Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Größe: px
Ab Seite anzeigen:

Download "Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014"

Transkript

1 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 ( ) 1) Von der DNA-Sequenz zum Protein Sie können diese Aufgabe auch interaktiv auf folgender Webseite lösen: Gehen Sie zu dem Punkt Problem a) Es ist Ihre Aufgabe, ein Gen zu sequenzieren, von dem noch keine Aminosäuresequenz bekannt ist. Sie sequenzieren nach der Sanger-Methode. Das folgende Bild zeigt das Autoradiogramm eines Ihrer ersten Sequenzgele. Lesen Sie die gesamte Sequenz und schreiben Sie Ihr Ergebnis in die entsprechenden Zeilen der Tabellen des folgenden Aufgabenblatts. 1

2 b) Schreiben Sie nun darunter den komplementären Strang. Beschriften Sie alle 5 - und 3 -Enden. c) Nehmen Sie an, dass der DNA-Strang in der 2. Zeile den Matrizenstrang darstellt. Übersetzen Sie diesen in RNA. Schreiben Sie die RNA-Sequenz in die dritte Zeile. Vergessen Sie nicht, die 5 - und 3 -Enden zu beschriften. 2

3 d) Benutzen Sie die Codesonne aus der 5. Übungsstunde und übersetzen Sie die ersten 20 Nukleotide der RNA. Welche der folgenden Aminosäuresequenzen finden Sie? (Einbuchstabencode siehe unten!) (1) T A D V E L (2) L L M L N Stop (3) C Stop C Stop I R (4) alle oben genannten (5) keine der oben genannten e) Bedenken Sie, dass Sie nicht wissen, welcher Strang der Matrizenstrang Ihres Gens ist. Sie müssten somit auch auf dem Gegenstrang nach möglichen offenen Leserahmen suchen. Welche der folgenden RNA-Sequenzen könnten theoretisch auch gebildet werden? (1) 5 UUAACGCGUGCCUCUGGUCU 3 (2) 5 TTAACGCGTGCCTCTGGTCT 3 (3) 5 UGACGACUACAACUUAAUCU 3 f) Im Folgenden ist das Ergebnis Ihrer Suche nach offenen Leserahmen auf beiden DNA-Strängen dargestellt. Leserahmen 1: T A D V E L Leserahmen 2: L L M L N Stop Leserahmen 3: C Stop C Stop I R Leserahmen 4: L T R A S G L Leserahmen 5: Stop R V P L V Stop Leserahmen 6: N A C L W S I Welche/n Leserahmen würden Sie mit dem Ziel, Ihr gesuchtes Gen zu identifizieren, weiter untersuchen? Einbuchstabencode der Aminosäuren: 3

4 2)Transkription und Translation A) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 11 und läuft von dort nach rechts. Wie lautet die Sequenz des kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden. Benutzen Sie die Codesonne aus der 5. Übungsstunde und den o.a. Einbuchstabencode der Aminosäuren. B) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 6 und läuft von dort nach rechts. Das Splicen der mrna erfolgt gemäß der GT- AG Regel. Demnach beginnt das 5 Ende des Introns mit GT und endet am 3 Ende mit AG. (I) Wie lautet die Sequenz des 5 untranslatierten Bereichs der mrna? Kennzeichnen Sie 5 und 3 Enden der mrna. (II) Wie lautet die Sequenz des von der reifen mrna kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. 4

5 (III) Wie lautet die Sequenz des Proteins im Einbuchstabencode, die nach einer Punktmutation des T/A Paares an Stelle 27 (fett markiert) zu einem C/G Paar gebildet wird? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. (IV) Um was für einen Typ von Nukleotid-Austausch handelt es sich hierbei? 5

6 3) Wiederholung Ordnen Sie die unten aufgelisteten Begriffe als Kürzel den folgenden Definitionen und Aussagen zu: 6

7 Liste der zuzuordnenden Begriffe: 7

Sichere E-Mail Anleitung Zertifikate / Schlüssel für Kunden der Sparkasse Germersheim-Kandel. Sichere E-Mail. der

Sichere E-Mail Anleitung Zertifikate / Schlüssel für Kunden der Sparkasse Germersheim-Kandel. Sichere E-Mail. der Sichere E-Mail der Nutzung von Zertifikaten / Schlüsseln zur sicheren Kommunikation per E-Mail mit der Sparkasse Germersheim-Kandel Inhalt: 1. Voraussetzungen... 2 2. Registrierungsprozess... 2 3. Empfang

Подробнее

Word 2010 Schnellbausteine

Word 2010 Schnellbausteine WO.001, Version 1.0 02.04.2013 Kurzanleitung Word 2010 Schnellbausteine Word 2010 enthält eine umfangreiche Sammlung vordefinierter Bausteine, die sogenannten "Schnellbausteine". Neben den aus den früheren

Подробнее

Der Jazz Veranstaltungskalender für Deutschland, Österreich und die Schweiz

Der Jazz Veranstaltungskalender für Deutschland, Österreich und die Schweiz Veranstaltung erstellen mit vorheriger Registrierung Wenn Sie sich bei Treffpunkt Jazz registrieren, genießen Sie folgende Vorteile: Sie können bereits eingestellte Veranstaltungen auch noch später ändern

Подробнее

Übungen zu Einführung in die Informatik: Programmierung und Software-Entwicklung: Lösungsvorschlag

Übungen zu Einführung in die Informatik: Programmierung und Software-Entwicklung: Lösungsvorschlag Ludwig-Maximilians-Universität München WS 2015/16 Institut für Informatik Übungsblatt 13 Prof. Dr. R. Hennicker, A. Klarl Übungen zu Einführung in die Informatik: Programmierung und Software-Entwicklung:

Подробнее

Installation OMNIKEY 3121 USB

Installation OMNIKEY 3121 USB Installation OMNIKEY 3121 USB Vorbereitungen Installation PC/SC Treiber CT-API Treiber Einstellungen in Starke Praxis Testen des Kartenlesegeräts Vorbereitungen Bevor Sie Änderungen am System vornehmen,

Подробнее

Das DAAD-PORTAL. Prozess der Antragstellung in dem SAPbasierten Bewerbungsportal des DAAD.

Das DAAD-PORTAL. Prozess der Antragstellung in dem SAPbasierten Bewerbungsportal des DAAD. Das DAAD-PORTAL Prozess der Antragstellung in dem SAPbasierten Bewerbungsportal des DAAD. November 2012 Man findet das neue Portal auf der Webseite vom DAAD : www.daad.de/ Danach erscheint ein neues Fenster,

Подробнее

1. Einführung 2. 2. Erstellung einer Teillieferung 2. 3. Erstellung einer Teilrechnung 6

1. Einführung 2. 2. Erstellung einer Teillieferung 2. 3. Erstellung einer Teilrechnung 6 Inhalt 1. Einführung 2 2. Erstellung einer Teillieferung 2 3. Erstellung einer Teilrechnung 6 4. Erstellung einer Sammellieferung/ Mehrere Aufträge zu einem Lieferschein zusammenfassen 11 5. Besonderheiten

Подробнее

Anleitung über den Umgang mit Schildern

Anleitung über den Umgang mit Schildern Anleitung über den Umgang mit Schildern -Vorwort -Wo bekommt man Schilder? -Wo und wie speichert man die Schilder? -Wie füge ich die Schilder in meinen Track ein? -Welche Bauteile kann man noch für Schilder

Подробнее

Anleitung für die Teilnahme an den Platzvergaben "Studio II, Studio IV und Studio VI" im Studiengang Bachelor Architektur SS15

Anleitung für die Teilnahme an den Platzvergaben Studio II, Studio IV und Studio VI im Studiengang Bachelor Architektur SS15 Anleitung für die Teilnahme an den Platzvergaben "Studio II, Studio IV und Studio VI" im Studiengang Bachelor Architektur SS15 1 Bitte melden Sie sich über das Campusmanagementportal campus.studium.kit.edu

Подробнее

Vorgehensweise bei Lastschriftverfahren

Vorgehensweise bei Lastschriftverfahren Vorgehensweise bei Lastschriftverfahren Voraussetzung hierfür sind nötige Einstellungen im ControlCenter. Sie finden dort unter Punkt 29 die Möglichkeit bis zu drei Banken für das Lastschriftverfahren

Подробнее

Jede Zahl muss dabei einzeln umgerechnet werden. Beginnen wir also ganz am Anfang mit der Zahl,192.

Jede Zahl muss dabei einzeln umgerechnet werden. Beginnen wir also ganz am Anfang mit der Zahl,192. Binäres und dezimales Zahlensystem Ziel In diesem ersten Schritt geht es darum, die grundlegende Umrechnung aus dem Dezimalsystem in das Binärsystem zu verstehen. Zusätzlich wird auch die andere Richtung,

Подробнее

P&P Software - Adressexport an Outlook 05/29/16 14:44:26

P&P Software - Adressexport an Outlook 05/29/16 14:44:26 Adressexport an Outlook Wozu? Aus EASY können viele Daten im Excelformat ausgegeben werden. Diese Funktion kann zum Beispiel zum Export von Lieferantenadressen an Outlook genutzt werden. Hinweis Wir können

Подробнее

Fotogalerie mit PWGallery in Joomla (3.4.0) erstellen

Fotogalerie mit PWGallery in Joomla (3.4.0) erstellen Fotogalerie mit PWGallery in Joomla (3.4.0) erstellen Als ersten Schritt müssen wir alle Fotos die in die Galerie sollen hochladen. Wir gehen davon aus, dass das Plugin PWGallery bereits installiert und

Подробнее

Der Gabelstapler: Wie? Was? Wer? Wo?

Der Gabelstapler: Wie? Was? Wer? Wo? Schreibkompetenz 16: schlusszeichen (Fragezeichen) sprechen zeichen Um eine Frage zu kennzeichnen, wird ein Fragezeichen (?) gesetzt. Fragewörter (zum Beispiel wo, wer, was, wie) zeigen an, dass ein Fragezeichen

Подробнее

2) Geben Sie in der Anmeldemaske Ihren Zugangsnamen und Ihr Passwort ein

2) Geben Sie in der Anmeldemaske Ihren Zugangsnamen und Ihr Passwort ein Kurzanleitung für die Nutzung der Bildergalerie Zugangsdaten zur Bildergalerie des Imkervereins Weinsberg Um einen namentlichen Benutzerzugang zur Bildergalerie des Imkervereins Weinsberg zu erhalten (http://bilder.imker-weinsbergertal.de)

Подробнее

Erfahrungen mit Hartz IV- Empfängern

Erfahrungen mit Hartz IV- Empfängern Erfahrungen mit Hartz IV- Empfängern Ausgewählte Ergebnisse einer Befragung von Unternehmen aus den Branchen Gastronomie, Pflege und Handwerk Pressegespräch der Bundesagentur für Arbeit am 12. November

Подробнее

ejgp Webseite Kurzeinführung

ejgp Webseite Kurzeinführung ejgp Webseite Kurzeinführung Inhaltsverzeichnis 1.Einloggen...2 2.Beitrag bearbeiten...2 3.Beitrag hinzufügen...3 4.Bild hoch laden und einfügen...3 5.Link in Text einfügen...4 6.Bilder für die Galerie

Подробнее

FH-SY Chapter 2.4 - Version 3 - FH-SY.NET - FAQ -

FH-SY Chapter 2.4 - Version 3 - FH-SY.NET - FAQ - FH-SY Chapter 2.4 - Version 3 - FH-SY.NET - FAQ - Version vom 02.02.2010 Inhaltsverzeichnis 1. KANN ICH BEI EINER EIGENEN LEKTION NACHTRÄGLICH NOCH NEUE LERNINHALTE ( WAS WURDE BEHANDELT? ) EINFÜGEN?...

Подробнее

Übernahme von Daten aus einem bestehenden Outlook-Profil bzw. einem anderen Exchange Server

Übernahme von Daten aus einem bestehenden Outlook-Profil bzw. einem anderen Exchange Server Übernahme von Daten aus einem bestehenden Outlook-Profil bzw. einem anderen Exchange Betroffene Produkte Outlook 2010 Lösung 1. Starten Sie bitte Ihr Outlook, um Ihre Daten aus dem alten Outlook-Profil

Подробнее

Schuljahreswechsel im Schul-Webportal

Schuljahreswechsel im Schul-Webportal Schuljahreswechsel im Schul-Webportal Seite 1 von 8 Schuljahreswechsel im Schul-Webportal Ablauf Übersicht: Schritte 1 bis 10: Schritte 11 bis 16: Schritte 17 bis 20: Vorbereitung des Schuljahreswechsels

Подробнее

CAQ Software für Ihr Qualitätsmanagement. Ablauf für die Erfassung der Fehler in der Fertigung

CAQ Software für Ihr Qualitätsmanagement. Ablauf für die Erfassung der Fehler in der Fertigung Ablauf für die Erfassung der Fehler in der Fertigung Voraussetzung ist die Zuordnung der Erzeugnisse zu Produktgruppen. Wie das funktioniert ist der Anleitung Neue Produktgruppe anlegen und mit Erzeugnissen

Подробнее

M@school Software- und Druckerzuweisung Selbstlernmaterialien

M@school Software- und Druckerzuweisung Selbstlernmaterialien Bildung und Sport M@school Software- und Druckerzuweisung Selbstlernmaterialien Hinweise zum Skript: LMK = Linker Mausklick RMK = Rechter Mausklick LMT = Linke Maustaste RMT = Rechte Maustaste Um die Lesbarkeit

Подробнее

Um eine Person in Magnolia zu erfassen, gehen Sie wie folgt vor:

Um eine Person in Magnolia zu erfassen, gehen Sie wie folgt vor: Personendaten verwalten mit Magnolia Sie können ganz einfach und schnell alle Personendaten, die Sie auf Ihrer Webseite publizieren möchten, mit Magnolia verwalten. In der Applikation Adressbuch können

Подробнее

Lernaufgabe Industriekauffrau/Industriekaufmann Angebot und Auftrag: Arbeitsblatt I Auftragsbeschreibung

Lernaufgabe Industriekauffrau/Industriekaufmann Angebot und Auftrag: Arbeitsblatt I Auftragsbeschreibung Angebot und Auftrag: Arbeitsblatt I Auftragsbeschreibung Ein Kunde hat Interesse an einem von Ihrem Unternehmen hergestellten Produkt gezeigt. Es handelt sich dabei um einen batteriebetriebenen tragbaren

Подробнее

Handbuch ECDL 2003 Professional Modul 3: Kommunikation Kalender freigeben und andere Kalender aufrufen

Handbuch ECDL 2003 Professional Modul 3: Kommunikation Kalender freigeben und andere Kalender aufrufen Handbuch ECDL 2003 Professional Modul 3: Kommunikation Kalender freigeben und andere Kalender aufrufen Dateiname: ecdl_p3_02_03_documentation.doc Speicherdatum: 08.12.2004 ECDL 2003 Professional Modul

Подробнее

Kompetenzen und Aufgabenbeispiele Deutsch Erstes Schreiben

Kompetenzen und Aufgabenbeispiele Deutsch Erstes Schreiben Institut für Bildungsevaluation Assoziiertes Institut der Universität Zürich Kompetenzen und Aufgabenbeispiele Deutsch Erstes Schreiben Informationen für Lehrpersonen und Eltern 1. Wie sind die Ergebnisse

Подробнее

Einrichten des fhb-wlan

Einrichten des fhb-wlan Einrichten des fhb-wlan Diese Anleitung wurde erstellt von Dirk Dahse. Fragen zur Einrichtung bitte an: wlanadmin@fh-brandenburg.de Diese Anleitung befasst sich mit der grundlegenden manuellen Einrichtung

Подробнее

SWOT Analyse zur Unterstützung des Projektmonitorings

SWOT Analyse zur Unterstützung des Projektmonitorings SWOT Analyse zur Unterstützung des Projektmonitorings Alle QaS-Dokumente können auf der QaS-Webseite heruntergeladen werden, http://qas.programkontoret.se Seite 1 Was ist SWOT? SWOT steht für Stärken (Strengths),

Подробнее

Handbuch ECDL 2003 Professional Modul 2: Tabellenkalkulation Arbeiten mit Pivot-Tabellen

Handbuch ECDL 2003 Professional Modul 2: Tabellenkalkulation Arbeiten mit Pivot-Tabellen Handbuch ECDL 2003 Professional Modul 2: Tabellenkalkulation Arbeiten mit Pivot-Tabellen Dateiname: ecdl_p2_04_01_documentation.doc Speicherdatum: 08.12.2004 ECDL 2003 Professional Modul 2 Tabellenkalkulation

Подробнее

Eigene Dokumente, Fotos, Bilder etc. sichern

Eigene Dokumente, Fotos, Bilder etc. sichern Eigene Dokumente, Fotos, Bilder etc. sichern Solange alles am PC rund läuft, macht man sich keine Gedanken darüber, dass bei einem Computer auch mal ein technischer Defekt auftreten könnte. Aber Grundsätzliches

Подробнее

Wie installiere ich das CAcert Root-Zertifikat?

Wie installiere ich das CAcert Root-Zertifikat? Wie installiere ich das CAcert Root-Zertifikat? 1. Internet Explorer / Outlook...1 2. Mozilla...4 3. Firefox...4 4. Thunderbird...5 5. Opera...9 1. Internet Explorer / Outlook Bitte gehen Sie zu der Adresse

Подробнее

1. Adressen für den Serienversand (Briefe Katalogdruck Werbung/Anfrage ) auswählen. Die Auswahl kann gespeichert werden.

1. Adressen für den Serienversand (Briefe Katalogdruck Werbung/Anfrage ) auswählen. Die Auswahl kann gespeichert werden. Der Serienversand Was kann man mit der Maske Serienversand machen? 1. Adressen für den Serienversand (Briefe Katalogdruck Werbung/Anfrage ) auswählen. Die Auswahl kann gespeichert werden. 2. Adressen auswählen,

Подробнее

Erstellen von x-y-diagrammen in OpenOffice.calc

Erstellen von x-y-diagrammen in OpenOffice.calc Erstellen von x-y-diagrammen in OpenOffice.calc In dieser kleinen Anleitung geht es nur darum, aus einer bestehenden Tabelle ein x-y-diagramm zu erzeugen. D.h. es müssen in der Tabelle mindestens zwei

Подробнее

Inhaltverzeichnis 1 Einführung... 1 2 Zugang zu den Unifr Servern... 1. 3 Zugang zu den Druckern... 4 4 Nützliche Links... 6

Inhaltverzeichnis 1 Einführung... 1 2 Zugang zu den Unifr Servern... 1. 3 Zugang zu den Druckern... 4 4 Nützliche Links... 6 Inhaltverzeichnis 1 Einführung... 1 2 Zugang zu den Unifr Servern... 1 2.1 Version Mac OSX 10.1-10.4, 10.6-10.7... 1 2.2 Version Mac OSX 10.5 (Leopard)... 2 3 Zugang zu den Druckern... 4 4 Nützliche Links...

Подробнее

Anzeige von eingescannten Rechnungen

Anzeige von eingescannten Rechnungen Anzeige von eingescannten Rechnungen Wenn Sie sich zu einer Eingangsrechnung die eingescannte Originalrechnung ansehen möchten, wählen Sie als ersten Schritt aus Ihrem Benutzermenü unter dem Kapitel Eingangsrechnung

Подробнее

SEPA-Umstellungshilfe für die VR-NetWorld-Software zur Nutzung von SEPA-Lastschriften

SEPA-Umstellungshilfe für die VR-NetWorld-Software zur Nutzung von SEPA-Lastschriften SEPA-Umstellungshilfe für die VR-NetWorld-Software zur Nutzung von SEPA-Lastschriften Inhaltsverzeichnis: 1. SEPA-Umstellungshilfe Seite 2-4 2. Ändern einer bestehenden Lastschrift Seite 5 3. Anlegen einer

Подробнее

Handbuch Kundenportal

Handbuch Kundenportal Handbuch Kundenportal Hinweise zur Nutzung des Kundenportals von Regis24 Stand: November 2015 Inhaltsverzeichnis Login Seite 3 Registrierungsdaten ändern Seite 6 Einzelanfragen in Auftrag geben Seite 7

Подробнее

Anleitung zur Erstellung von Serienbriefen (Word 2003) unter Berücksichtigung von Titeln (wie Dr., Dr. med. usw.)

Anleitung zur Erstellung von Serienbriefen (Word 2003) unter Berücksichtigung von Titeln (wie Dr., Dr. med. usw.) Seite 1/7 Anleitung zur Erstellung von Serienbriefen (Word 2003) unter Berücksichtigung von Titeln (wie Dr., Dr. med. usw.) Hier sehen Sie eine Anleitung wie man einen Serienbrief erstellt. Die Anleitung

Подробнее

Professionelle Seminare im Bereich MS-Office

Professionelle Seminare im Bereich MS-Office Der Name BEREICH.VERSCHIEBEN() ist etwas unglücklich gewählt. Man kann mit der Funktion Bereiche zwar verschieben, man kann Bereiche aber auch verkleinern oder vergrößern. Besser wäre es, die Funktion

Подробнее

A. Ersetzung einer veralteten Govello-ID ( Absenderadresse )

A. Ersetzung einer veralteten Govello-ID ( Absenderadresse ) Die Versendung von Eintragungsnachrichten und sonstigen Nachrichten des Gerichts über EGVP an den Notar ist nicht möglich. Was kann der Notar tun, um den Empfang in seinem Postfach zu ermöglichen? In zahlreichen

Подробнее

FuxMedia Programm im Netzwerk einrichten am Beispiel von Windows 7

FuxMedia Programm im Netzwerk einrichten am Beispiel von Windows 7 FuxMedia Programm im Netzwerk einrichten am Beispiel von Windows 7 Die Installation der FuxMedia Software erfolgt erst NACH Einrichtung des Netzlaufwerks! Menüleiste einblenden, falls nicht vorhanden Die

Подробнее

Glaube an die Existenz von Regeln für Vergleiche und Kenntnis der Regeln

Glaube an die Existenz von Regeln für Vergleiche und Kenntnis der Regeln Glaube an die Existenz von Regeln für Vergleiche und Kenntnis der Regeln Regeln ja Regeln nein Kenntnis Regeln ja Kenntnis Regeln nein 0 % 10 % 20 % 30 % 40 % 50 % 60 % 70 % 80 % 90 % Glauben Sie, dass

Подробнее

Hardware - Software - Net zwerke

Hardware - Software - Net zwerke Komprimierung der Ortho-Daten als ZIP-Archiv Dieses Dokument beschreibt die Archivierung aller Ortho-Daten als ZIP-Archiv über die MS- DOS-Eingabe-Aufforderung. Diese Information kann Ihnen zum Sichern

Подробнее

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Подробнее

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Подробнее

Bedienungsanleitung für Mitglieder von Oberstdorf Aktiv e.v. zur Verwaltung Ihres Benutzeraccounts auf www.einkaufserlebnis-oberstdorf.

Bedienungsanleitung für Mitglieder von Oberstdorf Aktiv e.v. zur Verwaltung Ihres Benutzeraccounts auf www.einkaufserlebnis-oberstdorf. Bedienungsanleitung für Mitglieder von Oberstdorf Aktiv e.v. zur Verwaltung Ihres Benutzeraccounts auf www.einkaufserlebnis-oberstdorf.de Einloggen in den Account Öffnen Sie die Seite http://ihrefirma.tramino.de

Подробнее

Stellvertretenden Genehmiger verwalten. Tipps & Tricks

Stellvertretenden Genehmiger verwalten. Tipps & Tricks Tipps & Tricks INHALT SEITE 1. Grundlegende Informationen 3 2.1 Aktivieren eines Stellvertretenden Genehmigers 4 2.2 Deaktivieren eines Stellvertretenden Genehmigers 11 2 1. Grundlegende Informationen

Подробнее

Internet online Update (Mozilla Firefox)

Internet online Update (Mozilla Firefox) Um Ihr Consoir Beta immer schnell und umkompliziert auf den aktuellsten Stand zu bringen, bieten wir allen Kunden ein Internet Update an. Öffnen Sie Ihren Mozilla Firefox und gehen auf unsere Internetseite:

Подробнее

Wegleitung Internetbestellungen

Wegleitung Internetbestellungen Wegleitung Internetbestellungen Inhalt 1. Internet Bestellung aufgeben... 2 2. Hilfe zur Cash-Funktion... 5 3. Passwort vergessen... 6 4. Passwort und Benutzerdaten ändern... 8 1. Internet Bestellung aufgeben

Подробнее

Microsoft Access 2010 Navigationsformular (Musterlösung)

Microsoft Access 2010 Navigationsformular (Musterlösung) Hochschulrechenzentrum Justus-Liebig-Universität Gießen Microsoft Access 2010 Navigationsformular (Musterlösung) Musterlösung zum Navigationsformular (Access 2010) Seite 1 von 5 Inhaltsverzeichnis Vorbemerkung...

Подробнее

Pflege Ihrer implantatgetragenen Krone

Pflege Ihrer implantatgetragenen Krone Pflege Ihrer implantatgetragenen Krone 1 2 Ästhetik und Funktion Der implantatgetragene Zahnersatz sieht aus und funktioniert wie Ihre natürlichen Zähne. Wie Ihre eigenen Zähne, so muss auch der implan

Подробнее

Whitepaper. Produkt: combit Relationship Manager 7. combit Relationship Manager email-rückläufer Script. combit GmbH Untere Laube 30 78462 Konstanz

Whitepaper. Produkt: combit Relationship Manager 7. combit Relationship Manager email-rückläufer Script. combit GmbH Untere Laube 30 78462 Konstanz combit GmbH Untere Laube 30 78462 Konstanz Whitepaper Produkt: combit Relationship Manager 7 combit Relationship Manager email-rückläufer Script Inhalt Einleitung 3 Notwendige Anpassungen 3 crm Solution

Подробнее

Entwicklung des Dentalmarktes in 2010 und Papier versus Plastik.

Entwicklung des Dentalmarktes in 2010 und Papier versus Plastik. Sehr geehrter Teilnehmer, hier lesen Sie die Ergebnisse aus unserer Umfrage: Entwicklung des Dentalmarktes in 2010 und Papier versus Plastik. Für die zahlreiche Teilnahme an dieser Umfrage bedanken wir

Подробнее

Zugang zum Online-Portal mit Passwort Benutzeranleitung (Stand 01/2015)

Zugang zum Online-Portal mit Passwort Benutzeranleitung (Stand 01/2015) Einleitung Um die Funktionen des Online-Portals BÄV24 nutzen zu können, müssen Sie sich zu Ihrer eigenen Sicherheit zunächst einmalig registrieren. Folgen Sie bitte den Hinweisen im Abschnitt "Registrierung

Подробнее

Einrichtung eines e-mail-konto mit Thunderbird

Einrichtung eines e-mail-konto mit Thunderbird Einrichtung eines e-mail-konto mit Thunderbird In diesem Tutorial zeigen wir Ihnen, wie Sie im Mozilla Thunderbird E-Mailclient ein POP3- Konto einrichten. Wir haben bei der Erstellung des Tutorials die

Подробнее

Bedienungshinweise für das Smartboard. Basisfunktionen

Bedienungshinweise für das Smartboard. Basisfunktionen Bedienungshinweise für das Smartboard Basisfunktionen Im Raum 6A 123 steht für die Lehre ein interaktives Whiteboard (Smartboard) zur Verfügung. Nachstehend werden die einfachsten Basisfunktionen erläutert,

Подробнее

sondern alle Werte gleich behandelt. Wir dürfen aber nicht vergessen, dass Ergebnisse, je länger sie in der Vergangenheit

sondern alle Werte gleich behandelt. Wir dürfen aber nicht vergessen, dass Ergebnisse, je länger sie in der Vergangenheit sondern alle Werte gleich behandelt. Wir dürfen aber nicht vergessen, dass Ergebnisse, je länger sie in der Vergangenheit liegen, an Bedeutung verlieren. Die Mannschaften haben sich verändert. Spieler

Подробнее

Bauteilattribute als Sachdaten anzeigen

Bauteilattribute als Sachdaten anzeigen Mit den speedikon Attributfiltern können Sie die speedikon Attribute eines Bauteils als MicroStation Sachdaten an die Elemente anhängen Inhalte Was ist ein speedikon Attribut?... 3 Eigene Attribute vergeben...

Подробнее

Pixtacy-Anbindung an CleverReach.de

Pixtacy-Anbindung an CleverReach.de Pixtacy-Anbindung an CleverReach.de Stand: 17. Oktober 2014 2014 Virthos Systems GmbH www.pixtacy.de Einleitung Pixtacy verfügt ab Version 2.5 über eine Schnittstelle zu dem Online-Newslettertool CleverReach.de.

Подробнее

Drucken in den Pools

Drucken in den Pools IT-Service-Center http://www.itsc.uni-luebeck.de Es können pro Semester 800 Seiten gedruckt werden. Die Drucker bitte nicht ausschalten! Probleme mit den Druckern bitte immer an die Pool-Betreuer melden.

Подробнее

RUNDE TISCHE /World Cafe. Themen

RUNDE TISCHE /World Cafe. Themen RUNDE TISCHE /World Cafe Themen A. Erfahrungen - Erfolge und Stolpersteine B. Marketing/Kommunikation C. Finanzierung/Förderungen D. Neue Ideen für sanft mobile Angebote/Projekte in der Zukunft A. Erfahrungen

Подробнее

SCHRITT 1: Öffnen des Bildes und Auswahl der Option»Drucken«im Menü»Datei«...2. SCHRITT 2: Angeben des Papierformat im Dialog»Drucklayout«...

SCHRITT 1: Öffnen des Bildes und Auswahl der Option»Drucken«im Menü»Datei«...2. SCHRITT 2: Angeben des Papierformat im Dialog»Drucklayout«... Drucken - Druckformat Frage Wie passt man Bilder beim Drucken an bestimmte Papierformate an? Antwort Das Drucken von Bildern ist mit der Druckfunktion von Capture NX sehr einfach. Hier erklären wir, wie

Подробнее

NODELOCKED LIZENZ generieren (ab ST4)

NODELOCKED LIZENZ generieren (ab ST4) NODELOCKED LIZENZ generieren () Besuchen Sie folgende Webseite support.ugs.com/global/de ( ohne www oder http:// ) Klicken Sie auf Lizenz Verwaltung und dann auf aktuelle Lizenz 1 1. Geben Sie Ihren Webkey

Подробнее

4.1 Wie bediene ich das Webportal?

4.1 Wie bediene ich das Webportal? 4.1 Wie bediene ich das Webportal? Die Bedienung ist durch ein Redaktionssystem sehr einfach möglich. Das Tutorial zeigt Ihnen wie Sie SMS-News und Top-News erstellen und veröffentlichen können. Schritt

Подробнее

EventAvenue: Event planen und unsere Planungshilfen im Detail

EventAvenue: Event planen und unsere Planungshilfen im Detail EventAvenue: Event planen und unsere Planungshilfen im Detail Über LogIn erreichen Sie die Anmelden -Maske. Als Neukunde legen Sie bitte ein neues Kundenkonto an. Sind Sie bereits Kunde melden Sie sich

Подробнее

Anleitung zum Anlegen und Bearbeiten einer News in TYPO3 für www.fk-havelland-mitte.de

Anleitung zum Anlegen und Bearbeiten einer News in TYPO3 für www.fk-havelland-mitte.de WEBandIT.net - Anleitung zum Anlegen und Bearbeiten einer News in TYPO3 für www.fk-havelland-mitte.de Die Internet-Seite wird intern durch das Programm TYPO3 verwaltet. Eine Anmeldung ist nur durch Zugangsdaten

Подробнее

Windows. Workshop Internet-Explorer: Arbeiten mit Favoriten, Teil 1

Windows. Workshop Internet-Explorer: Arbeiten mit Favoriten, Teil 1 Workshop Internet-Explorer: Arbeiten mit Favoriten, Teil 1 Wenn der Name nicht gerade www.buch.de oder www.bmw.de heißt, sind Internetadressen oft schwer zu merken Deshalb ist es sinnvoll, die Adressen

Подробнее

Wie ist das Wissen von Jugendlichen über Verhütungsmethoden?

Wie ist das Wissen von Jugendlichen über Verhütungsmethoden? Forschungsfragen zu Verhütung 1 Forschungsfragen zu Verhütung Wie ist das Wissen von Jugendlichen über Verhütungsmethoden? Wie viel Information über Verhütung ist enthalten? Wie wird das Thema erklärt?

Подробнее

Umzug der Datenbank Firebird auf MS SQL Server

Umzug der Datenbank Firebird auf MS SQL Server Umzug der Datenbank Firebird auf MS SQL Server Umzugsanleitung auf MS SQL Server Im Folgenden wird ein Umzug der julitec CRM Datenbank von Firebird auf MS SQL Server 2008 Express R2 beschrieben. Datensicherung

Подробнее

ERSTE SCHRITTE. info@kalmreuth.de

ERSTE SCHRITTE. info@kalmreuth.de ERSTE SCHRITTE info@kalmreuth.de ZUGRIFF AUF KMS Die Kalmreuth Mail Services können über folgende URLs aufgerufen werden: - http://mail.kalmreuth.de - http://kalmreuth.de/mail - http://kalmreuth.de/webmail

Подробнее

zur Sage New Classic 2015

zur Sage New Classic 2015 Das Aufgabencenter Modul Aufgabencenter (SNC 2015) zur Sage New Classic 2015 Aufgabencenter? Das Aufgabencenter ist ein Softwaremodul welches ihre Daten aus ihrer Sage New Classic Datenbank (oder andere)

Подробнее

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Подробнее

Kompetenzen und Aufgabenbeispiele Englisch Schreiben

Kompetenzen und Aufgabenbeispiele Englisch Schreiben Institut für Bildungsevaluation Assoziiertes Institut der Universität Zürich Kompetenzen und Aufgabenbeispiele Englisch Schreiben Informationen für Lehrpersonen und Eltern 1. Wie sind die Ergebnisse dargestellt?

Подробнее

Tipps & Tricks in CHARLY

Tipps & Tricks in CHARLY Tipps & Tricks in CHARLY September 2011 2 Wussten Sie schon, dass... Sie eine Rechnung, die ans Rechenzentrum übermittelt worden ist, in eine Praxis-Rechnung wandeln können? Wählen Sie im Karteireiter»Rechnung«unter»Rechenzentrum«die

Подробнее

Quartalsabrechnung! " " " " " " " Stufe 1! Beheben von Abrechnungsfehlern" Stufe 2! Neue Abrechnung erstellen"

Quartalsabrechnung!        Stufe 1! Beheben von Abrechnungsfehlern Stufe 2! Neue Abrechnung erstellen tomedo Quartalsabrechnung Seite 1 von 10 Wie erstelle ich die Quartalsabrechnung! Stufe 1! Beheben von Abrechnungsfehlern Stufe 2! Neue Abrechnung erstellen in tomedo? Unser Video-Tutorial finden sie unter

Подробнее

Durch einen Doppelklick (linke Maustaste) wird das Programm gestartet und es erscheint folgender Bildschirm.

Durch einen Doppelklick (linke Maustaste) wird das Programm gestartet und es erscheint folgender Bildschirm. erstellt von Klaus Förderer Picasa Diashow Picasa starten Durch einen Doppelklick (linke Maustaste) wird das Programm gestartet und es erscheint folgender Bildschirm. Achtung: Während dem Erstellen einer

Подробнее

Auswertung JAM! Fragebogen: Deine Meinung ist uns wichtig!

Auswertung JAM! Fragebogen: Deine Meinung ist uns wichtig! Auswertung JAM! Fragebogen: Deine Meinung ist uns wichtig! Im Rahmen des Projekts JAM! Jugendliche als Medienforscher wurden medienbezogene Lernmodule für den Einsatz an Hauptschulen entwickelt und bereits

Подробнее

Benutzerhandbuch - Elterliche Kontrolle

Benutzerhandbuch - Elterliche Kontrolle Benutzerhandbuch - Elterliche Kontrolle Verzeichnis Was ist die mymaga-startseite? 1. erste Anmeldung - Administrator 2. schnittstelle 2.1 Administrator - Hautbildschirm 2.2 Administrator - rechtes Menü

Подробнее

Das Seminar ist eine Prüfungsleistung für Bachelor und Masterstudierende der Informatik!

Das Seminar ist eine Prüfungsleistung für Bachelor und Masterstudierende der Informatik! Das Seminar ist eine Prüfungsleistung für Bachelor und Masterstudierende der Informatik! 1. Eintragung in die Seminarliste via Stud.IP (Bewerbungsverfahren) Die Eintragung in die Seminarliste Ihrer Wahl

Подробнее

Benutzung der LS-Miniscanner

Benutzung der LS-Miniscanner Benutzung der LS-Miniscanner Seit Januar 2010 ist es möglich für bestimmte Vorgänge (Umlagerungen, Retouren, Inventur) die von LS lieferbaren Miniscanner im Format Autoschlüsselgröße zu benutzen. Diese

Подробнее

Der neue persönliche Bereich/die CommSy-Leiste

Der neue persönliche Bereich/die CommSy-Leiste Der neue persönliche Bereich/die CommSy-Leiste Mit der neue CommSy-Version wurde auch der persönliche Bereich umstrukturiert. Sie finden all Ihre persönlichen Dokumente jetzt in Ihrer CommSy-Leiste. Ein

Подробнее

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Подробнее

E-Mails empfangen und versenden mit Apple Mail 3.x

E-Mails empfangen und versenden mit Apple Mail 3.x E-Mails empfangen und versenden mit Apple Mail 3.x Loggen Sie sich bitte in den passwortgeschützten Kundenservicebereich ein und erstellen in der E-Mail-Verwaltung, unter Unterpunkt, ein neues E-Mail-Konto,

Подробнее

1. Einführung. 2. Vorbereiten der Excel-Datei

1. Einführung. 2. Vorbereiten der Excel-Datei 1. Einführung Über den Datenimport-Assistenten im Bereich Verkauf -> Webshop-Bestellungen können Sie nicht nur Ihre Webshop-Bestellungen, sondern allgemein Vorgänge (sprich Aufträge, Lieferscheine oder

Подробнее

Aufgabe 5 Excel 2013 (Fortgeschrittene)

Aufgabe 5 Excel 2013 (Fortgeschrittene) - 1 - Aufgabe 5 Excel 2013 (Fortgeschrittene) 1. Starten Sie Excel und geben die Tabelle Hypothekenanalyse ein. Achten Sie bitte darauf, dass in den Zellen B10 und C11:G21 noch keine Angaben erfolgen.

Подробнее

Streamingserver - Aufzeichnung einer Lehrveranstaltung Ablauf

Streamingserver - Aufzeichnung einer Lehrveranstaltung Ablauf Zentrum für Informationstechnologie und Medien 30. November 2011 Michael Bennett Pädagogische Hochschule Postfach 11 10 62 76060 Karlsruhe Telefon +49 721 925 4746 bennett@ph-karlsruhe.de Streamingserver

Подробнее

Kurz-Anleitung Veranstaltungskalender AHG

Kurz-Anleitung Veranstaltungskalender AHG Babiel GmbH Moskauer Str. 27 40227 Düsseldorf www.babiel.com info@babiel.com Seite: 2 von 17 Inhaltsverzeichnis 1 Einleitung... 3 1.1 Neue Veranstaltungsansicht im Portal... 3 1.2 Neue Veranstaltungsübersicht

Подробнее

Bundesverband Flachglas Großhandel Isolierglasherstellung Veredlung e.v. U g -Werte-Tabellen nach DIN EN 673. Flachglasbranche.

Bundesverband Flachglas Großhandel Isolierglasherstellung Veredlung e.v. U g -Werte-Tabellen nach DIN EN 673. Flachglasbranche. Bundesverband Flachglas Großhandel Isolierglasherstellung Veredlung e.v. U g -Werte-Tabellen nach DIN EN 673 Ug-Werte für die Flachglasbranche Einleitung Die vorliegende Broschüre enthält die Werte für

Подробнее

Anleitung zur Einrichtung von Stellvertretungen in Outlook

Anleitung zur Einrichtung von Stellvertretungen in Outlook IT Sourcing Anleitung zur Einrichtung von Stellvertretungen in Outlook Vertraulichkeit Das vorliegende Dokument beinhaltet vertrauliche Informationen und darf nicht an Dritte weitergereicht werden. Datum

Подробнее

Um unsere Gemeindewebseite für Ihre Zwecke zu nutzen, haben Sie folgende Möglichkeiten:

Um unsere Gemeindewebseite für Ihre Zwecke zu nutzen, haben Sie folgende Möglichkeiten: Nutzen Sie unsere Webseite www.kirchstetten.at Um unsere Gemeindewebseite für Ihre Zwecke zu nutzen, haben Sie folgende Möglichkeiten: Sie können Veranstaltungen selbst auf unserer Webseite veröffentlichen.

Подробнее

Wir machen neue Politik für Baden-Württemberg

Wir machen neue Politik für Baden-Württemberg Wir machen neue Politik für Baden-Württemberg Am 27. März 2011 haben die Menschen in Baden-Württemberg gewählt. Sie wollten eine andere Politik als vorher. Die Menschen haben die GRÜNEN und die SPD in

Подробнее

Anleitung für IQES-Verantwortliche Schulkonto verwalten

Anleitung für IQES-Verantwortliche Schulkonto verwalten Anleitung für IQES-Verantwortliche Schulkonto verwalten Tellstrasse 18 8400 Winterthur Schweiz Telefon +41 52 202 41 25 info@iqesonline.net www.iqesonline.net Anleitung Konto verwalten Seite 2 Inhalt Einstieg

Подробнее

1. Vorbereitung... 1 2. Installation des USB Serial Converter. 1 3. Installation des USB Serial Port. 3 4. Installation des Druckertreibers...

1. Vorbereitung... 1 2. Installation des USB Serial Converter. 1 3. Installation des USB Serial Port. 3 4. Installation des Druckertreibers... Inhalt: 1. Vorbereitung... 1 2. Installation des USB Serial Converter. 1 3. Installation des USB Serial Port. 3 4. Installation des Druckertreibers... 4 1.0 Vorbereitung 1.1 Bitte schliessen sie Ihren

Подробнее

Handbuch ECDL 2003 Basic Modul 6: Präsentation Diagramm auf einer Folie erstellen

Handbuch ECDL 2003 Basic Modul 6: Präsentation Diagramm auf einer Folie erstellen Handbuch ECDL 2003 Basic Modul 6: Präsentation Diagramm auf einer Folie erstellen Dateiname: ecdl6_05_01_documentation_standard.doc Speicherdatum: 14.02.2005 ECDL 2003 Basic Modul 6 Präsentation - Diagramm

Подробнее

Spiel und Spaß im Freien. Arbeitsblat. Arbeitsblatt 1. Zeichnung: Gisela Specht. Diese Vorlage darf für den Unterricht fotokopiert werden.

Spiel und Spaß im Freien. Arbeitsblat. Arbeitsblatt 1. Zeichnung: Gisela Specht. Diese Vorlage darf für den Unterricht fotokopiert werden. Spiel und Spaß im Freien Arbeitsblatt 1 Arbeitsblat 1 Zeichnung: Gisela Specht Arbeitsblatt 1 Was kann man mit diesen Dingen machen? Was passt zusammen? Verbinde die richtigen Bildkarten miteinander. 2

Подробнее

Übungsaufgaben (Wertpapiere der Liquiditätsreserve)

Übungsaufgaben (Wertpapiere der Liquiditätsreserve) Übungsaufgaben (Wertpapiere der Liquiditätsreserve) Aufgabe Die Rhein-Ruhr-Bank AG bewertet die Wertpapiere der Liquiditätsreserve nach den Vorschriften des HGB. Welche der folgenden Aussagen sind in diesem

Подробнее

Anton Ochsenkühn. amac BUCH VERLAG. Ecxel 2016. für Mac. amac-buch Verlag

Anton Ochsenkühn. amac BUCH VERLAG. Ecxel 2016. für Mac. amac-buch Verlag Anton Ochsenkühn amac BUCH VERLAG Ecxel 2016 für Mac amac-buch Verlag 2 Word-Dokumentenkatalog! Zudem können unterhalb von Neu noch Zuletzt verwendet eingeblendet werden. Damit hat der Anwender einen sehr

Подробнее

Zahlenwinkel: Forscherkarte 1. alleine. Zahlenwinkel: Forschertipp 1

Zahlenwinkel: Forscherkarte 1. alleine. Zahlenwinkel: Forschertipp 1 Zahlenwinkel: Forscherkarte 1 alleine Tipp 1 Lege die Ziffern von 1 bis 9 so in den Zahlenwinkel, dass jeder Arm des Zahlenwinkels zusammengezählt das gleiche Ergebnis ergibt! Finde möglichst viele verschiedene

Подробнее

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Подробнее

MORE Profile. Pass- und Lizenzverwaltungssystem. Stand: 19.02.2014 MORE Projects GmbH

MORE Profile. Pass- und Lizenzverwaltungssystem. Stand: 19.02.2014 MORE Projects GmbH MORE Profile Pass- und Lizenzverwaltungssystem erstellt von: Thorsten Schumann erreichbar unter: thorsten.schumann@more-projects.de Stand: MORE Projects GmbH Einführung Die in More Profile integrierte

Подробнее