Abiturprüfung Biologie, Leistungskurs

Größe: px
Ab Seite anzeigen:

Download "Abiturprüfung Biologie, Leistungskurs"

Transkript

1 Seite 1 von 5 Abiturprüfung 2008 Biologie, Leistungskurs Aufgabenstellung: Thema: Das MERRF-Syndrom II.1 Begründen Sie, warum x-chromosomale Vererbung des MERRF-Krankheitsbildes, wie in Material C dargestellt, ausgeschlossen ist und eine autosomal rezessive Vererbung wenig wahrscheinlich ist. Erläutern Sie dies anhand geeigneter Falldarstellungen aus Abbildung 1. (16 Punkte) II.2 Beurteilen Sie, inwieweit eine mitochondriale Vererbung durch das Material A bis D abgesichert erscheint, und erklären Sie das Zustandekommen des Krankheitsbildes. (12 Punkte) II.3 Beschreiben Sie kurz die Vorgänge bei der Translation und gehen Sie dabei besonders auf die Rolle der trna ein. Erläutern Sie unter Bezug auf die in Material E dargestellten Erkenntnisse die molekulargenetische Ursache des MERRF- Krankheitsbildes. (24 Punkte) II.4 Stellen Sie dar, welche Inhalte eine genetische Beratung der Schwestern und Brüder der Mutter des Patienten in Material B anlässlich geäußerter Kinderwünsche haben muss. (14 Punkte) Zugelassene Hilfsmittel: Wörterbuch zur deutschen Rechtschreibung

2 Seite 2 von 5 Material A: MERRF-Syndrom und Mitochondrien Beim MERRF-Syndrom, einer recht seltenen Krankheit, wurde nach seiner Entdeckung eine erbliche Komponente zunächst widersprüchlich diskutiert. MERRF bedeutet: Myoclonic epilepsy associated with ragged-red muscle fibers (Muskelschüttelkrämpfe verbunden mit ausgefransten roten Muskelfasern). Aufgrund der Symptome wurden die Mitochondrien in die Untersuchungen einbezogen. Mitochondrien vermehren sich durch eine vom Zellzyklus unabhängige Teilung, die der Zellteilung von Bakterien sehr ähnlich ist. Tatsächlich fand man Mitochondrien mit eingeschränkter Funktion ( defekte Mitochondrien ) in den Gewebszellen von MERRF-Kranken, daneben allerdings auch vollständig intakte Mitochondrien. Denn bei jeder Zellteilung erfolgt eine zufällige Verteilung der Mitochondrien, so dass in den Tochterzellen intakte und defekte Mitochondrien nebeneinander existieren (Heteroplasmie) oder alle Mitochondrien die gleiche Mutation in ihrer DNA tragen (Homoplasmie). Innerhalb eines Gewebes treten entsprechend gesunde Zellen neben krankhaft veränderten auf. Die Krankheit wird erst dann auffällig, wenn der Heteroplasmiegrad im entsprechenden Gewebe 50 80% beträgt. Material B: Patient mit MERRF-Syndrom (gekürzte Schilderung aus einem Patientenforum) Sven ist heute 6½ Jahre alt und die Diagnosesuche ging los, da war er fast 2 Jahre alt und bis wir die Diagnose hatten, gingen ca. 1½ Jahre ins Land. Bei uns war es auch so, dass die Ärzte die Muskelbiopsie, also die Entnahme und Untersuchung von Muskelzellen aus dem Oberschenkelmuskel erstmal nicht machen wollten, aber letztendlich nicht drum herum kamen.... Sven war leider noch ein Frühchen (Frühgeburt) aus der 27. Schwangerschaftswoche und da wurden viele Auffälligkeiten erstmal auf seine Frühgeburt geschoben. Trotzdem fiel auf, dass sich seine Muskulatur wie Wackelpudding anfühlte und auch sehr wenig Muskelgewebe überhaupt da war. Nach allen Seiten drehen konnte er sich erst mit fast 3 Jahren. Es hieß, er würde nie laufen lernen und nie sprechen lernen. Aber, die Ärzte irrten sich, Gott sei Dank. Er lernte sprechen, viel später, aber das ist egal. Und er lernte sogar das freie Laufen mit fast 5 Jahren. Allerdings hat er eine starke Belastungsintoleranz [...] aufgrund des Energiemangels. Kurze Strecken geht er, und für draußen hat er seinen Rolli. Er hat auch immer wieder sehr schlappe Phasen, wo er fast den ganzen Tag nur liegt.

3 Seite 3 von 5 Material C: Stammbaum einer betroffenen Familie Abb. 1: MERRF-Stammbaum, Merkmalsträger sind schwarz dargestellt. Die Personen 3, 6 und 10 stammen aus Familien, in denen das Krankheitsbild nachweislich nie aufgetreten ist. Material D: Mitochondrien in Eizellen, Spermien und verschiedenen Geweben Jedes Spermium besitzt im Halsteil weniger als 50 Mitochondrien, jede Eizelle im Plasma Tausende. Bei der Befruchtung dringt nur der Kopf des Spermiums in die Eizelle ein. Den höchsten Mitochondriengehalt haben die Gewebe, in denen der Sauerstoffbedarf sehr hoch ist, dazu gehören die Skelettmuskulatur (vor allem Arme und Beine), das Gehirn und das Herz. Mitochondrien besitzen eigene DNA, eigene Ribosomen, eigene Proteine und vermehren sich unabhängig vom Zellzyklus. Abb. 2: Größenvergleich Eizelle/Spermium

4 Seite 4 von 5 Material E: Molekulare Ursachen des MERRF-Krankheitsbildes Abb. 3: Karte der mitochondrialen DNA des Menschen. Dargestellt sind der ringförmige DNA-Strang eines Mitochondriums sowie beispielhaft für einige Bereiche die Position der Basen; so codiert z. B. der Bereich von 648 bis 1601 für die kleine Untereinheit der Ribosomen (12s rrna). Beschriftet sind außerdem Bereiche, die für bestimmte Proteine codieren, z. B. ND für NADH-Dehydrogenase und CO für Cytochrom c-oxidase, beides Enzyme, die an der Energiebereitstellung beteiligt sind. Zusätzlich erkennt man, welche Bereiche in trna transkribiert werden, so steht z. B. K für die trna Lysin und G für die trna Glycin.

5 Seite 5 von 5 Genom: Homo sapiens, Mitochondrium, Positionen normal: CACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGA MERRF: CACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAGCCAACACCTCTTTACAGTGA Abb. 4: Ausschnitt aus der mitochondrialen DNA eines Gesunden und eines an MERRF Erkrankten Prozentzahl vollständiger Proteine (Vergleich mit Gesundem) Dargestellt ist der Prozentsatz vollständiger Proteine in den Mitochondrien eines MERRF-Kranken (verglichen mit einem gesunden Menschen) und zwar in Abhängigkeit von der Anzahl des in den Proteinen vorhandenen Aminosäurebausteins Lysin. Die Kurve stellt einen mathematischen Zusammenhang dar, der hier nicht berücksichtigt werden muss. Anzahl der Lysin-Bausteine im fertigen Protein Abb. 5: Proteine in Mitochondrien eines MERRF-Kranken. Außer den in Abbildung 5 angeführten Proteinen findet man in den Mitochondrien Erkrankter ein sogenanntes MERRF-Protein. Es handelt sich dabei um unvollständige Reste des Proteins COI; auch fand man unvollständige Reste des Proteins ND2 in hoher Konzentration in MERRF-Mitochondrien.

Originalklausur mit Musterlösung

Originalklausur mit Musterlösung Originalklausur mit Musterlösung Abitur Biologie Aufgabe I: Aufgabe II: Aufgabe III: Homo sapiens / Neandertaler MERFF-Syndrom Lebensgemeinschaft Ameisen / Ameisenpflanzen In den Aufgabenstellungen werden

Mehr

Ministerium für Schule und Weiterbildung NRW BI LK HT 2 Seite 1 von 8. Unterlagen für die Lehrkraft. Abiturprüfung 2008. Biologie, Leistungskurs

Ministerium für Schule und Weiterbildung NRW BI LK HT 2 Seite 1 von 8. Unterlagen für die Lehrkraft. Abiturprüfung 2008. Biologie, Leistungskurs Seite 1 von 8 Unterlagen für die Lehrkraft Abiturprüfung 2008 Biologie, Leistungskurs 1. Aufgabenart Aufgaben mit Untersuchungs- und Erhebungsdaten und/oder Texten 2. Aufgabenstellung Thema: Das MERRF-Syndrom

Mehr

3.2. Welche Folgen hätte der Verlust einer Guaninbase im dargestellten codogenen Strang:... G G A C T T C T T..? Begründen Sie!

3.2. Welche Folgen hätte der Verlust einer Guaninbase im dargestellten codogenen Strang:... G G A C T T C T T..? Begründen Sie! Kurs: MOK und Externe Hilfsmittel: keine Aufgaben: Die Klausur besteht aus einem Zentralthema ( Bewertungsanteil 50 %) und vier Wahlthemen (Bewertungsanteile je 25 %), von denen je zwei zu bearbeiten sind.

Mehr

Grundkurs Biologie. Aufgabenbeispiel für den B-Teil

Grundkurs Biologie. Aufgabenbeispiel für den B-Teil Aufgabenbeispiel für den B-Teil Nahrungsmittel-Unverträglichkeiten treten in verschiedener Häufigkeiten und Formen auf. Sie können auch ganz unterschiedliche Ursachen haben. An einer genetisch verursachten

Mehr

Evolution und Entwicklung

Evolution und Entwicklung Evolution und Entwicklung Wie aus einzelnen Zellen die Menschen wurden: Phylogenese Klassische Genetik: Mendel Moderne Genetik: Watson & Crick Wie aus einer einzigen Zelle ein Mensch wird: Ontogenese Vererbung

Mehr

Biologie für Mediziner

Biologie für Mediziner Biologie für Mediziner - Zellbiologie 1 - Prof. Dr. Reiner Peters Institut für Medizinische Physik und Biophysik/CeNTech Robert-Koch-Strasse 31 Tel. 0251-835 6933, petersr@uni-muenster.de Dr. Martin Kahms

Mehr

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie)

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) Als Erbkrankheit werden Erkrankungen und Besonderheiten bezeichnet, die entweder durch ein Gen (monogen)

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Zellzyklus G 1 Phase: postmitotische Phase oder Präsynthesephase Zelle beginnt wieder zu wachsen

Mehr

Gendefekte und Krankheiten. Frequenz monogener Erkrankungen: ~ 1%

Gendefekte und Krankheiten. Frequenz monogener Erkrankungen: ~ 1% endefekte und Krankheiten Frequenz monoener Erkrankunen: ~ 1% Katalo Mendelscher Krankheiten: > 6000 Einträe (OMIM TM : Online Mendelian Inheritance in Man) Mutationen in >2000 enen (monoene Erkrankunen)

Mehr

Einstieg: Fortpflanzung

Einstieg: Fortpflanzung Einstieg: Fortpflanzung Wozu ist Sex gut? - Nachkommen werden gezeugt --> Erhalt der Spezies. - Es entstehen Nachkommen mit Merkmalen (z.b. Aussehen), die denen von Vater und Mutter ähneln. Beide Eltern

Mehr

9.) Wie heißen die kurzen RNA-Moleküle, mit deren Hilfe die Polymerase die Replikation der DNA starten kann? a) Starter b) Primer c) Beginner

9.) Wie heißen die kurzen RNA-Moleküle, mit deren Hilfe die Polymerase die Replikation der DNA starten kann? a) Starter b) Primer c) Beginner Lernkontrolle M o d u l 1 A w i e... A n k r e u z e n! 1.) Wie viele Chromosomen besitzt eine menschliche Körperzelle? a) 23 b) 46 c) 44 2.) In welchem Zellorganell befindet sich die DNA? a) Zellkern

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

GENETIK. für Studierende. Michaela Aubele. für Ahnungslose. Eine Einstiegshilfe. 2. Auflage. Dr. Michaela Aubele, München.

GENETIK. für Studierende. Michaela Aubele. für Ahnungslose. Eine Einstiegshilfe. 2. Auflage. Dr. Michaela Aubele, München. Michaela Aubele GENETIK für Ahnungslose Eine Einstiegshilfe für Studierende 2. Auflage von Prof. Dr. Michaela Aubele, München Mit 52 Abbildungen und 33 Tabellen S. Hirzel Verlag die VII Vorwort V Kurzer

Mehr

Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung

Mehr

Abiturprüfung Biologie, Grundkurs

Abiturprüfung Biologie, Grundkurs Seite 1 von 5 Abiturprüfung 2009 Biologie, Grundkurs Aufgabenstellung: Thema: Parasiten als Indikatoren der Primaten-Evolution I.1 Begründen Sie, warum der Vergleich von Aminosäure-Sequenzen und Basen-Sequenzen

Mehr

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist.

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist. Die Prüfungsarbeit besteht aus drei zu bearbeitenden Teilen Aufgabe I Aufgabe II A oder II B Aufgabe III A oder III B I Aufgabe I: Humangenetik / klassische Genetik / Molekulargenetik Mukoviszidose Mukoviszidose,

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Regeln zur Vererbung Autosomal rezessiv: - Merkmal tritt auf in Nachkommen nicht betroffener Eltern

Mehr

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten.

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Wie bezeichnet man den Strang der DNA- Doppelhelix, der die

Mehr

Ministerium für Schule und Weiterbildung NRW BI GK HT 2 Seite 1 von 7. Unterlagen für die Lehrkraft. Abiturprüfung Biologie, Grundkurs

Ministerium für Schule und Weiterbildung NRW BI GK HT 2 Seite 1 von 7. Unterlagen für die Lehrkraft. Abiturprüfung Biologie, Grundkurs Seite 1 von 7 Unterlagen für die Lehrkraft Abiturprüfung 2008 Biologie, Grundkurs 1. Aufgabenart Bearbeitung fachspezifischen Materials mit neuem Informationsgehalt 2. Aufgabenstellung Thema: Ein Krankheitsbild

Mehr

Hilfe 1. Wissenschaft. Traditionen und. Hilfe 1

Hilfe 1. Wissenschaft. Traditionen und. Hilfe 1 Hilfe 1 Hilfe 1 Erklärt euch gegenseitig die Aufgabe noch einmal in euren eigenen Worten. Klärt dabei, wie ihr die Aufgabe verstanden habt und was euch noch unklar ist. Antwort 1 Wir sollen einen Stammbaum

Mehr

Abiturprüfung Biologie, Grundkurs

Abiturprüfung Biologie, Grundkurs Seite 1 von 6 biturprüfung 2008 Biologie, rundkurs ufgabenstellung: Thema: Ein Krankheitsbild unterschiedliche rsachen II.1 Werten Sie die Materialien und B hinsichtlich der Risikofaktoren für Diabetes

Mehr

FAZIOSKAPULO- HUMERALE MUSKEL- DYSTROPHIE

FAZIOSKAPULO- HUMERALE MUSKEL- DYSTROPHIE DGM INFO FAZIOSKAPULO- HUMERALE MUSKEL- DYSTROPHIE DGM Deutsche Gesellschaft für Muskelkranke e.v. 2 3 Die fazioskapulohumerale Muskeldystrophie (FSHD) Die fazioskapulohumerale Muskeldystrophie (FSHD)

Mehr

Mitochondriale Erkrankungen

Mitochondriale Erkrankungen W I S S E N S W E R T E S Mitochondriale Erkrankungen DGM Deutsche Gesellschaft für Muskelkranke e.v. 2 DGM Diagnosegruppe Mitochondriale Erkrankungen Mito Diagnosegruppe in der DGM e.v. Im Moos 4 79112

Mehr

Grundlagen. Chromosom. Jedes Lebewesen besteht aus Zellen bestehen aus DNA. menschliches Genom DNA

Grundlagen.  Chromosom. Jedes Lebewesen besteht aus Zellen bestehen aus DNA. menschliches Genom DNA Grundlagen Chromosom Jedes Lebewesen besteht aus Zellen 2. Chromosomen bestehen aus DNA menschliches Genom DNA Bakterium Pflanzenzelle Muskelzelle Nervenzelle Zellleib Zellkern 1. Die Gene befinden sich

Mehr

Stammbaumanalyse und Vererbungsmuster

Stammbaumanalyse und Vererbungsmuster Stammbaumanalyse und Vererbungsmuster Bei den meisten Tieren und Pflanzen lässt sich der eines Merkmals in der Regel zweifelsfrei durch mehr oder weniger umfangreiche Kreuzungsexperimente erheben. Bei

Mehr

Autosomal-rezessiver Erbgang

Autosomal-rezessiver Erbgang 12 Autosomal-rezessiver Erbgang Bearbeitetes Informationsblatt herausgegeben vom Guy s and St. Thomas Hospital, London und dem London IDEAS Genetic Knowledge Park, entsprechend deren Qualitätsstandards.

Mehr

BI BIL E GK?? 1 BI GK HT 2 Seite 1 von 5. Abiturprüfung Biologie, Grundkurs

BI BIL E GK?? 1 BI GK HT 2 Seite 1 von 5. Abiturprüfung Biologie, Grundkurs Seite 1 von 5 biturprüfung 2009 Biologie, rundkurs ufgabenstellung: Thema: endiagnostik am Beispiel von Faktor-V-Leiden II.1 Erläutern Sie anhand von Material und Material D, welche Mutation auf dem codogenen

Mehr

3.5 Moderne Genetik - Vorgänge

3.5 Moderne Genetik - Vorgänge 3.5 Moderne Genetik - Vorgänge Der genetische Code Jedes Gen besteht aus sogenannten Basentriplets. Das ist eine Sequenz von drei aufeinanderfolgenden Nukleinbasen, die für eine bestimmte Aminosäure stehen.

Mehr

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Einführung in die Grundlagen der Genetik Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Molekularbiologische Grundlagen Die Zelle ist die grundlegende, strukturelle und funktionelle

Mehr

Chromosomen & Populationsgenetik (1)

Chromosomen & Populationsgenetik (1) Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: 1 Karyogramme Chromosomen & Populationsgenetik (1) Bestimmen Sie den Karyotyp der folgenden

Mehr

auf den Lösungsbogen.

auf den Lösungsbogen. Test-Fragen für die Klausur Humangenetik Test-Fragen für die Klausur Humangenetik Es folgen 9 Fragen und der Lösungsbogen (blanko). Sie haben 13,5 min Zeit zum Beantworten der Fragen und zum Übertragen

Mehr

Gendefekt löst schwere kindliche Gehirnerkrankung aus

Gendefekt löst schwere kindliche Gehirnerkrankung aus Wenn der Zelle die nötige Energie fehlt Gendefekt löst schwere kindliche Gehirnerkrankung aus München (22. Juni 2009) - Eine besonders schwer verlaufende Variante der kindlichen Leukenzephalopathie wird

Mehr

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren

Mehr

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird Molekularbiologie 6c Proteinbiosynthese Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird 1 Übersicht: Vom Gen zum Protein 1. 2. 3. 2 Das Dogma

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

1. Mendelsche Vererbung, Stammbäume:

1. Mendelsche Vererbung, Stammbäume: 1. Mendelsche Vererbung, Stammbäume: typische Stammbäume atypische Stammbäume 2. Allelische und nicht-allelische Mutationen, Komplementationstests 3. Hardy-Weinberg Gleichgewicht 4. Mutation und Selektion,

Mehr

FACH: BIOLOGIE JAHRGANG: 11

FACH: BIOLOGIE JAHRGANG: 11 ca. 6 Wochen Folge der Einheiten Dauer der Einheit (ca.) 1 Thema: Zellen Tier-/Pflanzenzelle Biomembran Zelldifferenzierung Prokaryot/Eukaryot Diffusion/Osmose vergleichen komplexe Vorgänge auf zellulärer

Mehr

Übungen zur Vorlesung Molekularbiologische Datenbanken. Lösungsblatt 1: Datenbanksuche

Übungen zur Vorlesung Molekularbiologische Datenbanken. Lösungsblatt 1: Datenbanksuche Wissensmanagement in der Bioinformatik Prof. Dr. Ulf Leser, Silke Trißl Übungen zur Vorlesung Molekularbiologische Datenbanken Lösungsblatt 1: Datenbanksuche Symptome 1.Ein Kind kommt in die Praxis und

Mehr

Grundkurs Q 1: Inhaltsfeld: IF 3 (Genetik)

Grundkurs Q 1: Inhaltsfeld: IF 3 (Genetik) Grundkurs Q 1: Inhaltsfeld: IF 3 (Genetik) Unterrichtsvorhaben I: Humangenetische Beratung Warum sehe ich eigentlich meinen Eltern (nicht) ähnlich? Klassische und molekulare Genetik Unterrichtsvorhaben

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

Box. Biologie. Vom Genotyp zum Phänotyp und die gentechnische Anwendung

Box. Biologie. Vom Genotyp zum Phänotyp und die gentechnische Anwendung Box Biologie Schülerarbeitsbuch Einführungsphase 2. Halbjahr A G A Niedersachsen T C T Vom Genotyp zum Phänotyp und die gentechnische Anwendung Vom Genotyp zum Phänotyp: Proteinbiosynthese Gentechnische

Mehr

Bestehend aus Gehirn und Rückenmark. Bestehend aus den Gegenspielern (Antagonisten) Sympathikus und Parasympathikus;

Bestehend aus Gehirn und Rückenmark. Bestehend aus den Gegenspielern (Antagonisten) Sympathikus und Parasympathikus; Neuron 9 1 9 1 kleinstes Bauelement des ZNS dient der Aufnahme, gerichteten Weiterleitung und Verarbeitung von Informationen Bestandteile: Dendriten, Soma, Axon, Endknöpfchen 9 2 9 2 Zentrales Nervensystem

Mehr

erläutern Eigenschaften des genetischen Codes und charakterisieren mit dessen Hilfe Experimentelle Entschlüsselung (SF)

erläutern Eigenschaften des genetischen Codes und charakterisieren mit dessen Hilfe Experimentelle Entschlüsselung (SF) Schulinterner Kernlehrplan Biologie Q1 : Genetik Inhaltsfelder Schwerpunkt Basiskonzept Konkretisierte Kompetenzen 1.1 Vom Gen zum Genprodukt Wiederholung - DNA und Replikation Aufgaben DNA und Replikation

Mehr

Wie erblich sind Epilepsien?

Wie erblich sind Epilepsien? Wie erblich sind Epilepsien? Häufigkeit Epilepsie in Bevölkerung 5% erleiden ein Mal einen epileptischen Anfall 1% erkranken an Epilepsie Folie 2 Folie 3 3-5 % Epidemiologische Studie 1989 Rochester, Minnesota,

Mehr

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie Grundwissenkarten Gymnasium Vilsbisburg 9. Klasse Biologie Es sind insgesamt 10 Karten für die 9. Klasse erarbeitet. davon : Karten ausschneiden : Es ist auf der linken Blattseite die Vorderseite mit Frage/Aufgabe,

Mehr

Mein Buch des Lebens: Ein Mensch entsteht. Wörtersalat:

Mein Buch des Lebens: Ein Mensch entsteht. Wörtersalat: Arbeitsblatt 1 zur Sendung 40 Wochen Von der Keimzelle zum Kind im SWR Fernsehen Stammnummer 4685036 MEIN BUCH DES LEBENS EIN MENSCH ENTSTEHT (1): DECKBLATT UND WÖRTERSALAT Aus einer weiblichen Eizelle

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Die gentechnische Produktion von Insulin - Selbstlerneinheit zur kontextorientierten Wiederholung der molekularen Genetik Das komplette

Mehr

Markl Biologie. Synopse zum Markl Biologie Schülerbuch und Markl Biologie Arbeitsbuch zur Einführungsphase Oberstufe in Niedersachsen

Markl Biologie. Synopse zum Markl Biologie Schülerbuch und Markl Biologie Arbeitsbuch zur Einführungsphase Oberstufe in Niedersachsen Niedersachsen / Einführungsphase Markl Biologie Synopse zum Markl Biologie Schülerbuch und Markl Biologie Arbeitsbuch zur Einführungsphase Oberstufe in Niedersachsen Schülerbuch 978-3-12-150010-9 Arbeitsbuch

Mehr

In unseren Beispielen bilden Valeria und Arnold ein theoretisches Paar - und geben wir zu, ein Paar das viel Pech im Leben hat das selber und auch

In unseren Beispielen bilden Valeria und Arnold ein theoretisches Paar - und geben wir zu, ein Paar das viel Pech im Leben hat das selber und auch In unseren Beispielen bilden Valeria und Arnold ein theoretisches Paar - und geben wir zu, ein Paar das viel Pech im Leben hat das selber und auch Ihre Familien an zahlreichen genetischen Krankheiten leiden.

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Wie entstehen Erbkrankheiten? Das komplette Material finden Sie hier:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Wie entstehen Erbkrankheiten? Das komplette Material finden Sie hier: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Das komplette Material finden Sie hier: School-Scout.de RAAbits Hauptschule 7 9 Naturwissenschaften 68 Erbkrankheiten 1 von 10 Tanja

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte

Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Frage 1: 10 Punkte a) Die Bildung der Gameten bei Diplonten und bei Haplonten erfolgt im Verlaufe von Kernteilungen. Ergänzen Sie die angefangenen Sätze (2

Mehr

P1 Grundlagen der Pathologie. Inhalt. Gesundheit und Krankheit. Terminologie. Krankheitsursachen. Krankheitsverlauf. Ausgang und Folgen der Krankheit

P1 Grundlagen der Pathologie. Inhalt. Gesundheit und Krankheit. Terminologie. Krankheitsursachen. Krankheitsverlauf. Ausgang und Folgen der Krankheit Inhalt Gesundheit und Krankheit Terminologie Krankheitsursachen Krankheitsverlauf Ausgang und Folgen der Krankheit Krankheitsbehandlung Altern und Tod Klinische Untersuchung des Patienten Lernziele Die

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Chromosom enthält DNA besteht aus Nucleotiden bestehen aus Phosphat und Basen sind Adenin, Guanin, Cytosin, Thymin

Chromosom enthält DNA besteht aus Nucleotiden bestehen aus Phosphat und Basen sind Adenin, Guanin, Cytosin, Thymin 2 Molekulargenetik Natura Genetik 2 Molekulargenetik Lösungen zu den Aufgaben Seiten 20 21 2.1 DNA ist das genetische Material 1 Stelle in einem Begriffsnetz den Zusammenhang zwischen folgenden Begriffen

Mehr

Proteinbiosynthese: Transkripion:

Proteinbiosynthese: Transkripion: Proteinbiosynthese: - Basensequenz der DNA wird in die Basensequenz der RNA übersetzt (Transkription) - Übersetzen der mrna in die spezifische Aminosäuresequenz (Translation) - Bei Eukaryoten sind Transkription

Mehr

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Fallkonferenz Schwerpunkt Humangenetik Genetische Beratung Genetische Beratung ist ein Kommunikationsprozess, der

Mehr

ZUSAMMENFASSUNG EINFÜHRUNG BIOLOGIE. Zusammenfassung für die Biologie-Prüfung vom

ZUSAMMENFASSUNG EINFÜHRUNG BIOLOGIE. Zusammenfassung für die Biologie-Prüfung vom ZUSAMMENFASSUNG EINFÜHRUNG BIOLOGIE Zusammenfassung für die Biologie-Prüfung vom 20.11.2017 Exposee Zusammenfassung für die Biologie-Prüfung vom 20.11.2017 über die Einführung in die Biologie. RaviAnand

Mehr

Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2

Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2 Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis 1. Übersicht über die Unterrichtsveranstaltungen... 2 1.1. Vorlesung... 2 1.2. Seminar/Praktikum... 5 2. Beschreibung der Unterrichtsveranstaltungen...

Mehr

Tier- & Pflanzenzelle

Tier- & Pflanzenzelle B301 CYTOLOGIE: Tier- & Pflanzenzelle 1. Vergleichen Sie die hier dargestellten Strukturen. Welche Zelle ist eine pflanzliche, welche eine tierische Zelle? Zelle Zelle a) b) c) d) e) f) g) h) i) j) k)

Mehr

speziell eine Mitochondriale Stoffwechselerkrankung.

speziell eine Mitochondriale Stoffwechselerkrankung. Mitochondriale Stoffwechselerkrankung von Jacqueline Bosch, Whirlwind of Shadows, NL http://www.wosshelties.nl - 42 - Epilepsie ist unter Sheltie Eigentümern in den Niederlanden ein Thema. Oft wird das

Mehr

Über die Autorinnen 7. Einführung 19. Teil I Grundlagen der Biologie 25. Kapitel 1 Die Erforschung der belebten Welt 27

Über die Autorinnen 7. Einführung 19. Teil I Grundlagen der Biologie 25. Kapitel 1 Die Erforschung der belebten Welt 27 Über die Autorinnen 7 Einführung 19 Über dieses Buch 19 Konventionen in diesem Buch 19 Was Sie nicht lesen müssen 20 Törichte Annahmen über den Leser 20 Wie dieses Buch aufgebaut ist 21 Teil I: Grundlagen

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Sinnvoller Umgang mit DNA-Tests

Sinnvoller Umgang mit DNA-Tests Sinnvoller Umgang mit DNA-Tests - Eine Zuchtmethode - - Kleine Hundepopulation - Helga Eichelberg Welpenstatistik Eingetragene Welpen 2006 2005 2004 Pinscher 384 237 246 ca. 80 Würfe Zwerge 197 250 251

Mehr

Genaktivierung und Genexpression

Genaktivierung und Genexpression Genaktivierung und Genexpression Unter Genexpression versteht man ganz allgemein die Ausprägung des Genotyps zum Phänotyp einer Zelle oder eines ganzen Organismus. Genotyp: Gesamtheit der Informationen

Mehr

PGD. Genetische Präimplantationsdiagnostik von monogenetischen Krankheiten und strukturellen Chromosomenanomalien

PGD. Genetische Präimplantationsdiagnostik von monogenetischen Krankheiten und strukturellen Chromosomenanomalien PGD Genetische Präimplantationsdiagnostik von monogenetischen Krankheiten und strukturellen Chromosomenanomalien V01/DEZ16 ProCreaLab ist ein Unternehmen von labormedizinisches zentrum Dr Risch ProCreaLab

Mehr

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name Starzinski-Powitz, 6 Fragen, 53 Punkte Name Frage 1 8 Punkte Nennen Sie 2 Möglichkeiten, wie der Verlust von Heterozygotie bei Tumorsuppressorgenen (Z.B. dem Retinoblastomgen) zum klompletten Funktionsverlust

Mehr

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten!

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten! Genomics Herausforderungen und Chancen Prinzipien dominieren über Detail-Fluten Genomics in 10 Minuten! biol. Prin cip les Genomic data Dr.Thomas WERNER Scientific & Business Consulting +49 89 81889252

Mehr

ALS = Amyotrophe Lateralsklerose

ALS = Amyotrophe Lateralsklerose ALS = Amyotrophe Lateralsklerose Themenüberblick Fallbeispiel Zahlen und Fakten Einführung ins Thema Lage der Motoneuronen Formen und Ursachen von ALS Klinischer Verlauf Fallbeispiel Stephen William Hawking

Mehr

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird..

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird.. Proteinbiosynthese Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Alle Proteine, sind über die DNA codiert Wobei jeweils eine AS von 3 Basen codiert wird.. GENETISCHER CODE

Mehr

Brustkrebs. Genetische Ursachen, erhöhte Risiken. Informationen über familiär bedingten Brust- & Eierstockkrebs

Brustkrebs. Genetische Ursachen, erhöhte Risiken. Informationen über familiär bedingten Brust- & Eierstockkrebs Brustkrebs Genetische Ursachen, erhöhte Risiken Informationen über familiär bedingten Brust- & Eierstockkrebs Gibt es Brustkrebs-Gene? Brustkrebs: Wie und wo er entsteht Wenn bei der Zellteilung ein Fehler

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

Pharmazeutische Biologie Grundlagen der Biochemie

Pharmazeutische Biologie Grundlagen der Biochemie Pharmazeutische Biologie Grundlagen der Biochemie Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.de Empfohlene Literatur Empfohlene

Mehr

Fragiles X in der Familie: Vererbung, FXS, FXTAS, FXPOI. Andreas Dufke, Version PDF

Fragiles X in der Familie: Vererbung, FXS, FXTAS, FXPOI. Andreas Dufke, Version PDF Fragiles X in der Familie: Vererbung, FXS, FXTAS, FXPOI Andreas Dufke, 04.10.2014 Version PDF J Neurol Psychiatry-1943-Martin-154-7 Vererbung Geschlechtsgebundene Vererbung Was sind die Besonderheiten

Mehr

Modell für rezessive Epistasie

Modell für rezessive Epistasie Modell für rezessive Epistasie Selbsten Beide Enzyme aktiv Figure 6-19 Enzym 2 defekt Enzym 1 defekt Kein Substrat Block am ersten Enzym Aufspaltung der F2 in 9:4:3 Suppression Beispiel Hefe a ts Stirbt

Mehr

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden

Mehr

Jahrgangsstufe 9. Inhaltsfeld Individualentwicklung des Menschen. Unterrichtsverlauf Inhalte Fortpflanzung, Entwicklung und Geburt (s.

Jahrgangsstufe 9. Inhaltsfeld Individualentwicklung des Menschen. Unterrichtsverlauf Inhalte Fortpflanzung, Entwicklung und Geburt (s. Jahrgangsstufe 9 Inhaltsfeld Individualentwicklung des Menschen Fortpflanzung, Entwicklung und Geburt (s. Sexualkunde) Grundlagen gesundheitsbewusster Ernährung Bau und Funktion der Niere Bedeutung der

Mehr

Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende

Mehr

Diese Kombination von multiplen Geburtsfehlern ist relativ häufig (ca. 1/ 8500 Neugeborene). Selten zeigen Betroffene eine normale Intelligenz.

Diese Kombination von multiplen Geburtsfehlern ist relativ häufig (ca. 1/ 8500 Neugeborene). Selten zeigen Betroffene eine normale Intelligenz. Praxis für Humangenetik Heinrich-von-Stephan-Str. 5 D-79100 Freiburg Information CHARGE-Syndrom Molekulargenetische Untersuchung des Gens CHD7 Praxis für Humangenetik Prof. Dr. med. Jürgen Kohlhase Facharzt

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation

Mehr

Inhalt. Vorwort I. Medizinisch-naturwissenschaftliche Aspekte der Präimplantationsdiagnostik Verena Steinke, Nils Rahner

Inhalt. Vorwort I. Medizinisch-naturwissenschaftliche Aspekte der Präimplantationsdiagnostik Verena Steinke, Nils Rahner Vorwort............................... 11 I. Medizinisch-naturwissenschaftliche Aspekte der Präimplantationsdiagnostik................. 13 Verena Steinke, Nils Rahner 1. Humangenetische Grundlagen.................

Mehr

Bsp.: Trisomie 21 (früher: Mongolismus, heute: DOWN-Syndrom)

Bsp.: Trisomie 21 (früher: Mongolismus, heute: DOWN-Syndrom) 3.3.4.5 Genommutationen Def.: Mutation = durch einen Verursacher hervorgerufene oder spontane Veränderung im Erbgut, die an die Nachkommen weiter gegeben wird. Mutationen können einzelne Gene betreffen,

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

MGZ ERBLICHER DIABETES. Medizinisch Genetisches Zentrum. Arztinformation

MGZ ERBLICHER DIABETES. Medizinisch Genetisches Zentrum. Arztinformation MGZ Medizinisch Genetisches Zentrum Arztinformation 1 ERBLICHER DIABETES 3 LEITSYMPTOM: DIABETES MIT ERSTMANIFESTATION UNTER DEM 45. LEBENSJAHR 1 Genetische Differentialdiagnose Es gibt eine große Anzahl

Mehr

Abiturprüfung Physik, Leistungskurs. Aufgabe: Anregung von Vanadium und Silber durch Neutronen

Abiturprüfung Physik, Leistungskurs. Aufgabe: Anregung von Vanadium und Silber durch Neutronen Seite 1 von 6 Abiturprüfung 2013 Physik, Leistungskurs Aufgabenstellung: Aufgabe: Anregung von Vanadium und Silber durch Neutronen Vanadium besteht in der Natur zu 99,75 % aus dem stabilen Isotop 51 23

Mehr

Zytologie, Zellteilung

Zytologie, Zellteilung Biologie Zytologie, Zellteilung Zusammenfassungen Semesterprüfung Freitag, 17. Juni 2016 Zellbau Zelldifferenzierung Zellteilung (Zellzyklus, Mitose, Meiose) Marisa DESIGN + LAYOUT Steffi BIOLOGIE Zellbiologie

Mehr

Inhaltsverzeichnis VORWORT

Inhaltsverzeichnis VORWORT Inhaltsverzeichnis VORWORT Bis zum Jahr 1922 waren Typ-1-Diabetiker zum Tode verurteilt. Doch schon ein Jahr später konnten Zuckerkranke auf ein langes, erfülltes und produktives Leben hoffen. Gemeinsam

Mehr

Teil I Grundlagen der Zell- und Molekularbiologie

Teil I Grundlagen der Zell- und Molekularbiologie Teil I Grundlagen der Zell- und Molekularbiologie Molekulare Biotechnologie: Konzepte, Methoden und Anwendungen, 2. Aufl. Herausgegeben von Michael Wink Copyright 2011 WILEY-VCH Verlag GmbH & Co. KGaA,

Mehr

Illustrierende Prüfungsaufgabe zum LehrplanPLUS. Gymnasium, Natur und Technik (Schwerpunkt Biologie), Jahrgangsstufe 5. Verdauung

Illustrierende Prüfungsaufgabe zum LehrplanPLUS. Gymnasium, Natur und Technik (Schwerpunkt Biologie), Jahrgangsstufe 5. Verdauung Verdauung Fach Natur und Technik (Schwerpunkt Biologie) Jahrgangsstufe 5 Prüfungsart Zeitrahmen Benötigte Materialien / zugelassene Hilfsmittel Stegreifaufgabe 20 Minuten --- Aufgabenstellung 1. Das folgende

Mehr

Es gibt Risikogruppen, die vor einer Schwangerschaft eine Beratung in Anspruch nehmen sollten:

Es gibt Risikogruppen, die vor einer Schwangerschaft eine Beratung in Anspruch nehmen sollten: .. Genetische Familienberatung Es gibt Risikogruppen, die vor einer Schwangerschaft eine Beratung in Anspruch nehmen sollten: - Träger einer Erbkrankheit - Verwandte von Trägern einer Erbkrankheit - Eltern

Mehr

Schulinternes Curriculum für das Fach Biologie (Ne, Ha, We) IGS Winsen-Roydorf (Februar 2017) Arbeitsplan für die Einführungsphase.

Schulinternes Curriculum für das Fach Biologie (Ne, Ha, We) IGS Winsen-Roydorf (Februar 2017) Arbeitsplan für die Einführungsphase. Arbeitsplan für die Einführungsphase Biologie Grundlage des Schulcurriculums ist das Kerncurriculum für die Gymnasiale Oberstufe in Niedersachsen - Stand 2009 Hinweis: Schwerpunktthemen und EPA s beachten

Mehr

"Chromosomen Didac 2" Einzelsatz Best.- Nr / Paket von 6 Sätzen

Chromosomen Didac 2 Einzelsatz Best.- Nr / Paket von 6 Sätzen "Chromosomen Didac 2" Einzelsatz Best.- Nr. 2013336 / 2013337 Paket von 6 Sätzen Zusammensetzung Der Einzelsatz besteht aus: 2 blauen Sätzen mit 3 Chromosomen + 1 Geschlechtschromosom + 1 Stück von einem

Mehr

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1 S 1 Gendefekte und Gentherapie Klausurarbeit Name: Datum: I Aufgabenteil Aufgabe 1 a) Lesen Sie sich die Informationen über die Ursache der Krankheit Mukoviszidose im Teil I des Materialteils genau durch.

Mehr

Markl Biologie 2 für Gymnasien in Niedersachsen Stoffverteilungsplan (G9), Jg. 9/

Markl Biologie 2 für Gymnasien in Niedersachsen Stoffverteilungsplan (G9), Jg. 9/ Markl Biologie für Gymnasien in Niedersachsen Stoffverteilungsplan (G9), Jg. 9/0 978---5000-7 Die Konzepte im Schülerbuch Markl Biologie sind exemplarisch den im Kerncurriculum für das Gymnasium (Schuljahrgänge

Mehr

Mitochondriale Erkrankungen

Mitochondriale Erkrankungen Humangenetik: 7. Stunde I. Die Mitochondrien und ihr Genom Mitochondriale Erkrankungen II. Mutationen im Mitochondrien-Genom des Menschen Kearns-Sayre-Syndrom (KSS) Mitochondriale Enzephalomyopathie, Laktat-Azidose

Mehr