der Räuber ebenfalls Dieser idealisierte Kurvenverlauf kann durch Simulationen entstehen In natürlichen Systemen sind zusätzlich andere Faktoren vorhanden, welche die Kurvenverläufe zusätzlich beeinflussen, sodass die Sinuskurve in ihrem Verlauf beeinträchtigt wäre A3 Beschreiben Sie die Daten in Abb 8 und erläutern Sie, welche Bedeutung solche Modellrechnungen für das Verständnis der Evolution haben In Abb 8 sind Modelldaten zur Fitness unter verschiedenen Modellvorgaben dargestellt Die Verteilung und Veränderung von Allelen innerhalb von Populationen spielt eine entscheidende Rolle bei der Fitness im Evolutionsprozess Die Simulationen zeigen jedoch, dass im Idealfall die Fitness bei beiden Voraussetzungen immer erreicht wird Hier können Grundüberlegungen Mechanismen erklären Diese müssen jedoch in der Realität genauer angepasst werden, das Modell muss überprüft werden 3 Methoden

4 1 Genetik 1 1 Nucleinsäuren DNA ein geniales Speichermedium (Seite 21) A1 Die DNA im Vergleich mit modernen Speichermedien: Ein Nucleotid auf einem DNA-Strang hat einen Informationsgehalt von 2 bit (=,25 byte), da es 2 2 = 4 Zustände (A, T, G bzw C) annehmen kann Berechnen Sie den Informationsgehalt der DNA einer menschlichen Zelle Vergleichen Sie mit modernen Speichermedien (DVD oder USB-Stick) Berücksichtigen Sie auch den Platzbedarf Ein Basenpaar der DNA hat einen Informationsgehalt von 2 bit =,25 Byte Die menschliche DNA enthält rund 6 Milliarden Basenpaare Damit ergeben sich,25 x 6 x 1 9 Byte = 1,5 Gigabyte Auf eine DVD passt mit 4,7 Gigabyte mehr als die dreifache Datenmenge, allerdings bei enormem Platzbedarf Auch wenn z B Speichermedien immer kleiner bei größerem Speichervolumen werden, ist der Platzbedarf eines Zellkerns noch nicht erreicht DNA-Replikation (Seite 22) A1 Erläutern Sie den Vorteil der hohen Anzahl an AT-Basenpaaren im Bereich eines Origins Zwischen aufeinander folgenden AT-Basenpaaren sind die Stapelkräfte der DNA verringert Zudem besteht eine AT-Basenpaarung jeweils aus nur zwei Wasserstoffbrückenbindungen Aufgrund der geringeren Anzahl an Wasserstoffbrücken und schwächeren Basenstapelkräften kann der DNA-Doppelstrang von der Helicase hier leichter geöffnet werden PCR DNA-Replikation im Reagenzglas (Seite 23) A1 Vergleichen Sie die Polymerasekettenreaktion mit der DNA-Replikation in einer eukaryotischen Zelle Die Auftrennung der DNA-Stränge erfolgt bei der PCR durch Temperaturerhöhung Bei der DNA-Replikation werden hierzu Enzyme verwendet (Helicase) Bei der PCR werden sowohl der Leit- als auch der Folgestrang kontinuierlich synthetisiert Bei der DNA-Replikation wird nur der Leitstrang kontinuierlich synthetisiert Die Synthese des Folgestrangs erfolgt in Okazaki- Fragmenten, die am Ende der Replikation zusammengefügt werden müssen Genau wie bei der DNA-Replikation sind zum Start der Synthese Primer erforderlich Im Gegensatz zur DNA-Replikation handelt es sich jedoch bei der PCR um DNA-Primer und nicht um RNA-Primer Folglich müssen diese auch am Ende nicht wieder herausgeschnitten werden Startpunkt und Endpunkt der Replikation werden durch spezifische Sequenzen auf der DNA festgelegt Bei der PCR wird der Beginn durch die Primer festgelegt und das Ende durch die Temperaturerhöhung herbeigeführt Für beide Prozesse wird eine DNA-Polymerase verwendet, die nur in 3 5 -Richtung arbeiten kann Im Gegensatz zu den DNA-Polymerasen aus Eukaryoten ist die bei der PCR verwendete DNA-Polymerase hitzestabil Bei der DNA-Replikation steht am Ende eine Verdopplung des gesamten Genoms einer Zelle eines Organismus Das Endprodukt der PCR sind viele Kopien einer relativ kurzen spezifischen DNA-Sequenz RNA mehr als nur eine weitere Nucleinsäure (Seite 24) A1 Recherchieren Sie ein Beispiel eines Ribozyms und beschreiben Sie seine Funktion Eines der ersten Ribozyme, die entdeckt wurden, ist die RNase P eine Ribonuclease Sie ist an der Bildung von t-rna-molekülen durch die Spaltung größerer t-rna-vorstufen beteiligt A2 Vergleichen Sie Ribozyme und Enzyme in ihrem Aufbau und ihrer Funktion Ribozyme sind aus RNA-Nucleotiden aufgebaut Durch Wechselwirkungen zwischen den Nucleotiden (z B komplementäre Basenpaarung durch H-Brücken) können sie eine komplexe dreidimensionale Struktur bilden (Sekundär-/ Tertiärstruktur) Enzyme sind aus Aminosäuren aufgebaut Auch sie können durch Wechselwirkungen zwischen den Seitenketten der Aminosäuren eine komplexe dreidimensionale Struktur bilden (Sekundär-/ Tertiärstruktur) Ribozyme und Enzyme haben dieselbe Grundfunktion: Sie binden spezifisch Substrate, katalysieren eine spezifische Reaktion mit diesem Substrat und entlassen ein Produkt (verändertes Substrat) Sie gehen aus dieser Reaktion unverbraucht hervor und können sie oft wiederholen 4 Genetik

5 Material: Nucleinsäuren (Seite 25) A1 Erläutern Sie die Schwierigkeiten bei der Entwicklung antiviraler Medikamente ohne Nebenwirkungen Nehmen Sie Stellung zu der Aussage Viren sind perfekte Tramper Viren bestehen meist nur aus Nucleinsäure und Proteinhülle Sie nutzen den Zellstoffwechsel und die enzymatische Maschinerie des Wirts Medikamente, die ihre Vermehrung stoppen oder verhindern sollen, können nur schlecht in den Stoffwechsel oder die Replikation eingreifen, da sie auch unbefallene Zellen des Wirtes schädigen würden Viruserkrankungen lassen sich derzeit am besten durch Impfungen potentieller Wirte bekämpfen Möglich könnte auch ein Angriff auf die spezifischen RNA-Polymerasen sein Tramper reisen mit leichtem Gepäck und unter Ausnutzung fremder Ressourcen über große Entfernungen Die Aussage trifft zu, da Viren fast nur die Information ihrer Nucleinsäure mit sich tragen und sich über die Ressourcen ihrer Wirte effektiv vermehren können A2 Nennen Sie die drei möglichen Hypothesen von Hershey und Chase Erläutern Sie die Schritte des Experiments Ergänzen Sie begründet die Schlussfolgerung 1 Die Viren-Proteine sind entscheidend für die Vermehrung, enthalten also die nötigen Informationen 2 Die Viren-DNA ist entscheidend für die Vermehrung, enthält also die nötigen Informationen 3 Sowohl DNA als auch Proteine sind entscheidend für die Vermehrung Beide enthalten also die nötigen Informationen Zunächst züchteten sie Bakteriophagen, die entweder eine radioaktiv markierte Proteinhülle (durch den Einbau von radioaktiven Schwefelatomen) oder eine radioaktiv markierte DNA (durch den Einbau von radioaktiven Phosphoratomen) besaßen Diese ließen sie Bakterien befallen Durch Mixen und anschließendes Zentrifugieren gelang es ihnen, Proteine und DNA voneinander zu trennen, ohne dass dabei die Bakterien beschädigt wurden Bei den Phagen mit markierter DNA fand sich die Radioaktivität am Boden des Probenröhrchens, bei denen mit markierten Proteinen im Überstand Abschließend entnahmen sie Proben aus dem jeweiligen Bodensatz und beobachteten, ob die Phagen sich vermehren konnten Da sich die Phagen in beiden Ansätzen erfolgreich vermehren konnten, obwohl die Proteine im Überstand abgetrennt wurden, zeigt, dass allein die DNA für die Vermehrung nötig ist Hershey und Chase lieferten damit eine unabhängige Bestätigung der Ergebnisse 1944 von Avery, dass die DNA die genetische Information enthält 5 Genetik

6 1 2 Proteinbiosynthese Die Entwicklung des Genbegriffs (Seite 26) A1 Geben Sie an, welches Gen bei den in Abb 1 dargestellten Neurospora-Mutanten jeweils defekt ist und erläutern Sie die Entwicklung des Genbegriffs Bei jeder Mangelmutante von Neurospora ist das Gen für ein bestimmtes Enzym defekt Stellt man der Mutante aber im Nährmedium den Stoff zur Verfügung, hat ihr Stoffwechsel wieder alle benötigten Substanzen, vor allem das lebenswichtige Tryptophan zur Verfügung: Die Zellen wachsen und vermehren sich wieder Im ersten Fall kann Neurospora nur wachsen, wenn ihr direkt Tryptophan zur Verfügung gestellt wird Die Vorstufen dafür nützen nichts Es kann also hier der letzte Aufbauschritt zum Tryptophan nicht vollzogen werden, Das Enzym für die Katalyse der Reaktion von Indol zu Tryptophan ist aufgrund der Veränderung in seinem Gen defekt Im zweiten Fall funktioniert dieser Schritt Diese Mutante wächst auch, wenn Indol (oder direkt das daraus gebildete Tryptophan) zur Verfügung steht Indol selbst aber kann hier nicht synthetisiert werden, das Enzym für die Reaktion von Anthranilsäure zu Indol ist defekt Entsprechend kann man von den anderen beiden Mutanten sagen, dass die dritte keine Antranilsäure, die vierte keine Chorrisminsäure synthetisieren kann Die Entwicklung des Genbegriffs hängt mit dem Erkenntnisgewinn über Proteinfunktion und Genexpression zusammen Garrod stellte zunächst die Hypothese auf, dass ein Gen die genetische Information für den Bau eines Enzyms trägt Dies bestätigten Beadle und Tatum in ihrem Experiment über Mangelmutanten Mit der Kenntnis darüber, dass nicht jedes Polypeptid ein Enzym darstellt, entwickelte man die Ein-Gen-ein-Polypeptid-Hypothese Mit den Erkenntnissen über die Genexpression (z B alternatives Spleißen; r-rna, si-rna etc) entwickelte man den heutigen Genbegriff: Ein Gen ist ein DNA-Abschnitt, der für eine RNA codiert Material: Genwirkketten (Seite 27) A1 Erläutern Sie das in der Abbildung dargestellte Versuchsergebnis Alle 6 Bakterienstämme wachsen auf dem Vollmedium und auf dem Minimalmedium, dem Arginin zugesetzt wurde Auf dem Minimalmedium mit Ornithinzusatz wachsen 2 Stämme und auf dem mit Citrullin 4 Bakterienstämme Das Versuchsergebnis lässt darauf schließen, dass Arginin von allen Bakterien benötigt wird Zwei Stämme wachsen weder auf Ornithin noch auf Arginin Für diese Stämme ist Arginin ein lebenswichtiger Zusatz, da sie diesen Stoff nicht selbst herstellen können Die beiden Stämme, die auf Ornithin wachsen, wachsen ebenfalls auf Citrullin, was darauf hinweist, dass sie Enzyme zur Weiterverarbeitung beider Stoffe besitzen 2 Stämme wachsen nur auf Citrullin, nicht aber auf Ornithin Ihnen fehlen die Enzyme zur Verarbeitung dieses Stoffes So lässt sich schließen, dass Ornithin und Citrullin Zwischenprodukte auf dem Syntheseweg des Arginin sind A2 Erklären Sie den Begriff Mangelmutante Unter Mangelmutanten versteht man Bakterien, die die Fähigkeit verloren haben, bestimmte biochemische Synthesen durchzuführen Dadurch können sie nur auf Nährmedien wachsen, denen die Stoffe zugesetzt wurden, die sie nicht mehr selbst herstellen können A3 Nennen Sie Möglichkeiten, im Labor Mangelmutanten eines Bakteriums zu erkennen Mangelmutanten lassen sich dadurch erkennen, dass sie auf Minimalnährmedien nicht wachsen können Durch Zugabe verschiedener Substanzen lässt sich erkennen, welcher Stoff von der Mangelmutante nicht mehr selbst hergestellt werden kann Gibt man Zwischenprodukte des Syntheseweges hinzu, kann man genau erkennen, welches Enzym auf dem Stoffwechselweg des Bakteriums durch die Mutation einen Defekt aufweist A4 Stellen Sie den Syntheseweg der Aminosäure Arginin in Form einer Genwirkkette dar Vorstufe Ornithin Citrullin Arginin Enzym 1 Enzym 2 Enzym 3 Gen 1 Gen 2 Gen 3 A5 Ordnen Sie die beschriebenen Krankheitsbilder Mutationen der Gene der Enzyme A, B, C bzw D zu Begründen Sie Mutation am Gen für Enzym A: Phenylketonurie; Anreicherung von Phenylalanin, Entstehung von Phenylketon, da kein Abbau zu Tyrosin möglich; Mutation am Gen für Enzym B: Albinismus; keine Bildung von Melanin möglich; Mutation am Gen für Enzym C: Alkaptonurie; Anreicherung von Homogentinsinsäure und Oxidation zum Alkapton, da kein Abbau zu CO 2 und H 2 O möglich; Mutation am Gen für Enzym D: Kretinismus; keine Bildung von Thyroxin möglich 6 Genetik

7 A6 Bei den oben beschriebenen Stoffwechselerkrankungen handelt es sich um genetisch bedingte Krankheiten, die durch eine rezessive Anlage verursacht werden Die Erkrankung tritt nur auf, wenn beide homologen Chromosomen den Defekt aufweisen Geben Sie dafür eine Erklärung Liegt eine rezessive Erkrankung vor, tragen beide homologen Chromosomen den Defekt, d h der Organismus kann das Enzym nicht mehr herstellen In diesem Fall tritt die Erkrankung auf Beim heterozygoten Genotyp kann das Enzym immer noch hergestellt werden A7 Neugeborene werden heute routinemäßig auf PKU untersucht Beschreiben Sie eine mögliche Therapie im Falle eines positiven Tests Bei positivem Ergebnis wird eine phenylalaninarme und thyrosinreiche Diät verabreicht, das Gehirn entwickelt sich dann normal A8 PKU-Kranke fallen häufig durch eine besonders helle Haut, helle Haarfarbe und helle Augen auf Begründen Sie diese Symptome anhand des Phenylalaninstoffwechsels PKU-Kranken fehlt das Enzym zur Synthese von Thyrosin aus Phenylalanin Dadurch entsteht bei PKU-Kranken ein Mangel an Thyrosin und allen daraus gebildeten Stoffen Zu ihnen gehört auch der Farbstoff Melanin, der für die Färbung der Haut, der Haare und der Iris des Auges verantwortlich ist Transkription der erste Schritt der Proteinbiosynthese (Seite 29) A1 Geben Sie die m-rna-sequenz an, in die der folgende DNA-Abschnitt transkribiert wird 3 TTGAGGCTAGATACCGAACCTTCT 5 Die m-rna lautet: 5 AACUCCGAUCUAUGGCUUGGAAGA 3 A2 Stellen Sie tabellarisch DNA-Replikation und Transkription gegenüber, indem Sie die biologische Bedeutung, den Zeitpunkt im Zellzyklus, die zugehörigen Vorlagen, die beteiligten Enzyme sowie die verwendeten Nucleotide auflisten biologische Bedeutung der DNA-Replikation: Kopieren von DNA vor der Zellteilung biologische Bedeutung der Transkription: Transport der genetischen Information vom Zellkern zu den Ribosomen Zeitpunkt im Zellzyklus bei der DNA-Replikation: vor der Zellteilung (Synthese-Phase) Zeitpunkt im Zellzyklus bei der Transkription: G 1 -Phase (Wachstumsphase) und G -Phase (Dauerphase) zugehörige Vorlagen bei der DNA-Replikation: beide DNA-Einzelstränge zugehörige Vorlagen bei der Transkription: codogener DNA-Strang verwendete Nucleotide bei der DNA-Replikation: A-, T-, C-, G-Nucleotide verwendete Nucleotide bei der Transkription: A-, U-, C-, G-Nucleotide Material: Die Erforschung der RNA (Seite 31) A1 Beschreiben Sie kurz das Experiment in Abb 1 und erläutern Sie die Bedeutung der kurzfristigen Gabe von radioaktiv markiertem Uracil Eukaryotischen Zellen wurde für einen kurzen Zeitraum radioaktiv markiertes Uracil angeboten (Tracerexperiment) Anschließend wurde untersucht, wo die Markierungen in der Zelle zu finden waren Die Bedeutung der kurzfristigen Gabe von markiertem Uracil liegt darin, dass eine Veränderung innerhalb der Zelle gemessen werden kann, ansonsten käme es zu einer Anhäufung, wodurch die räumliche Veränderung nicht mehr nachvollziehbar wäre A2 Erklären Sie anhand der in Abb 1 dargestellten Versuchsergebnisse die unterschiedliche Verteilung des Tracers in der Zelle und übertragen Sie diese Aussagen auf das Schema in Abb 3 Uracil ist ein Baustein der nur in der RNA vorkommt Hierdurch konnte man nachweisen, dass zuerst im Zellkern (Nucleus) viel Uracil zu finden ist, danach im Cytoplasma Dies bedeutet, dass RNA im Nucleus gebildet wird und anschließend ins Cytoplasma gelangt Das wäre ein Hinweis, dass die RNA die Informationen aus dem Nucleus ins Cytoplasma transportiert A3 Erläutern Sie mithilfe dieser Aussagen und der Informationen zur Entdeckungsgeschichte der RNA, welche Fragestellungen mit diesen Experimenten beantwortet werden konnten Die Vermutung, dass die Ribosomen immer spezifische Aufbauten der Proteine vorbestimmt haben, konnte widerlegt werden, da die Zusammensetzung der RNA ständig wechselte und relativ schnell Informationen aus dem Nucleus ins Cytoplasma gelangten Daher musste eine zusätzliche RNA vorhanden sein, welche die Verbindung zwischen DNA und Ribosomen darstellte Diese wurde messenger-rna genannt 7 Genetik

8 A4 Beschreiben Sie die Versuchsergebnisse in Abb 2 In Abb 2 sind die verschiedenen RNAs und deren Verteilung nach der Zentrifugation dargestellt Es wird sowohl die Gesamtmenge der RNA angegeben als auch die radioaktiv markierte Menge Man findet größere Mengen an Polysomen und einzelnen Ribosomen sowie t-rna Freie m-rna findet man nicht in großen Mengen Bei der Markierung liegt der Schwerpunkt bei den Polysomen und Ribosomen und der m-rna, nicht bei der t-rna A5 Erklären Sie die Messergebnisse in Verbindung mit der Versuchsdurchführung Aus diesem Messergebnis wird deutlich, dass die Information kurzfristig über die m-rna umgesetzt wird, da diese kurzfristig für die Steuerung der Proteinbiosynthese neu aufgebaut wird Die m-rna tritt mit den Ribosomen in Verbindung Durch das Pulsexperiment konnte der kurzfristige Vorgang deutlich werden, besonders von der freien zu gebundenen m-rna A6 Erläutern Sie anhand des Textes zur Entdeckungsgeschichte der m-rna, welcher Zusammenhang mit den Versuchen geklärt werden konnte Es wurde die Vermittlung der Information von der DNA zum Ort der Proteinbiosynthese, den Ribosomen, hierdurch erklärbar A7 Beschreiben Sie die Experimente mit Acetabulariazellen in Abb 6 Nehmen Sie hierzu auch die Informationen aus dem Text zur Hilfe In Abb 6 sind die Auftrennungsergebnisse von Proteinen verschiedener Acetabularia-Arten mithilfe der Gelelektrophorese dargestellt Es zeigen sich zwischen A mediterranea und A crenulata deutliche Unterschiede Nach dem Tausch der Rhizoide mit dem jeweiligen Nucleus zeigten sich die dementsprechenden Bandenmuster des dazugehörenden Nucleus A8 Erläutern Sie, welche Bedeutung diese Ergebnisse für die Hypothese zu den morphogenetischen Substanzen und der m-rna haben Da die Proteine dem jeweiligen Kern zugeordnet werden konnten, jedoch kurzfristig noch die alte Hutform gebildet wurde, mussten neben den Proteinen noch andere Substanzen vorhanden sein, die morphogenetischen Substanzen Es waren also nicht nur der Nucleus und die neuen Proteine entscheidend, sondern noch Substanzen des alten Nucleus Da die m-rna jedoch auch nicht bei den Proteinen nachzuweisen ist, könnte sie diese Funktion beinhalten Der genetische Code (Seite 32) A1 Übersetzen Sie die folgende m-rna in eine Aminosäuresequenz 5 UUAGAUGAGCGACGAACCCCUAAAAUUUACCUAGUAGUAGCCAU 3 Met-Ser-Asp-Glu-Pro-Leu-Lys-Phe-Thr-Stopp-Stopp-Stopp A2 Übertragen Sie diesen Abschnitt eines codogenen DNA-Strangs in die entsprechende Aminosäuresequenz 3 CTGGCTACTGACCCGCTTCTTCTATC 5 Die m-rna lautet: 5 GACCGAUGACUGGGCGAAGAAGAUAG3 Die Aminosäuresequenz lautet: Met-Thr-Gly-Arg-Arg-Arg-Stopp A3 Lassen Sie den ersten Buchstaben im Beispielsatz VORDERRNAISTDIEDNA weg und behalten den Triplettcode bei, wird der Sinn des Satzes entstellt Lassen Sie in der DNA-Sequenz aus Aufgabe 2 ebenfalls die erste Base weg Beschreiben Sie die Konsequenzen Die m-rna lautet: 5 ACCGAUGACUGGGCGAAGAAGAUAG3 Durch die Verschiebung des Leserasters entfällt das Start-Codon AUG, es gibt kein Genprodukt 8 Genetik

9 Material: Die Entdeckung des genetischen Codes (Seite 33) A1 Skizzieren Sie den Versuchsaufbau von Nirenberg und Lederer, mit dem der genetische Code entschlüsselt wurde s Skizze radioaktiv markiertes Phenylalanin unmarkierte Aminosäuren (alle außer Phenylalanin) t-rna- Moleküle m-rna-tripletts der Sequenz UUU Ribosomen Nur die mit Phenylalanin beladene t-rna bindet an die m-rna und das Ribosom Filtrieren Ribosomen und die gebundene Phenylalanin-t-RNA bleiben auf dem Filter zurück Die übrigen t-rnas gelangen ins Filtrat Untersuchen auf Radioaktivität Ist der Filter radioaktiv, codiert das Triplett UCU für Phenylalanin A2 Aus den Versuchsergebnissen lässt sich den Tripletts UUU und UCU eine Bedeutung zuordnen Nennen Sie diese UUU codiert für die Aminosäure Phenylalanin (Phe), UCU für die Aminosäure Serin (Ser) A3 Vor den Triplettbindungstests wurden alle m-rna-moleküle der Herkunftszellen entfernt Begründen Sie dieses Vorgehen Die radioaktiv markierten Aminosäuren wären ansonsten bei der Translation der m-rna-moleküle der Herkunftszelle in die Proteine eingebaut worden, die Radioaktivität hätte sich auf dem Filter wiedergefunden, die Bedeutung der m-rna-moleküle bekannter Sequenz hätte sich nicht aufklären lassen A4 Durch die Verwendung von Poly-U-, Poly-A-, Poly-C- und Poly-G-m-RNA-Sequenzen konnte weiteren Tripletts eine Bedeutung zugeordnet werden Nennen Sie die entsprechenden Tripletts und ihre Bedeutung Jede der vier eingesetzten m-rnas wird in Proteine aus immer gleichen Aminosäuren übersetzt Die vier auftretenden Tripletts codieren die folgenden Aminosäuren: UUU = Phenylalanin; AAA = Lysin; CCC = Prolin; GGG = Glycin A5 Verwendet man RNA, in der zwei Nucleotide abwechselnd vorkommen, erhält man Peptide, in denen sich zwei Aminosäuren abwechseln Erklären Sie dies Kann man durch diese Versuche die Bedeutung weiterer Tripletts eindeutig klären? Wechseln sich in einer m-rna zwei Nucleotide regelmäßig ab, ergeben sich je nach Translationsstart zwei verschiedene, sich abwechselnde Tripletts Bei Poly-AC sind folgende Triplettmuster möglich: ACA-CAC-ACA-CAC- oder CAC-ACA-CAC-ACA- Da sich mit Poly-AC ein Peptid ergibt, in dem sich Threonin und Histidin abwechseln, kann man folgern, dass eines der beiden Tripletts ACA oder CAC die Aminosäure Histidin codiert, das andere Threonin Eindeutig klären lässt sich die Bedeutung der Tripletts nicht A6 Verwendet man andere, regelmäßige Polynucleotide aus längeren Untereinheiten, erhält man im Gemisch verschiedene Peptide (s unten) Erläutern Sie, weshalb verschiedene Peptide gebildet werden Ordnen Sie weiteren Tripletts eine Bedeutung zu Je nach Start ergeben sich bei Poly-AAC drei verschiedene Triplettmuster: AAC-AAC-AAC-AAC-, ACA-ACA-ACA-ACA- oder CAA-CAA-CAA-CAA- Zunächst lässt sich nicht eindeutig folgern, welches der drei Tripletts AAC, ACA und CAA die Aminosäuren Asparagin, Threonin bzw Glutamin codiert Aus den Angaben zu Aufgabe 5 ist aber bekannt, dass das Triplett ACA die Aminosäuren Histidin oder Threonin codiert Da hier nur Threonin auftritt, muss ACA für Threonin stehen Daraus ergibt sich, dass CAC der Aminosäure Histidin entspricht (s Aufgabe 5) Welches der beiden Tripletts AAC und CAA die Aminosäuren Asparagin bzw Glutamin codiert, bleibt zunächst unklar Mit Poly-ACC ergeben sich die drei Triplettmuster: ACC-ACC-ACC-ACC-, CCA- CCA-CCA-CCA- oder CAC-CAC-CAC-CAC- Da CAC der Aminosäure Histidin entspricht, müssen die Tripletts ACC und CCA jeweils für eine der beiden Aminosäuren Threonin oder Prolin stehen 9 Genetik

10 A7 Es wurden ebenfalls Experimente mit vier regelmäßig wechselnden Nucleotiden durchgeführt (s unten) Analysieren Sie das Versuchsergebnis Mit Poly-ACCC ergeben sich folgende vier Triplettmuster: ACC-CAC-CCA-CCC-ACC-, CCC-ACC-CAC-CCA-CCC-, CCA-CCC-ACC-CAC-CCA- oder CAC-CCA-CCC-ACC-CAC- Die vier möglichen Tripletts treten stets in derselben Reihenfolge auf Daher wird ein Peptid gebildet, in dem sich eine Sequenz aus vier Aminosäuren wiederholt Da bekannt ist, dass das Triplett CCC für Prolin und das Triplett CAC für Histidin steht, müssen die Tripletts ACC und CCA jeweils eine der beiden Aminosäuren Threonin oder Prolin codieren Das Triplett CCA liegt zwischen den Tripletts CAC und CCC Zwischen Histidin und Prolin liegt im Peptid die Aminosäure Prolin Also steht das Triplett CCA ebenfalls für Prolin und ACC folglich für Threonin Translation ein Protein entsteht (Seite 36) A1 Das Codon AUG hat zwei verschiedene Bedeutungen, je nachdem ob es sich am Anfang einer m-rna befindet oder nicht Begründen Sie Als Startcodon markiert AUG auf einer m-rna den Beginn der Translation, fungiert also als Satzzeichen Methionin ist demgemäß die erste Aminosäure eines Proteins, die aber meist bei der Reifung von Proteinen wieder abgespalten wird Innerhalb eines Proteins codiert das Codon AUG lediglich für die Aminosäure Methionin A2 Ein Ausschnitt eines Peptids lautet: Ser Val Lys Met Ala Geben Sie eine mögliche Sequenz der m-rna und der codogenen DNA an Eine mögliche Lösung wäre: m-rna: 5 UCU GUG AAA AUG GCU 3 codogene DNA: 3 AGA CAC TTT TAC CGA 5 Vergleich der Proteinbiosynthese bei Pro- und Eukaryoten (Seite 39) A1 Erläutern Sie, weshalb die Proteinsynthese bei Eukaryoten mehr Zeit erfordert Bei eukaryotischen Zellen erfolgt die Transkription im Zellkern, die Translation im Zellplasma Der Ort der Transkription ist also, anders als bei den Prokaryoten, durch die Kernmembran vom Ort der Translation getrennt Die Translation kann demnach bei Eukaryoten erst beginnen, wenn die Transkription mit dem Spleißen beendet und die fertige m-rna durch die Kernporen in das Cytoplasma gelangt ist Modellvorstellungen zur Genregulation bei Prokaryoten (Seite 4) A1 Vergleichen Sie Substrat-Induktion und Endprodukt-Repression Bei gleichem Grundaufbau (Repressor, Effektor, Operon aus Promotor, Operator und Strukturgenen) zeigen Substrat-Induktion und Endprodukt-Repression genau gegenteilige Zustände: Während bei der Substrat-Induktion das Regulatorgen für einen aktiven Repressor codiert, der durch Bindung des Effektors inaktiviert wird, codiert bei der Endprodukt-Repression das Regulatorgen für einen inaktiven Repressor, der durch Bindung des Effektors erst aktiv wird Beide Male verhindert ein aktiver Repressor die Transkription der Strukturgene, ein inaktiver gibt sie frei Bei der Substrat-Induktion entstehen abbauende Enzyme, während bei der Endprodukt- Repression aufbauende Enzyme gebildet werden A2 Erläutern Sie die Aussage: Ein Effektor kann als Induktor oder als Co-Repressor wirken Je nachdem, ob der Effektor den Repressor inaktiviert oder aktiviert, sorgt er als Induktor für den Substratabbau (Substrat-Induktion) oder als Co-Repressor für den Baustopp des Endprodukts (Endprodukt-Repression) Material: Genregulation bei Prokaryoten (Seite 41) A1 Beschreiben Sie die Grafik Zugabe der radioaktiven Aminosäuren erfolgt zeitlich vor der Zugabe des Substrats Kurze Zeit nach der Zugabe des Substrats sind die ersten Moleküle radioaktiv markierter ß-Galactosidase festzustellen Ihre relative Menge nimmt dann linear zu A2 Mit dem gezeigten Ergebnis konnte die Hypothese widerlegt werden Erläutern Sie diese Schlussfolgerung Radioaktive ß-Galactosidase kann nur entstehen, indem neue Proteine mit den radioaktiven Bausteinen (AS) gebildet werden Der Zeitpunkt des Nachweises zeigt, dass der Proteinbau erst nach der Substratzugabe erfolgt 1 Genetik

11 A3 Zeichnen Sie das zu erwartende Ergebnis, wenn die Hypothese richtig gewesen wäre Wenn sich die Substrate mit bereits vorhandenen Vorläufer-Proteinen verbinden, um aktive Enzyme zu erhalten, findet kein Neubau der Proteine statt Es wäre keine radioaktive ß-Galactosidase nachweisbar A4 Erläutern Sie die zeitliche Verzögerung zwischen der Substratzugabe und dem ersten Auftreten radioaktiver b-galactosidase Nach der Substratzugabe wird etwas Zeit für die Vorgänge der Transkription und Translation benötigt, bevor die ersten fertigen Proteine nachweisbar sind A5 Beschreiben Sie die vier Zustände des lac-operons (Abb 2) und geben Sie für jeden Zustand an, ob Lactose und/oder Glucose vorhanden sind 1: Operon aus; kein Repressor gebunden; kein CAP-c-AMP-Komlex gebunden; Lactose und Glucose sind vorhanden 2: Operon aus; Repressor ist gebunden; kein CAP-c-AMP-Komlex gebunden; keine Lactose aber Glucose vorhanden 3: Operon aus; Repressor ist gebunden; CAP-c-AMP-Komlex ist gebunden weder Lactose noch Glucose vorhanden 4: Operon an (Transkription erfolgt); kein Repressor gebunden; CAP-c-AMP-Komlex ist gebunden; RNA-Polymerase ist gebunden und transkribiert die lac-gene Lactose ist vorhanden, Glucose nicht A6 Nehmen Sie begründet Stellung zu folgender Aussage: Die Konzentrationsbestimmungen von Lactose, Glucose, Glucose-Abbauprodukten, c-amp und CAP lieferten den Forschern wichtige Informationen bei der Entschlüsselung der doppelten Kontrolle des lac-operons Ich halte diese Aussage für richtig, da die Forscher durch die Konzentrationsmessungen sehen konnten, dass nicht alle Konzentrationen hoch sein mussten, sondern eine Kombination unterschiedlicher Konzentrationen nötig waren, damit die Transkription erfolgt A7 Erstellen Sie Hypothesen, auf welchem Weg Medikamente in die doppelte Kontrolle des lac- Operons eingreifen können Medikamente können an vielen verschiedenen Stellen eingreifen Sie können die Menge des Repressors oder des Aktivators verändern, ihre Bindungseigenschaften ändern sowie die Bindungsstellen besetzen Modellvorstellungen zur Genregulation bei Eukaryoten (Seite 43) A1 Fassen Sie die Möglichkeiten der Genregulation bei Eukaryoten auf den verschiedenen Ebenen (Transkriptionsebene, RNA-Prozessierungsebene, Translationsebene, Proteinaktivitätsebene) in Form einer Tabelle zusammen siehe Tabelle Regulations ebene Transkriptionsebene RNA-Prozessierungsebene Translationsebene Proteinaktivitätsebene Mechanismus Proteine (Transkriptionsfaktoren) binden an regulatorische DNA- Sequenzen und aktivieren oder hemmen die Transkription alternatives Spleißen der m-rna Abbau der m-rna durch spezielle Enzyme Aktivierung bzw Inaktivierung von Proteinen; Abbau von Proteinen Epigenetik Gene und Umwelt (Seite 45) A1 Beschreiben Sie die unterschiedlichen epigenetischen Modifikationen am Beispiel der Agouti-Maus Das Beispiel der Agouti-Maus zeigt, wie der Aktivitätszustand eines Gens durch Umwelteinflüsse (Ernährung) beeinflusst werden kann Beim inaktiven Agouti-Gen liegt durch Methylierung der DNA das Chromatin so stark komprimiert vor, dass die RNA-Polymerase blockiert wird und die Transkription unterbleibt Auch die freien Enden der Histone können methyliert werden und so weitere Proteine aktivieren, die dann das Anheften der Polymerase und anderer Transkriptionsfaktoren blockieren (Silencing) Um das Agouti-Gen zu aktivieren, muss die Methylierung rückgängig gemacht werden Eine geringere Packungsdichte des Chromatins und eine damit einhergehende Erhöhung der Transkriptionsrate wird dann zusätzlich durch die Acetylierung der Histone erreicht 11 Genetik

12 A2 Entwickeln Sie eine Hypothese hinsichtlich der Wirkung epigenetischer Medikamente zur Krebstherapie Die Medikamente müssten die epigenetischen Modifikationen beeinflussen können Damit könnten z B Tumorsuppressorgene aktiviert werden Dies betrifft laut Abb 4 insbesondere die Demethylierung und Acetylierung der DNA, wodurch die Wechselwirkung der Histone mit der DNA verändert wird Die lockerere Wicklung sorgt dann für eine höhere Transkritionsrate bei den Tumorsuppressorgenen Entsprechend könnten auch Gene, die durch epigenetische Veränderungen die Kontrolle über das Zellwachstum verloren haben, durch Einsatz von Methyltransferasen, gezielt stillgelegt werden Material: Epigenetik (Seite 46) A1 Vergleichen Sie die Veränderungen durch epigenetische Abweichung in Abb 1 und ordnen Sie die Methylierungsmuster begründet dreijährigen bzw fünfzigjährigen eineiigen Zwillingen zu Im Vergleich der Methylierungsmuster der eineiigen Zwillinge zeigen sich auffällige Unterschiede Bei dem Chromosomenpaar mit der starken Gelbfärbung sind die Methylierungsmuster recht ähnlich Das Maß an Hypo- bzw Hypermethylierung ist annähernd identisch, d h dass eine Expression gleicher Gene erfolgt Dieses Muster kann man also dem dreijährigen Zwillingspaar zuordnen In dem anderen Chromosomenpaar überwiegen in jeweils anderen Bereichen der Chromosomen die roten und grünen Signale Hier liegen demzufolge mehr oder weniger ausgeprägte Methylierungen vor und so ergeben sich jeweils andere Muster Da die Methylierung die Transkription der Gene steuert und so deren Genexpression verändert, belegen verschiedenfarbige Bereiche der angefärbten Chromosomen eine unterschiedliche Genexpression Dieses Chromosomenpaar lässt sich deshalb den fünfzigjährigen eineiigen Zwillingen zuordnen, bei denen sich aufgrund des Alters über einen langen Zeitraum verschiedene Methylierungsmuster entwickeln A2 Formulieren Sie eine Hypothese über die Ursachen der epigenetischen Abweichungen bei eineiigen Zwillingen Obwohl sie identische Gene besitzen, unterscheiden sich ältere eineiige Zwillinge manchmal recht stark voneinander Es ist zu vermuten, dass einige Abschnitte der Erbsubstanz bei einem Zwilling aktiv und beim anderen inaktiv sind bzw bestimmte Gene an- oder abgschaltet sind Die Ursache dafür sind epigenetische Veränderungen am Erbgut, die im Laufe des Lebens entstehen und sich ausprägen So können psychische und physische Krankheiten, Ernährungsgewohnheiten, das Maß an körperlicher Aktivität, Stress und Rauchen zu unterschiedlichen epigenetischen Mustern und damit zu unterschiedlichen phänotypischen Merkmalen führen A3 Beschreiben Sie den Einfluss des Gelée Royal auf die Entwicklung in einem Bienenstaat Das fett- und eiweißreiche Gelée Royal hat einen direkten Einfluss auf die Entwicklung der Bienen und die Arbeitsteilung in einem Staat Arbeiterbienen und die eierlegende Königin haben zwar denselben Genotyp, die phänotypische Ausprägung ist jedoch unterschiedlich Werden Larven mit Gelée Royal gefüttert, so wachsen sie zu Königinnen heran, während die mit Pollen und Honig gefütterten Bienenlarven zu Arbeiterinnen werden A4 Erläutern Sie anhand der Abb 5 die Wirkung von Methyltransferase-Hemmer auf die Larven Methyltransferase-Hemmer blockieren gezielt die Enzyme (Methyltransferasen), die für Methylierungen der DNA verantwortlich sind Abb 5 zeigt, dass bei der Kontrolle der prozentuale Anteil der Methylierung in der DNA der Bienenlarven hoch ist (8 %) Diese Larven entwickeln sich dann zu Arbeiterinnen, während es deutlich weniger Bienen gibt, deren DNA einen geringeren Grad an Methylierung aufweist und die damit bezogen auf diesen Parameter königinnenähnlich sind Unter dem Einfluss eines Methyltransferase-Hemmers sind die Verhältnisse anders Das Enzym verhindert eine Übertragung von Methylgruppen, sodass nur etwa 25 % der Larven zu Arbeiterinnen werden Dagegen steigt der Anteil an Königinnen stark an Die Methyltransferasen sorgen demnach für ein gänzlich anderes Methylierungsmuster bei den Larven und steuern damit die Entwicklung von Königinnen A5 Stellen Sie eine begründete Hypothese auf über die Zusammensetzung des Gelée Royal hinsichtlich seiner epigenetischen Wirkung Die Ernährung von Bienenlarven mit Gelée Royal ist für die Entwicklung der Bienenkönigin ausschlaggebend und man kann diese Entwicklung auch durch den Einsatz von Methyltransferase- Hemmern auslösen So liegt die Vermutung nahe, dass sich im Gelée Royal auch Methyltransferase-Hemmer befinden, deren Aktivität ein zur DNA der Arbeiterinnen unterschiedliches Methylierungsmuster der Königinnen-DNA bewirkt 12 Genetik

13 A6 Ermitteln Sie, welche Folgen eine hohe Pheromonkonzentration für das Sammelverhalten der Bienen hat Pheromone, die von den älteren Sammelbienen abgegeben werden, signalisieren den Arbeiterbienen, dass genügend Sammelbienen im Stock vorhanden sind und keine jüngeren Bienen zu Sammlerinnen rekrutiert werden müssen Material: Genomische Prägung (Seite 47) A1 Beschreiben Sie die genauen Vorgänge bei der Inaktivierung des X-Chromosoms und stellen Sie die Kondensation des X-Chromosoms grafisch dar Die starke Kondensierung des X-Chromosoms geht von einem bestimmten DNA-Bereich nahe des Centromers aus, der sogenannten XIC-Region Die dort lokalisierten Gene tragen die genetische Information für die XIST-RNA Diese RNA-Moleküle binden flächendeckend am gesamten Chromosom und legen dieses still Außerdem bewirkt die XIST-RNA eine Methylierung der DNA sowie eine Abspaltung der Acetylgruppen von den Histonen XIST-RNA zunehmende Kondensation des Chromatids aktives X-Chromosom inaktives X-Chromosom A2 Erläutern Sie die Weitergabe von Methylierungsmustern an Tochterzellen und erörtern Sie den Begriff Zellgedächtnis am Beispiel der Schildpattkatze Während dem Wachstum und der Entwicklung von Organismen finden besonders viele Zellteilungen statt Die damit zusammenhängenden Replikationen der DNA erfordern eine Dekondensation des X-Chromosoms der Schildpatt-Katze Allerdings bleibt die Information darüber, welches X-Chromosom nach der Replikation wieder inaktiviert werden soll, über alle nachfolgenden Generationen erhalten Dies bezeichnet man als Zellgedächtnis Die Methylierungsmuster der DNA gehen also während der Replikation nicht verloren Nach dem Grundsatz der semikonservativen Replikation besteht die DNA der Tochterzellen aus einem methylierten Einzelstrang und einem Strang, der an den entsprechenden Stellen (vorwiegend an der Base Cytosin) keine Methylgruppen trägt Bestimmte Enzyme, die sogenannten Erhaltungsmethylasen, erkennen das Muster und ergänzen an den jeweiligen Stellen die Methylgruppe Da die Gene für die Fellfarbe bei Schildpatt-Katzen auf dem X-Chromosom lokalisiert sind und in den Zellen jeweils nur ein X-Chromosom (aber nicht stets dasselbe) aktiv ist, kommt es zu einer zufälligen Expression der Gene für die Fellfarbe je nach dem, von welchem Elternteil das jeweils aktive X-Chromosom stammt A3 Begründen Sie, inwiefern die Inaktivierung eines X-Chromosoms bei Säugetieren ein extremes Beispiel für epigenetische Vererbung darstellt Epigenetische Veränderungen durch Methylierung oder Acetylierung betreffen in der Regel bestimmte DNA-Abschnitte und beeinflussen damit die Expression einzelner dort lokalisierter Gene Bei der Inaktivierung eines X-Chromosoms ist jedoch ein ganzes Chromosom betroffen, da durch Methylierung und Histondeacetylierung alle Gene eines Chromosoms ausgeschaltet werden RNA-Interferenz und Gen-Silencing (Seite 49) A1 Vergleichen Sie mi-rna mit si-rna Beide sind doppelsträngige RNA-Moleküle mit einer Länge von ca 2 bis 25 Nucleotiden und beide erhalten ihre Länge durch Schneiden mit Dicer mi-rna wird als prä-mi-rna durch Transkription zelleigener DNA gebildet, paart sich komplementär, wird geschnitten und richtet sich gegen zelleigene Gene si-rna entsteht durch Schneiden langer, doppelsträngiger RNA, die zellfremd ist (z B viral) Richtet sich gegen zellfremde Gene 13 Genetik

14 A2 Erläutern Sie die Unterschiede zwischen der Regulation durch RISC und der durch Transkriptionsfaktoren Regulation durch RISC = posttraskriptional, d h Transkription ist gelaufen, m-rna vorhanden; wird gesucht und zerstört (nur Hemmung möglich) Regulation durch Transkriptionsfaktoren = transkriptional, d h Regulation erfolgt früher bereits auf der Ebene der Transkription; Enhancer beschleunigen die Transkription, Silencer hemmen sie (beides möglich) Mutationen (Seite 51) A1 Begründen Sie, warum nicht alle Mutationen zum Nachteil des Trägers sein müssen Zum einen führen nicht alle Mutationen zu einer Veränderung in der Struktur der Proteine, da z B eine Basensubstitution aufgrund der Redundanz des genetischen Codes keine Auswirkungen auf die Aminosäuresequenz haben muss (stumme Mutation) Zum anderen sind Mutationen notwendig, um ein gewisses Maß an Variation der Erbsubstanz zu ermöglichen, denn Variationen der Gene können einer Spezies Überlebensvorteile verschaffen A2 Beschreiben Sie die Ursachen und Folgen der Sichelzellanämie Bei der Sichelzellanämie liegt aufgrund einer Missense-Mutation (Substitution einer Base) und demzufolge dem Austausch einer Aminosäure in der Peptidkette des ß-Globins ein verändertes Hämoglobin vor (HbS) Das Sichelzell-Hämoglobin bildet unter Sauerstoffmangel und nach Sauerstoffabgabe sogenannte Aggregate Die Erythrocyten nehmen dann eine sichelartige Form an, verklumpen in den Blutgefäßen und können so zu Verschlüssen/ Infarkten führen A3 Eine DNA-Sequenz im codogenen Strang sei gegeben: CGAAATAAGCTGTTC Fügen Sie willkürlich jeweils zwei verschiedene Punktmutationen sowie eine Insertion und eine Deletion ein und erläutern Sie die Auswirkungen auf die Aminosäuresequenz Nehmen Sie dabei die Codesonne zu Hilfe z B: codogener Strang ohne Mutation CGAAATAAGCTGTCC m-rna GCUUUAUUCGACAGG AS-Sequenz Ala Leu Phe Asp Arg Basenaustausch CGATATAAGCTGTCC m-rna GCUAUAUUCGACAGG AS-Sequenz Ala Ile Phe Asp Arg weitere individuelle Lösungen A4 Erläutern Sie die Ursachen für die veränderte Aminosäuresequenz bei der b-globin-kette (Abb 4) Nach dem 7 Basentriplett in der abgebildeten Basensequenz kommt es zu einer zweifachen Deletion es fehlen im 8 Triplett zwei Thyminbasen Es kommt zu einer Verschiebung des Leserasters ab der Frameshift-Mutation und somit zur Veränderung der Aminosäuresequenz Material: Mondscheinkinder und schädliche UV-Strahlung (Seite 52/53) A1 Erläutern Sie, welche Maßnahmen zum Lichtschutz bei einem XP-Patienten noch sinnvoll sein könnten Tragen von langer Kleidung, die die sonnenexponierten Hautregionen komplett abdeckt und Tragen einer Sonnenbrille getönte Fensterscheiben oder UV-abweisende Schutzfolie an Fenstern von Haus und Auto Sonnencremes mit sehr hohem Lichtschutzfaktor (LSF 6) A2 Vergleichen Sie die Wahrscheinlichkeit, an Hautkrebs zu erkranken, bei XP-Patienten und Menschen ohne dieses Krankheitsbild (Abb 2) Die Untersuchungsergebnisse zeigen eine signifikante (fast exponentielle) Zunahme der Hautkrebswahrscheinlichkeit erst ab einem Alter von etwa 4 bis 5 Jahren bei Menschen ohne XP Die Ursache für Hautkrebs sind Mutationen, die vom Reparatursystem nicht behoben werden Im Allgemeinen ist mehr als eine Mutation nötig, um alle Veränderungen herbeizuführen, die eine Krebszelle charakterisieren Je älter man wird, desto mehr Mutationen häufen sich an und desto höher wird die Wahrscheinlichkeit für Hautkrebs Bei XP-Patienten ist dieses Risiko bereits von Geburt an sehr hoch, da UV-Licht-induzierte DNA- Schäden nicht repariert werden können Ab einem Alter von 2 Jahren bleibt das Risiko nahezu gleich bei 1 %, da die irreversiblen Schäden in den Hautzellen sich kontinuierlich anhäufen 14 Genetik

15 A3 Formulieren Sie eine Hypothese über die Auswirkungen der Dimerbildung auf die DNA-Replikation Thymin-Dimere führen zu einer Verformung der DNA, sodass die DNA-Polymerase die DNA an dieser Stelle nicht mehr passieren kann Die Replikation der DNA setzt daher aus und der gebildete Tochterstrang enthält entsprechend weniger Basen als der Mutterstrang A4 Nennen Sie das dem Reparatursystem der DNA zugrunde liegende Prinzip Spezielle Enzyme erkennen Schäden in der DNA und können die schadhaften Stellen herausschneiden Die Lücken werden nach dem Prinzip der komplementären Basenpaarung dann mit den entsprechenden Basen wieder aufgefüllt Eine andere Möglichkeit ist die Spaltung der Thymin-Dimere in Einzelbausteine, die wieder zur komplementären Basenpaarung fähig sind A5 Erläutern Sie die Bedeutung von Reparaturmechanismen für den Organismus im Allgemeinen und die Excisionsreparatur im Besonderen DNA-Reparaturmechanismen sind enzymatisch gesteuerte Prozesse, die Schäden der DNA beseitigen und dadurch den reibungslosen Ablauf der Replikation und Transkription gewährleis ten Sie sind dafür verantwortlich, dass sich Mutationen im Erbgut nicht anhäufen können Die Exzisionsreparatur erfolgt in Fällen, in denen falsche Basen eingebaut werden Die modifizierten Basen müssen entfernt und anschließend ersetzt werden Diese Stellen werden von speziellen Endonucleasen erkannt und zusammen mit benachbarten Nucleotiden herausgeschnitten, sodass eine ca 1 Basen lange Lücke entsteht, die durch die DNA-Polymerase I aufgefüllt und von der DNA-Ligase wieder geschlossen wird Der nicht betroffene Strang dient dabei als Matrize A6 Beschreiben und erklären Sie die in Abb 7 dargestellten Versuchsergebnisse Die Versuche zeigen die Überlebensfähigkeit von E coli-zellen (Anteil lebender Zellen nach UV-Bestrahlung) in Abhängigkeit von der Strahlendosis Dabei erwies sich, dass der Wildtyp Bestrahlungen überlebt und der Anteil an lebenden Zellen erst ab einer vergleichsweise hohen Dosis sinkt Die UV-sensiblen Mutanten (uvr- und RecA-Mutante) dagegen reagieren äußerst empfindlich; der Anteil an lebenden Zellen geht bereits bei niedrigen Strahlendosen stark zurück, wobei die Entwicklung bei der RecA-Mutante noch deutlicher ist Uvr und RecA sind Reparatursysteme, die UV-induzierte Fehler in der Basensequenz der DNA erkennen und reparieren Bei den UV-sensiblen uvr-mutanten kam es vermutlich zu einer Mutation in den uvr- Genen kommen, die für verschiedene Untereinheiten einer Endonuclease codieren Diese kann daraufhin ihre Funktion, die DNA auf Fehler und Schäden zu kontrollieren, nicht mehr ausüben Die sich dadurch anhäufenden Schäden führen zu einem Absterben der Zellen Beim Wildtyp dagegen greifen die Reparatursysteme und so können die Zellen eine relativ hohe Strahlendosis tolerieren A7 Erläutern Sie die Aussage: Die Haut vergisst nichts Die Haut vergisst nichts, schon gar nicht einen Sonnenbrand Oberflächlich betrachtet sieht es zwar aus, als hätte sich die Haut nach einem ausgeheilten Sonnenbrand erholt Aber tief im Innern der Zellen der Ober- und Lederhaut zeigt sich, dass der Schaden, den die UV-Strahlung in der DNA angerichtet hat, unwiderruflich ist Wiederholen sich die Sonnenbrände und die Wirkung lang anhaltender und intensiver Sonnenstrahlung häufiger, kumulieren und festigen sich die Schäden in den Hautzellen, da das zelleigene Reparatursystem nicht alle Schäden beheben kann Die Folge ist im besten Fall vorzeitige Hautalterung im schlimmsten Fall jedoch Hautkrebs A8 Beschreiben Sie die Entwicklung der Krebsneuerkrankungen (Abb 9) und stellen Sie Hypothesen über mögliche Ursachen auf Die Zahl der Neuerkrankungen beim Schwarzen Hautkrebs ist in Deutschland im dem angegebenen Zeitraum von 23 bis 21 signifikant gestiegen (bei Frauen um ca 2, bei Männern in etwa um 3 Fälle) Bis 27 gab es bei Frauen deutlich mehr neue Fälle von Hautkrebs, seit 28 überwiegt jedoch deren Anteil bei den Männern Die Zunahme an Neuerkrankungen ist dabei unabhängig vom Geschlecht seit 27 besonders gravierend Als mögliche Ursachen für den starken Anstieg sind folgendes Aspekte denkbar: starke und häufige Sonnenbrände in der Kindheit und Jugend mangelnde Sorgfalt beim Sonnenschutz häufiger und regelmäßiger Besuch von Sonnenbänken und Solarien, vor allem wenn die zulässigen Grenzwerte für die UV-Strahlung überschritten werden Alterung der Gesellschaft (viele Fälle von Schwarzem Hautkrebs treten erst im Alter auf) kontinuierliche Belastung durch UV-Strahlung in Berufsgruppen mit nahezu ausschließlicher Außentätigkeit (zb Landwirtschaft, Seefahrt, Fischerei, Straßenbau) verändertes Freizeitverhalten/ größere Mobilität: Urlaube werden ganzjährig in sonnenintensiven Regionen verbracht 15 Genetik

16 A9 Begründen Sie, warum das Maligne Melanom häufig tödlich verläuft Ein Malignes Melanom der Haut, auch Schwarzer Hautkrebs genannt, ist ein bösartiger (maligner) Tumor, der aus Pigmentzellen der Haut entsteht Diese Zellen entarten und wuchern unkontrolliert Das Maligne Melanom ist eine der gefährlichsten Krebsarten überhaupt, da es trotz einer relativ geringen Größe bereits frühzeitig Tochtergeschwülste (Metastasen) in Lymphknoten sowie anderen Organen bilden kann Proteom und Proteomforschung (Seite 54/55) A1 Beschreiben Sie die verschiedenen Möglichkeiten der Veränderung des Proteoms im Laufe der Entwicklung eines Organismus Neben unterschiedlichen Aktivitätsmustern von Genen durch Aktivierung oder Stilllegung in Form von Methylierungen oder Acetylierungen (oder Demethylierungen bzw Deacetylierungen), kommt es zu Veränderungen der m-rna durch alternatives Spleißen und zu Veränderungen der Polypeptide nach der Translation Dabei können sich bestimmte Modifikationen in der Tertiärstruktur und komplexe chemische Bearbeitungen vollziehen, z B Bildung von Glykoproteinen (Ausbildung von Signalstrukturen) oder Phosphorylierungen bzw die Bindung an größere Moleküle A2 Beschreiben Sie die genauen Arbeitsabläufe bei der Proteomanalyse Zunächst werden aus Patientenproben, wie Gewebe oder Blut, Proteine extrahiert und das Proteingemisch mit einer 2D-Gelelektrophorese aufgetrennt In einem speziellen Kunststoffgel erfolgt die Auftrennung nach Lage und Größe (in zwei Richtungen) Es entsteht eine Proteomkarte, ein Muster von Flecken, das sowohl Art als auch Menge der vorhandenen Proteine wiedergibt Ein Fleck wird dann aus dem Gel herausgeschnitten und durch Proteasen zerschnitten, sodass unterschiedliche große Proteinbruchstücke entstehen, die für das jeweilige Protein spezifisch sind Mithilfe der Massenspektrometrie lässt sich das Gewicht der einzelnen im Gemisch der Probe enthaltenen Proteine feststellen und jedes Protein eindeutig identifizieren A3 Auch schon seit langem bekannte genetische Erkrankungen, wie z B das Down-Syndrom, sind Gegenstand der Proteomforschung Stellen Sie eine begründete Hypothese darüber auf, wie sich die Trisomie 21 auf das Proteom der Betroffenen auswirken könnte Da bei der Trisomie 21 das Chromosom 21 dreimal vorhanden ist, sollten auch die Proteine, die durch die Gene auf diesem Chromosom codiert werden, vermehrt auftreten Welche Proteine das sind und in welchen Zellen sie exprimiert werden, könnte Rückschlüsse auf das konkrete Krankheitsbild und den Grad der Down-Syndrom-Erkrankung geben 16 Genetik

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon


Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition


IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während


Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht


Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.


6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen


RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase


Übung 8. 1. Zellkommunikation. Vorlesung Bio-Engineering Sommersemester 2008. Kapitel 4. 4

Übung 8. 1. Zellkommunikation. Vorlesung Bio-Engineering Sommersemester 2008. Kapitel 4. 4 Bitte schreiben Sie Ihre Antworten direkt auf das Übungsblatt. Falls Sie mehr Platz brauchen verweisen Sie auf Zusatzblätter. Vergessen Sie Ihren Namen nicht! Abgabe der Übung bis spätestens 05. 05. 08


Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden.

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden. 03 Arbeitsauftrag Arbeitsauftrag Ziel: Anhand des Foliensatzes soll die Bildung und der Aufbau des Proteinhormons Insulin erklärt werden. Danach soll kurz erklärt werden, wie man künstlich Insulin herstellt.


Diese Broschüre fasst die wichtigsten Informationen zusammen, damit Sie einen Entscheid treffen können.

Diese Broschüre fasst die wichtigsten Informationen zusammen, damit Sie einen Entscheid treffen können. Aufklärung über die Weiterverwendung/Nutzung von biologischem Material und/oder gesundheitsbezogen Daten für die biomedizinische Forschung. (Version V-2.0 vom 16.07.2014, Biobanken) Sehr geehrte Patientin,


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können


Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn


8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria


Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem


Aufgabe 2: (Aminosäuren)

Aufgabe 2: (Aminosäuren) Aufgabe 2: (Aminosäuren) Aufgabenstellung Die 20 Aminosäuren (voller Name, 1- und 3-Buchstaben-Code) sollen identifiziert und mit RasMol grafisch dargestellt werden. Dann sollen die AS sinnvoll nach ihren


Pädagogik. Melanie Schewtschenko. Eingewöhnung und Übergang in die Kinderkrippe. Warum ist die Beteiligung der Eltern so wichtig?

Pädagogik. Melanie Schewtschenko. Eingewöhnung und Übergang in die Kinderkrippe. Warum ist die Beteiligung der Eltern so wichtig? Pädagogik Melanie Schewtschenko Eingewöhnung und Übergang in die Kinderkrippe Warum ist die Beteiligung der Eltern so wichtig? Studienarbeit Inhaltsverzeichnis 1. Einleitung.2 2. Warum ist Eingewöhnung


AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1 Variabilität von Antikörpern 1 Rezeptoren bzw. Antikörper eines noch undifferenzierten B-Lymphocyten: a) Schreiben Sie die Anzahl der variablen Exons je Chromosom auf. b) Berechnen Sie die mögliche Anzahl


Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat


Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid


Lineargleichungssysteme: Additions-/ Subtraktionsverfahren

Lineargleichungssysteme: Additions-/ Subtraktionsverfahren Lineargleichungssysteme: Additions-/ Subtraktionsverfahren W. Kippels 22. Februar 2014 Inhaltsverzeichnis 1 Einleitung 2 2 Lineargleichungssysteme zweiten Grades 2 3 Lineargleichungssysteme höheren als


Modellbildungssysteme: Pädagogische und didaktische Ziele

Modellbildungssysteme: Pädagogische und didaktische Ziele Modellbildungssysteme: Pädagogische und didaktische Ziele Was hat Modellbildung mit der Schule zu tun? Der Bildungsplan 1994 formuliert: "Die schnelle Zunahme des Wissens, die hohe Differenzierung und


OECD Programme for International Student Assessment PISA 2000. Lösungen der Beispielaufgaben aus dem Mathematiktest. Deutschland

OECD Programme for International Student Assessment PISA 2000. Lösungen der Beispielaufgaben aus dem Mathematiktest. Deutschland OECD Programme for International Student Assessment Deutschland PISA 2000 Lösungen der Beispielaufgaben aus dem Mathematiktest Beispielaufgaben PISA-Hauptstudie 2000 Seite 3 UNIT ÄPFEL Beispielaufgaben


PCD Europe, Krefeld, Jan 2007. Auswertung von Haemoccult

PCD Europe, Krefeld, Jan 2007. Auswertung von Haemoccult Auswertung von Haemoccult Ist das positiv? Nein! Ja! Im deutschen Krebsfrüherkennungsprogramm haben nur etwa 1 % der Frauen und 1,5 % der Männer ein positives Haemoccult -Ergebnis, da dieser Test eine


Eigene Dokumente, Fotos, Bilder etc. sichern

Eigene Dokumente, Fotos, Bilder etc. sichern Eigene Dokumente, Fotos, Bilder etc. sichern Solange alles am PC rund läuft, macht man sich keine Gedanken darüber, dass bei einem Computer auch mal ein technischer Defekt auftreten könnte. Aber Grundsätzliches


Primzahlen und RSA-Verschlüsselung

Primzahlen und RSA-Verschlüsselung Primzahlen und RSA-Verschlüsselung Michael Fütterer und Jonathan Zachhuber 1 Einiges zu Primzahlen Ein paar Definitionen: Wir bezeichnen mit Z die Menge der positiven und negativen ganzen Zahlen, also


AGROPLUS Buchhaltung. Daten-Server und Sicherheitskopie. Version vom 21.10.2013b

AGROPLUS Buchhaltung. Daten-Server und Sicherheitskopie. Version vom 21.10.2013b AGROPLUS Buchhaltung Daten-Server und Sicherheitskopie Version vom 21.10.2013b 3a) Der Daten-Server Modus und der Tresor Der Daten-Server ist eine Betriebsart welche dem Nutzer eine grosse Flexibilität


in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010

in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010 Seite 1/5 in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010 Expertengespräch zum Thema Retinoblastom Und zu diesem Thema begrüße ich jetzt Professor Norbert Bornfeld, Direktor des Zentrums


Chemotherapie -ein Bilderbuch für Kinder

Chemotherapie -ein Bilderbuch für Kinder Chemotherapie -ein Bilderbuch für Kinder Unser Körper besteht aus verschiedenen Zellen, die ganz unterschiedlich aussehen. Jede Art erfüllt eine besondere Aufgabe. Da gibt es zum Beispiel Gehirnzellen,


Zwischenablage (Bilder, Texte,...)

Zwischenablage (Bilder, Texte,...) Zwischenablage was ist das? Informationen über. die Bedeutung der Windows-Zwischenablage Kopieren und Einfügen mit der Zwischenablage Vermeiden von Fehlern beim Arbeiten mit der Zwischenablage Bei diesen


Würfelt man dabei je genau 10 - mal eine 1, 2, 3, 4, 5 und 6, so beträgt die Anzahl. der verschiedenen Reihenfolgen, in denen man dies tun kann, 60!.

Würfelt man dabei je genau 10 - mal eine 1, 2, 3, 4, 5 und 6, so beträgt die Anzahl. der verschiedenen Reihenfolgen, in denen man dies tun kann, 60!. 040304 Übung 9a Analysis, Abschnitt 4, Folie 8 Die Wahrscheinlichkeit, dass bei n - maliger Durchführung eines Zufallexperiments ein Ereignis A ( mit Wahrscheinlichkeit p p ( A ) ) für eine beliebige Anzahl


Daten sammeln, darstellen, auswerten

Daten sammeln, darstellen, auswerten Vertiefen 1 Daten sammeln, darstellen, auswerten zu Aufgabe 1 Schulbuch, Seite 22 1 Haustiere zählen In der Tabelle rechts stehen die Haustiere der Kinder aus der Klasse 5b. a) Wie oft wurden die Haustiere


Zahlen auf einen Blick

Zahlen auf einen Blick Zahlen auf einen Blick Nicht ohne Grund heißt es: Ein Bild sagt mehr als 1000 Worte. Die meisten Menschen nehmen Informationen schneller auf und behalten diese eher, wenn sie als Schaubild dargeboten werden.


Mobile Intranet in Unternehmen

Mobile Intranet in Unternehmen Mobile Intranet in Unternehmen Ergebnisse einer Umfrage unter Intranet Verantwortlichen aexea GmbH - communication. content. consulting Augustenstraße 15 70178 Stuttgart Tel: 0711 87035490 Mobile Intranet


In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)


Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen


Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese

Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese Station 1 Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese 1 I. Vorinformationen An der GSI wurde eine weltweit neuartige Krebstherapie mit Ionenstrahlen entwickelt. Dazu werden in


Der Morbus Basedow. Warum Panik bei der Basedow- Diagnose?

Der Morbus Basedow. Warum Panik bei der Basedow- Diagnose? Der Morbus Basedow Es hängt mit einer alten Erinnerung zusammen, dass wir den»basedow«, wie wir ihn in diesem Buch kurz nennen wollen, so ernst nehmen und bei seiner Diagnose sofort in Panik Warum Panik


Berechnung der Erhöhung der Durchschnittsprämien

Berechnung der Erhöhung der Durchschnittsprämien Wolfram Fischer Berechnung der Erhöhung der Durchschnittsprämien Oktober 2004 1 Zusammenfassung Zur Berechnung der Durchschnittsprämien wird das gesamte gemeldete Prämienvolumen Zusammenfassung durch die


Pränatales Screening auf Chromosomenstörungen. Pränatales Screening. Leitfaden für werdende Mütter und Väter. Leitfaden für werdende Mütter und Väter

Pränatales Screening auf Chromosomenstörungen. Pränatales Screening. Leitfaden für werdende Mütter und Väter. Leitfaden für werdende Mütter und Väter Unsere Patienten-Information Pränatales auf Chromosomenstörungen Pränatales auf Chromosomenstörungen Leitfaden für werdende Mütter und Väter Leitfaden für werdende Mütter und Väter Labor Enders & Partner,


Heute braun morgen Krebs: Sonne(n) mit Verstand am 28. Juli 2008 in München

Heute braun morgen Krebs: Sonne(n) mit Verstand am 28. Juli 2008 in München Grußwort: Heute braun morgen Krebs: Sonne(n) mit Verstand am 28. Juli 2008 in München von Dr. med. Max Kaplan, Vizepräsident der Bayerischen Landesärztekammer Es gilt das gesprochene Wort. Seite 1 von


Ein neues System für die Allokation von Spenderlungen. LAS Information für Patienten in Deutschland

Ein neues System für die Allokation von Spenderlungen. LAS Information für Patienten in Deutschland Ein neues System für die Allokation von Spenderlungen LAS Information für Patienten in Deutschland Ein neues System für die Allokation von Spenderlungen Aufgrund des immensen Mangels an Spenderorganen


Behörde für Bildung und Sport Abitur 2008 Lehrermaterialien zum Leistungskurs Mathematik

Behörde für Bildung und Sport Abitur 2008 Lehrermaterialien zum Leistungskurs Mathematik Abitur 8 II. Insektenpopulation LA/AG In den Tropen legen die Weibchen einer in Deutschland unbekannten Insektenpopulation jedes Jahr kurz vor Beginn der Regenzeit jeweils 9 Eier und sterben bald darauf.


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Antibiotikaresistenz bei Pseudomonaden

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Antibiotikaresistenz bei Pseudomonaden Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Antibiotikaresistenz bei Pseudomonaden Das komplette Material finden Sie hier: S 1 M 6 M 7 Erarbeitung II, Präsentation



VORANGEGANGENE MODELLE VORANGEGANGENE MODELLE UNSER THEMA HEUTE Ziel dieses Papers: - Nähere Charakterisierung der AuxREs - Analyse eines zu den AuxREs gehörenden Transkriptionsfaktors WAS BEREITS BEKANNT WAR: - Auxin moduliert


Grundlagen der Theoretischen Informatik, SoSe 2008

Grundlagen der Theoretischen Informatik, SoSe 2008 1. Aufgabenblatt zur Vorlesung Grundlagen der Theoretischen Informatik, SoSe 2008 (Dr. Frank Hoffmann) Lösung von Manuel Jain und Benjamin Bortfeldt Aufgabe 2 Zustandsdiagramme (6 Punkte, wird korrigiert)


Kulturelle Evolution 12

Kulturelle Evolution 12 3.3 Kulturelle Evolution Kulturelle Evolution Kulturelle Evolution 12 Seit die Menschen Erfindungen machen wie z.b. das Rad oder den Pflug, haben sie sich im Körperbau kaum mehr verändert. Dafür war einfach


WAS finde ich WO im Beipackzettel

WAS finde ich WO im Beipackzettel WAS finde ich WO im Beipackzettel Sie haben eine Frage zu Ihrem? Meist finden Sie die Antwort im Beipackzettel (offiziell "Gebrauchsinformation" genannt). Der Aufbau der Beipackzettel ist von den Behörden


Osteoporose. Ein echtes Volksleiden. Schon jetzt zählen die Osteoporose und die damit verbundene erhöhte Brüchigkeit der Knochen

Osteoporose. Ein echtes Volksleiden. Schon jetzt zählen die Osteoporose und die damit verbundene erhöhte Brüchigkeit der Knochen Osteoporose Osteoporose 9 Osteoporose Ein echtes Volksleiden Schon jetzt zählen die Osteoporose und die damit verbundene erhöhte Brüchigkeit der Knochen in den entwickelten Ländern zu den häufigsten Erkrankungen


Outlook. outlook - mail-grundlagen Seite 1/8. Mail-Grundlagen. Posteingang

Outlook. outlook - mail-grundlagen Seite 1/8. Mail-Grundlagen. Posteingang outlook - mail-grundlagen Seite 1/8 Outlook Mail-Grundlagen Posteingang Es gibt verschiedene Möglichkeiten, um zum Posteingang zu gelangen. Man kann links im Outlook-Fenster auf die Schaltfläche


Übungsblatt zu Säuren und Basen

Übungsblatt zu Säuren und Basen 1 Übungsblatt zu Säuren und Basen 1. In einer wässrigen Lösung misst die Konzentration der Oxoniumionen (H 3 O + ) 10 5 M. a) Wie gross ist der ph Wert? b) Ist die Konzentration der OH Ionen grösser oder


Hautkrebsscreening. 49 Prozent meinen, Hautkrebs sei kein Thema, das sie besorgt. Thema Hautkrebs. Ist Hautkrebs für Sie ein Thema, das Sie besorgt?

Hautkrebsscreening. 49 Prozent meinen, Hautkrebs sei kein Thema, das sie besorgt. Thema Hautkrebs. Ist Hautkrebs für Sie ein Thema, das Sie besorgt? Hautkrebsscreening Datenbasis: 1.004 gesetzlich Krankenversicherte ab 1 Jahren Erhebungszeitraum:. bis 4. April 01 statistische Fehlertoleranz: +/- Prozentpunkte Auftraggeber: DDG Hautkrebs ist ein Thema,


APP-GFP/Fluoreszenzmikroskop. Aufnahmen neuronaler Zellen, mit freund. Genehmigung von Prof. Stefan Kins, TU Kaiserslautern

APP-GFP/Fluoreszenzmikroskop. Aufnahmen neuronaler Zellen, mit freund. Genehmigung von Prof. Stefan Kins, TU Kaiserslautern Über die Herkunft von Aβ42 und Amyloid-Plaques Heute ist sicher belegt, dass sich die amyloiden Plaques aus einer Vielzahl an Abbaufragmenten des Amyloid-Vorläufer-Proteins (amyloid-precursor-protein,


Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.


Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email:

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,


Professionelle Seminare im Bereich MS-Office

Professionelle Seminare im Bereich MS-Office Der Name BEREICH.VERSCHIEBEN() ist etwas unglücklich gewählt. Man kann mit der Funktion Bereiche zwar verschieben, man kann Bereiche aber auch verkleinern oder vergrößern. Besser wäre es, die Funktion


Screening Das Programm. zur Früherkennung von Brustkrebs

Screening Das Programm. zur Früherkennung von Brustkrebs Mammographie Screening Das Programm zur Früherkennung von Brustkrebs das Mammographie Screening Programm Wenn Sie zwischen 50 und 69 Jahre alt sind, haben Sie alle zwei Jahre Anspruch auf eine Mammographie-Untersuchung


Darum geht es in diesem Heft

Darum geht es in diesem Heft Die Hilfe für Menschen mit Demenz von der Allianz für Menschen mit Demenz in Leichter Sprache Darum geht es in diesem Heft Viele Menschen in Deutschland haben Demenz. Das ist eine Krankheit vom Gehirn.


Erfahrungen mit Hartz IV- Empfängern

Erfahrungen mit Hartz IV- Empfängern Erfahrungen mit Hartz IV- Empfängern Ausgewählte Ergebnisse einer Befragung von Unternehmen aus den Branchen Gastronomie, Pflege und Handwerk Pressegespräch der Bundesagentur für Arbeit am 12. November


Katalysatoren - Chemische Partnervermittlung im virtuellen Labor

Katalysatoren - Chemische Partnervermittlung im virtuellen Labor Seite 1 von 6 Katalysatoren - Chemische Partnervermittlung im virtuellen Labor Katalysatoren Der Katalysator in der Großindustrie Was passiert im Inneren? Das virtuelle Labor. Katalysatoren Katalysatoren



4. BEZIEHUNGEN ZWISCHEN TABELLEN 4. BEZIEHUNGEN ZWISCHEN TABELLEN Zwischen Tabellen können in MS Access Beziehungen bestehen. Durch das Verwenden von Tabellen, die zueinander in Beziehung stehen, können Sie Folgendes erreichen: Die Größe


Anleitung über den Umgang mit Schildern

Anleitung über den Umgang mit Schildern Anleitung über den Umgang mit Schildern -Vorwort -Wo bekommt man Schilder? -Wo und wie speichert man die Schilder? -Wie füge ich die Schilder in meinen Track ein? -Welche Bauteile kann man noch für Schilder


L10N-Manager 3. Netzwerktreffen der Hochschulübersetzer/i nnen Mannheim 10. Mai 2016

L10N-Manager 3. Netzwerktreffen der Hochschulübersetzer/i nnen Mannheim 10. Mai 2016 L10N-Manager 3. Netzwerktreffen der Hochschulübersetzer/i nnen Mannheim 10. Mai 2016 Referentin: Dr. Kelly Neudorfer Universität Hohenheim Was wir jetzt besprechen werden ist eine Frage, mit denen viele


Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?


Simulation LIF5000. Abbildung 1

Simulation LIF5000. Abbildung 1 Simulation LIF5000 Abbildung 1 Zur Simulation von analogen Schaltungen verwende ich Ltspice/SwitcherCAD III. Dieses Programm ist sehr leistungsfähig und wenn man weis wie, dann kann man damit fast alles


Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge


ONLINE-AKADEMIE. "Diplomierter NLP Anwender für Schule und Unterricht" Ziele

ONLINE-AKADEMIE. Diplomierter NLP Anwender für Schule und Unterricht Ziele ONLINE-AKADEMIE Ziele Wenn man von Menschen hört, die etwas Großartiges in ihrem Leben geleistet haben, erfahren wir oft, dass diese ihr Ziel über Jahre verfolgt haben oder diesen Wunsch schon bereits


Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information):

Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information): Frauenklinik Gynäkologie und Gynäkologische Onkologie Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information): Universitätsspital Basel Frauenklinik PD Dr. med. Nicole


Die monatliche Selbstuntersuchung der Brust

Die monatliche Selbstuntersuchung der Brust Die monatliche Selbstuntersuchung der Brust Kein Problem: die monatliche Selbstuntersuchung der Brust Hormone steuern nicht nur den weiblichen Monats zyklus, sondern beeinflussen auch das Brustgewebe.


DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette


Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine


Kreativ visualisieren

Kreativ visualisieren Kreativ visualisieren Haben Sie schon einmal etwas von sogenannten»sich selbst erfüllenden Prophezeiungen«gehört? Damit ist gemeint, dass ein Ereignis mit hoher Wahrscheinlichkeit eintritt, wenn wir uns


Programme im Griff Was bringt Ihnen dieses Kapitel?

Programme im Griff Was bringt Ihnen dieses Kapitel? 3-8272-5838-3 Windows Me 2 Programme im Griff Was bringt Ihnen dieses Kapitel? Wenn Sie unter Windows arbeiten (z.b. einen Brief schreiben, etwas ausdrucken oder ein Fenster öffnen), steckt letztendlich


Finanzierung: Übungsserie III Innenfinanzierung

Finanzierung: Übungsserie III Innenfinanzierung Thema Dokumentart Finanzierung: Übungsserie III Innenfinanzierung Lösungen Theorie im Buch "Integrale Betriebswirtschaftslehre" Teil: Kapitel: D1 Finanzmanagement 2.3 Innenfinanzierung Finanzierung: Übungsserie


1. Einführung 2. 2. Erstellung einer Teillieferung 2. 3. Erstellung einer Teilrechnung 6

1. Einführung 2. 2. Erstellung einer Teillieferung 2. 3. Erstellung einer Teilrechnung 6 Inhalt 1. Einführung 2 2. Erstellung einer Teillieferung 2 3. Erstellung einer Teilrechnung 6 4. Erstellung einer Sammellieferung/ Mehrere Aufträge zu einem Lieferschein zusammenfassen 11 5. Besonderheiten


Erfolg im Verkauf durch Persönlichkeit! Potenzialanalyse, Training & Entwicklung für Vertriebsmitarbeiter!

Erfolg im Verkauf durch Persönlichkeit! Potenzialanalyse, Training & Entwicklung für Vertriebsmitarbeiter! Wer in Kontakt ist verkauft! Wie reden Sie mit mir? Erfolg im Verkauf durch Persönlichkeit! Potenzialanalyse, Training & Entwicklung für Vertriebsmitarbeiter! Fritz Zehetner Persönlichkeit


Datenaufbereitung in SPSS. Daten zusammenfügen

Datenaufbereitung in SPSS. Daten zusammenfügen Daten zusammenfügen I. Fälle hinzufügen Diese Schritte müssen Sie unternehmen, wenn die Daten in unterschiedlichen Dateien sind; wenn also die Daten von unterschiedlichen Personen in unterschiedlichen



Verband der TÜV e. V. STUDIE ZUM IMAGE DER MPU Verband der TÜV e. V. STUDIE ZUM IMAGE DER MPU 2 DIE MEDIZINISCH-PSYCHOLOGISCHE UNTERSUCHUNG (MPU) IST HOCH ANGESEHEN Das Image der Medizinisch-Psychologischen Untersuchung (MPU) ist zwiespältig: Das ist


II. Zum Jugendbegleiter-Programm

II. Zum Jugendbegleiter-Programm II. Zum Jugendbegleiter-Programm A. Zu den Jugendbegleiter/inne/n 1. Einsatz von Jugendbegleiter/inne/n Seit Beginn des Schuljahres 2007/2008 setzen die 501 Modellschulen 7.068 Jugendbegleiter/innen ein.


Erweiterungen Webportal

Erweiterungen Webportal Erweiterungen Webportal Adress-Suche Inaktive Merkmale und gelöschte Adresse Die Suche im Webportal wurde so erweitert, dass inaktive Adresse (gelöscht) und inaktive Merkmale bei der Suche standardmässig


Gutes Leben was ist das?

Gutes Leben was ist das? Lukas Bayer Jahrgangsstufe 12 Im Hirschgarten 1 67435 Neustadt Kurfürst-Ruprecht-Gymnasium Landwehrstraße22 67433 Neustadt a. d. Weinstraße Gutes Leben was ist das? Gutes Leben für alle was genau ist das


GEVITAS Farben-Reaktionstest

GEVITAS Farben-Reaktionstest GEVITAS Farben-Reaktionstest GEVITAS Farben-Reaktionstest Inhalt 1. Allgemeines... 1 2. Funktionsweise der Tests... 2 3. Die Ruhetaste und die Auslösetaste... 2 4. Starten der App Hauptmenü... 3 5. Auswahl


DNA-Sequenzierung. Martina Krause

DNA-Sequenzierung. Martina Krause DNA-Sequenzierung Martina Krause Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse


Der Kälteanlagenbauer

Der Kälteanlagenbauer Der Kälteanlagenbauer Band : Grundkenntnisse Bearbeitet von Karl Breidenbach., überarbeitete und erweiterte Auflage. Buch. XXVIII, S. Gebunden ISBN 00 Format (B x L):,0 x,0 cm Zu Inhaltsverzeichnis schnell


Das Vermögen der privaten Haushalte in Nordrhein-Westfalen ein Überblick auf der Basis der Einkommens- und Verbrauchsstichprobe

Das Vermögen der privaten Haushalte in Nordrhein-Westfalen ein Überblick auf der Basis der Einkommens- und Verbrauchsstichprobe Sozialberichterstattung NRW. Kurzanalyse 02/2010 09.07.2010 12.07.2010 Das Vermögen der privaten Haushalte in Nordrhein-Westfalen ein Überblick auf der Basis der Einkommens- und Verbrauchsstichprobe 2008


Unvoreingenommene Neugier

Unvoreingenommene Neugier Grundhaltung: Unvoreingenommene Neugier Das ist die Haltung des Forschers. Er beschäftigt sich nicht mit unbewiesenen Annahmen und Glaubenssätzen, sondern stellt Hypothesen auf und versucht, diese zu verifizieren


Bei der Anlage von Pauschalen ist folgendes zu beachten!!!!!!!!

Bei der Anlage von Pauschalen ist folgendes zu beachten!!!!!!!! Bei der Anlage von Pauschalen ist folgendes zu beachten!!!!!!!! Vorgaben für Pauschen: Die Pauschale wird in der Homepage mit 3 Punkten dargestellt Titel ist der Produkttitel Pro Punkt jeweils maximal


Lichtbrechung an Linsen

Lichtbrechung an Linsen Sammellinsen Lichtbrechung an Linsen Fällt ein paralleles Lichtbündel auf eine Sammellinse, so werden die Lichtstrahlen so gebrochen, dass sie durch einen Brennpunkt der Linse verlaufen. Der Abstand zwischen


Uli Greßler. Qualitätsmanagement. Überwachung der Produkt- und Prozessqualität. Arbeitsheft. 2. Auflage. Bestellnummer 04796

Uli Greßler. Qualitätsmanagement. Überwachung der Produkt- und Prozessqualität. Arbeitsheft. 2. Auflage. Bestellnummer 04796 Uli Greßler Qualitätsmanagement Überwachung der Produt- und Prozessqualität Arbeitsheft 2. Auflage Bestellnummer 04796 Haben Sie Anregungen oder Kritipunte zu diesem Produt? Dann senden Sie eine E-Mail


Vermögensbildung: Sparen und Wertsteigerung bei Immobilien liegen vorn

Vermögensbildung: Sparen und Wertsteigerung bei Immobilien liegen vorn An die Redaktionen von Presse, Funk und Fernsehen 32 02. 09. 2002 Vermögensbildung: Sparen und Wertsteigerung bei Immobilien liegen vorn Das aktive Sparen ist nach wie vor die wichtigste Einflussgröße


1 topologisches Sortieren

1 topologisches Sortieren Wolfgang Hönig / Andreas Ecke WS 09/0 topologisches Sortieren. Überblick. Solange noch Knoten vorhanden: a) Suche Knoten v, zu dem keine Kante führt (Falls nicht vorhanden keine topologische Sortierung


Erstellen von x-y-diagrammen in OpenOffice.calc

Erstellen von x-y-diagrammen in OpenOffice.calc Erstellen von x-y-diagrammen in OpenOffice.calc In dieser kleinen Anleitung geht es nur darum, aus einer bestehenden Tabelle ein x-y-diagramm zu erzeugen. D.h. es müssen in der Tabelle mindestens zwei


Hirnödeme bei HAE was Patienten wissen sollten

Hirnödeme bei HAE was Patienten wissen sollten Hirnödeme bei HAE was Patienten wissen sollten Dieser immer stärker werdende Druck... Starke Kopfschmerzen? Bei HAE kann auch ein Hirnödem die Ursache sein. 2 Ein kaum beachteter Zusammenhang Verspannungen,


1 C H R I S T O P H D R Ö S S E R D E R M A T H E M A T I K V E R F Ü H R E R

1 C H R I S T O P H D R Ö S S E R D E R M A T H E M A T I K V E R F Ü H R E R C H R I S T O P H D R Ö S S E R D E R M A T H E M A T I K V E R F Ü H R E R L Ö S U N G E N Seite 7 n Wenn vier Menschen auf einem Quadratmeter stehen, dann hat jeder eine Fläche von 50 mal 50 Zentimeter


Geld Verdienen im Internet leicht gemacht

Geld Verdienen im Internet leicht gemacht Geld Verdienen im Internet leicht gemacht Hallo, Sie haben sich dieses E-book wahrscheinlich herunter geladen, weil Sie gerne lernen würden wie sie im Internet Geld verdienen können, oder? Denn genau das


I.O. BUSINESS. Checkliste Effektive Vorbereitung aktiver Telefonate

I.O. BUSINESS. Checkliste Effektive Vorbereitung aktiver Telefonate I.O. BUSINESS Checkliste Effektive Vorbereitung aktiver Telefonate Gemeinsam Handeln I.O. BUSINESS Checkliste Effektive Vorbereitung aktiver Telefonate Telefonieren ermöglicht die direkte Kommunikation


Inhalt. Allgemeine Einführung. Argumentationsvermögen. Räumliches Vorstellungsvermögen. Begabungen und Fähigkeiten messen

Inhalt. Allgemeine Einführung. Argumentationsvermögen. Räumliches Vorstellungsvermögen. Begabungen und Fähigkeiten messen Beispielheft Inhalt Allgemeine Einführung Test Eins: Test Zwei: Test Drei: Test Vier: Test Fünf: Argumentationsvermögen Auffassungsvermögen Zahlenvermögen Sprachverständnis Räumliches Vorstellungsvermögen


Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung


Lineare Funktionen. 1 Proportionale Funktionen 3 1.1 Definition... 3 1.2 Eigenschaften... 3. 2 Steigungsdreieck 3

Lineare Funktionen. 1 Proportionale Funktionen 3 1.1 Definition... 3 1.2 Eigenschaften... 3. 2 Steigungsdreieck 3 Lineare Funktionen Inhaltsverzeichnis 1 Proportionale Funktionen 3 1.1 Definition............................... 3 1.2 Eigenschaften............................. 3 2 Steigungsdreieck 3 3 Lineare Funktionen


Kapitel 8 Ò Chromosomen und Genregulation

Kapitel 8 Ò Chromosomen und Genregulation Kapitel 8 Ò Chromosomen und Genregulation 8.1 Struktur eukaryontischer Chromosomen Ein menschlicher Zellkern ist nur zehn Mikrometer gross und (10-9 ) hat zwei Meter DNA drin. Damit es da kein Durcheinander
