Klinische Symptomatik kongenitaler Myopathien

Größe: px
Ab Seite anzeigen:

Download "Klinische Symptomatik kongenitaler Myopathien"

Transkript

1 Klinische Symptomatik kongenitaler Myopathien Folie 1 1 Heike Kölbel und Ulrike Schara Neuropädiatrie, Entwicklungsneurologie und Sozialpädiatrie Zentrum für Kinder- und Jugendheilkunde, Universitätsklinikum Essen

2 Kongenitale (Struktur-) Myopathien Definition Kongenitale (Struktur-)Myopathien bezeichnen eine seltene heterogene Erkrankungsgruppe mit einer geschätzten Inzidenz von 6: Die Einteilung erfolgt bisher nach histologischen, ultrastrukturellen und molekulargenetischen Gesichtspunkten. Erste Symptome können schon intrauterin auftreten, überwiegend manifestieren sie sich ab Geburt in den ersten Lebensjahren; spätere Manifestationen sind auch berichtet. Folie 2 2

3 Kongenitale (Struktur-) Myopathien Anamnese Intrauterine Entwicklung, Geburt (vermehrt peripartale Asphyxie, FG) Neugeborenenphase: Floppy infant, bulbäre Symptome, respiratorische Probleme Späteres Manifestationsalter: motorische und mentale Entwicklung, Muskelschwäche, eingeschränkte Belastbarkeit, Progredienz Familienanamnese Weitere betroffene Familienmitglieder Stammbaumanalyse Hinweis für den Erbgang Folie 3 3

4 Kongenitale (Struktur-) Myopathien Hypotonie ( floppy infant, Froschhaltung d. Beine, Henkelstellung d. Arme, überstreckbare Gelenke) Muskelschwäche, Gangauffälligkeiten ( floppy infant, pos. Gowers Zeichen, Durchschlupfphänomen) Reflexauffälligkeiten Bulbäre Symptome (Trinkschwäche, Schluckstörungen) Respiratorische Probleme bis zur Beatmung Auffälliges Muskelrelief (überwiegend gen. Muskelatrophie) Klumpfüße, AMC, Kontrakturen, Hüftluxation, Skoliose, rigid spine, Hohlfüße Folie 4 4 Faziale Hypomimie und / oder Dysmorphie, Ptosis, Ophthalmoplegie

5 . X-chrom.-rez. Myotubuläre Myopathie Leitsymptome in der Neonatalzeit Arthrogryposis multiplex congenita (AMC) Muskuläre Hypotonie Muskelschwäche Faziale Schwäche Saug- und Schluckstörungen Schwaches Schreien Respiratorische Probleme Klumpfüße, Kontrakturen, Skoliose, Hüftluxation MH-Reaktion Folie 5 5

6 X-chrom.-rez. Myotubuläre Myopathie Mögliche Organbeteiligungen Leberfunktionsstörungen, Vit-K-Mangel, Hämangiome in der Leber Gallensteine Pylorusstenose Nephrokalzinose Verzögerte Nervenleitungen MH-Reaktion Folie 6 6

7 X-chrom.-rez. Myotubuläre Myopathie Diagnostik Anamnese Klinik - Leitsymptome Labor (Cave CK oft normal!!) Myosonographie, Muskel-MRT EKG, Echokardiographie Lungenfunktion, PSG Muskelbiopsie (Histologie, evtl. EM) Genetik einschl. NGS Weitere Untersuchungen bei anderen Organmanifestationen Folie 7 7

8 X-chrom.-rez. myotubuläre Myopathie Besonderheiten: floppy infant plus Areflexie, bulbärer Symptomatik und häufig prim. resp. Insuffizienz aber auch fazialer Hypomimie und Ptose bds. Wichtig ist auch die Untersuchung der Mutter; sie ist aber gesund! Die Muskelbiopsie hilft weiter? Gezielte genetische Analyse im Myotubularin-Gen. Folie 8 8

9 Kasuistik Folie 9 9

10 X-chrom.-rez. Myotubuläre Myopathie Pyridostigminbromid: Hemmt den Abbau des Botenstoffes Acetylcholin im Spalt synaptischen Verstärkt dadurch die Stimulation der neuromuskulären Endplatte an den Muskelfasern Das Signal der neuromuskulären Endplatte wird dann über die Triade ( T-Tubulus und 2x sarkoplasmatisches Retikulum) in die Muskelfaser weitergeleitet Folie 10 10

11 Synaptischer Spalt Folie 11 11

12 X-chrom.-rez. Myotubuläre Myopathie Veränderungen an den neuromuskulären Endplatten sind in den Tiermodellen beschrieben worden (Zebrafisch und Mäuse). Eine Behandlung mit Pyridostigmin zeigte eine Verbesserung der motorischen Funktion. Einzelfallberichte von jugendlichen Patienten und Erwachsenen beschreiben eine Verbesserung der Kraft. Berichte von der Behandlung sehr junger Kinder und Säuglingen mit Pyridostigmin liegen bisher nicht vor Folie 12 12

13 X-chrom.-rez. Myotubuläre Myopathie Fallbericht: 2. Gravida, Resectio in der 38 SSW, postnatal respiratorische Anpassungsstörung, CPAP-Beatmung erforderlich. 4x Reanimationsereignisse in den ersten drei Lebensmonaten durch Sekretprobleme bei Schluckstörung. Muskelbiopsie im 2. Lebensmonat: zentronukleäre Myopathie Genetik: Nachweis einer heterozygoten Mutation im MTM-Gen Verlegung in unsere Klinik zur Verbesserung der respiratorischen Situation Folie 13 13

14 Video Folie 14 14

15 Zusammenfassung Die Variabilität der klinischen Symptome und der Muskelbiopsiebefunde ist offensichtlich, sie sind typisch, aber nicht spezifisch An die Möglichkeit weiterer Organmanifestationen denken!! Die Muskel-MRT kann sinnvolle Zusatzinformationen liefern. Genetische Analysen sind in Zusammenschau der klinischen, bildgebenden und bioptischen Daten zu initiieren. Im Einzelfall sind die jeweils sinnvoll erscheinenden Methoden einschl. des NGS zu diskutieren. Ein Therapieversuch mit AChE-Inhibitoren ist in einzelnen Fällen gerechtfertigt, da dies bei Positiveffekten dem Patienten entscheidend helfen kann. Folie 15 15

16 Ausblick Neue Einteilung auf der Grundlage pathophysiologischer Erkenntnisse: Defekte des sarkolemmalen und intrazellulären Membran-Remodellierung (MTM1, DNM2, BIN1) und der Excitation-Kontraktion-Verbindung (RYR1) Defekte der neuromuskulären Übertragung, erste positive Erfahrungen mit Pyridostigminbromid-Therapie (MTM1, TPM2 und TPM3, RyR1) Störung der mitochondrialen Verteilung und Funktion (RYR1, SEPN1) Störung der myofibrillären Kraftentwicklung (NEB, ACTA1) Atrophie und Autophagie (NEB, ZNM) Ziel: Entwicklung gezielter therapeutischer Strategien Folie 16 16

17 Vielen Dank Folie 17 17

Muskel- und Nervenerkrankungen

Muskel- und Nervenerkrankungen WS 2016/17 Vorlesung Neuropathologie Muskel- und Nervenerkrankungen Tanja Kuhlmann Institut für Neuropathologie Klinische Symptomatik Muskelschwäche Muskelatrophie (Pseudo-)Muskelhypertrophie Schmerzen/Mißempfindungen

Mehr

ABKLÄRUNGS- UND BEHANDLUNGSSTRATEGIEN BEI NEUROMUSKULÄREN ERKRANKUNGEN. Warnzeichen bei hypotonen Säuglingen / floppy infants

ABKLÄRUNGS- UND BEHANDLUNGSSTRATEGIEN BEI NEUROMUSKULÄREN ERKRANKUNGEN. Warnzeichen bei hypotonen Säuglingen / floppy infants ABKLÄRUNGS- UND BEHANDLUNGSSTRATEGIEN BEI NEUROMUSKULÄREN ERKRANKUNGEN 22.03.16, Kinderspital Luzern, Petra Kolditz Warnzeichen bei hypotonen Säuglingen / floppy infants Respiratorische Insuffizienz Trinkschwäche

Mehr

Kongenitale Myopathien

Kongenitale Myopathien Kongenitale Myopathien Karin Jurkat-Rott, Herbert Schreiber, Hans H. Goebel, Frank Lehmann-Horn, 2005 Historie Seit der Einführung der Elektronenmikroskopie und Enzymhistochemie in die Diagnostik neuromuskulärer

Mehr

Mathias Müller (FA Kinderheilkunde/ Neuropädiatrie) NEUROLOGISCHE ERKRANKUNGEN DES KINDESALTERS MIT BEATMUNGSNOTWENDIGKEIT

Mathias Müller (FA Kinderheilkunde/ Neuropädiatrie) NEUROLOGISCHE ERKRANKUNGEN DES KINDESALTERS MIT BEATMUNGSNOTWENDIGKEIT Mathias Müller (FA Kinderheilkunde/ Neuropädiatrie) NEUROLOGISCHE ERKRANKUNGEN DES KINDESALTERS MIT BEATMUNGSNOTWENDIGKEIT Erkrankungen mit Heimbeatmungsnotwendigkeit Ursachen für chronische Ateminsuffizienz

Mehr

Die erhöhte Creatinkinase als Zufallsbefund

Die erhöhte Creatinkinase als Zufallsbefund Die erhöhte Creatinkinase als Zufallsbefund Was tun? Wann ist welche Diagnostik sinnvoll? Ulrike Schara 1,3, Hans-Jürgen Christen 2 und Matthias Vorgerd 3,4 Die Erhöhung der Creatinkinase (CK) stellt immer

Mehr

Neuromuskuläre Erkrankungen

Neuromuskuläre Erkrankungen Klinische Neurologie Neuromuskuläre Erkrankungen Bearbeitet von Jörn P Sieb, Bertold Schrank 1. Auflage 2009. Taschenbuch. 332 S. Paperback ISBN 978 3 17 018381 0 Format (B x L): 13,5 x 23,5 cm Gewicht:

Mehr

Klinik und Transition neuromuskulärer Erkrankungen

Klinik und Transition neuromuskulärer Erkrankungen Klinik und Transition neuromuskulärer Erkrankungen Ulrike Schara Christiane Schneider-Gold Bertold Schrank Klinik und Transition neuromuskulärer Erkrankungen Neuropädiatrie trifft Neurologie Mit 45 Abbildungen

Mehr

Fragebogen zu Patienten mit Verdacht auf Dopa-responsive Dystonie: Evaluation von Anamnese, klinischen Symptomen und Diagnostik

Fragebogen zu Patienten mit Verdacht auf Dopa-responsive Dystonie: Evaluation von Anamnese, klinischen Symptomen und Diagnostik Fragebogen zu Patienten mit Verdacht auf Dopa-responsive Dystonie: Evaluation von Anamnese, klinischen Symptomen und Diagnostik Patienteninitialen: Geschlecht: Geb. Datum: Nr.: (wird zugeteilt) Familienanamnese

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Pongratz Atlas der Muskelkrankheiten

Pongratz Atlas der Muskelkrankheiten Pongratz Atlas der Muskelkrankheiten von D.E. Pongratz, CD. Reimers, D. Hahn, M. Nagele und W. Müller-Felber unter Mitarbeit von G. Hübner mit einem Vorwort von J. Lissner 411 Abbildungen und 20 Tabellen

Mehr

Weshalb es wichtig ist die genetischen Ursachen von ZNM zu kennen

Weshalb es wichtig ist die genetischen Ursachen von ZNM zu kennen MTM/ZNM Familientreffen Frankfurt 5.-8. Mai 2016 Weshalb es wichtig ist die genetischen Ursachen von ZNM zu kennen Why it is important to know the genetic causes of CNM Dr. Johann Böhm IGBMC, Strasbourg

Mehr

Diagnostik bei neuromuskulären Erkrankungen

Diagnostik bei neuromuskulären Erkrankungen Diagnostik bei neuromuskulären Erkrankungen Neue Methoden der Genetik 7. DGM Fach- und Informationstag für Muskelkranke 2014 1. Juni 2014 Dr. Sabine Uhrig AGENDA 2 Menschliche Muskulatur 656 Muskeln 30-50%

Mehr

Kein Hinweis für eine andere Ursache der Demenz

Kein Hinweis für eine andere Ursache der Demenz die später nach ihm benannte Krankheit. Inzwischen weiß man, dass die Alzheimer-Krankheit eine sogenannte primär-neurodegenerative Hirnerkrankung ist. Das bedeutet, dass die Erkrankung direkt im Gehirn

Mehr

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Fallkonferenz Schwerpunkt Humangenetik Genetische Beratung Genetische Beratung ist ein Kommunikationsprozess, der

Mehr

Myopathie. Bianca Dräger

Myopathie. Bianca Dräger Myopathie Bianca Dräger Klinik für Schlafmedizin und neuromuskuläre Erkrankungen Neuromuskuläres Zentrum Münster/Westfalen/Osnabrück Department für Neurologie Westfälische Wilhelms-Universität Münster

Mehr

11. Gebiet Humangenetik

11. Gebiet Humangenetik Auszug aus der Weiterbildungsordnung der Ärztekammer Niedersachsen und Richtlinien vom 01.05.2005, geändert zum 01.02.2012 (siehe jeweilige Fußnoten) 11. Gebiet Humangenetik Definition: Das Gebiet Humangenetik

Mehr

Wissenswertes zur Spinalen Muskelatrophie

Wissenswertes zur Spinalen Muskelatrophie Wissenswertes zur Spinalen Muskelatrophie Rudolf Korinthenberg, Janbernd Kirschner Klinik für Neuropädiatrie und Muskelerkrankungen Zentrum für Kinderheilkunde und Jugendmedizin Universitätsklinikum Freiburg/Brsg.

Mehr

HOCM. Diagnostik, Risiko, Therapie. PD Dr. Marcel Halbach. Klinik III für Innere Medizin. Herzzentrum der Universität zu Köln

HOCM. Diagnostik, Risiko, Therapie. PD Dr. Marcel Halbach. Klinik III für Innere Medizin. Herzzentrum der Universität zu Köln HOCM Diagnostik, Risiko, Therapie PD Dr. Marcel Halbach Klinik III für Innere Medizin Herzzentrum der Universität zu Köln Definition und Ätiologie der HCM Erhöhung der Wanddicke, die nicht allein durch

Mehr

EA I Funkti k onsstörung de s Kaliumka umk nals un d Ataxie? Tier modell (Maus ) der der I: verstärkte Inhibi ärkte tion inhibierender ender Pur

EA I Funkti k onsstörung de s Kaliumka umk nals un d Ataxie? Tier modell (Maus ) der der I: verstärkte Inhibi ärkte tion inhibierender ender Pur Diagnose und Therapie Episodischer Ataxien Michael Strupp, MD Neurologische Klinik und IFBLMU Universität München Leitsymptome 1. Paroxysmale Ataxie für (Sekunden bis) Minuten Dauer/Frequenz für (Sekunden

Mehr

FAZIOSKAPULO- HUMERALE MUSKEL- DYSTROPHIE

FAZIOSKAPULO- HUMERALE MUSKEL- DYSTROPHIE DGM INFO FAZIOSKAPULO- HUMERALE MUSKEL- DYSTROPHIE DGM Deutsche Gesellschaft für Muskelkranke e.v. 2 3 Die fazioskapulohumerale Muskeldystrophie (FSHD) Die fazioskapulohumerale Muskeldystrophie (FSHD)

Mehr

Rationale Diagnostik ik von Autoimmunthyreopathien

Rationale Diagnostik ik von Autoimmunthyreopathien 2. Mühldo orfer Schild ddrüs sensym mposium Rationale Diagnostik ik von Autoimmunthyreopathien Dr. Christos Koutsampelas Facharzt für Nuklearmedizin dia.log Diagnostische Radiologie Altötting Nuklearmedizinische

Mehr

Multiple Sklerose (MS)

Multiple Sklerose (MS) Bild: Kurzlehrbuch Neurologie, Thieme Multiple Sklerose 2 Multiple Sklerose (MS) Inhalt» Pathogenese» Symptome» Diagnostik» Therapie Multiple Sklerose 4 Multiple Sklerose 3 Klinischer Fall..\3) Sammlung\Klinischer

Mehr

Neuromuskuläre Skoliose - Spinale Muskelatrophie Skoliose Deformitiäten I 08 3

Neuromuskuläre Skoliose - Spinale Muskelatrophie Skoliose Deformitiäten I 08 3 Was sind Neuromuskuläre Erkrankungen? Man beschreibt damit Krankheitsbilder, die primär durch neurologische oder muskuläre Erkrankungen entstehen und durch eine Vielzahl von Symptomen in unterschiedlicher

Mehr

Amyotrophe Lateralsklerose. Referat von Eva Montag

Amyotrophe Lateralsklerose. Referat von Eva Montag Amyotrophe Lateralsklerose Referat von Eva Montag http://p5.focus.de/img/incoming/origs3195325/5738838139-w630-h412-o-q75-p5/wissen-hawking.jpg Inhalt 1. Definition Was genau ist ALS? 2. Verlauf und Symptomatik

Mehr

2 Erkrankungen von Muskel und neuromuskulärer Synapse

2 Erkrankungen von Muskel und neuromuskulärer Synapse 2 Erkrankungen von Muskel und neuromuskulärer Synapse... ÜBERSICHT Hereditäre degenerative Erkrankungen des Skelettmuskels durch molekulargenetisch definierte Gendefekte. Die Kenntnis der verantwortlichen

Mehr

Neurologische Leitsymptome und diagnostische Entscheidungen

Neurologische Leitsymptome und diagnostische Entscheidungen Neurologische Leitsymptome und diagnostische Entscheidungen von Helmut Buchner 1. Auflage Thieme 2007 Verlag C.H. Beck im Internet: www.beck.de ISBN 97 3 13 1433 4 Zu Inhaltsverzeichnis schnell und portofrei

Mehr

Manuela Baumgartner. Genetik. Vererbungsmodus: Autosomal rezessiv. X-chromosomal rezessiv. Syndrome. PowerPoint Syndrome

Manuela Baumgartner. Genetik. Vererbungsmodus: Autosomal rezessiv. X-chromosomal rezessiv. Syndrome. PowerPoint Syndrome Genetik Chromosomensatz 46 XX bzw. 46XY Manuela Baumgartner KH Barmherzige Schwestern, Linz Autosomal dominant z.b. Chorea Huntington, Marfan- Syndrom, Myotonia congenita Thomsen Autosomal rezessiv z.b.

Mehr

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Chronisch obstruktive Lungenerkrankung (COPD)

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Chronisch obstruktive Lungenerkrankung (COPD) Medizin im Vortrag Herausgeber: Prof. Dr. med. Christoph Frank Dietrich Chronisch obstruktive Lungenerkrankung (COPD) Autoren: Dr. med. Manfred Oestreicher Priv.-Doz. Dr. med. Christoph Frank Dietrich

Mehr

Neues zu Studien bei aut.-rez. spinaler Muskelatrophie

Neues zu Studien bei aut.-rez. spinaler Muskelatrophie Neues zu Studien bei aut.-rez. spinaler Muskelatrophie Ulrike Schara Neuropädiatrie, Entwicklungsneurologie und Sozialpädiatrie Zentrum für Kinder- und Jugendmedizin Universitätsklinikum Essen Aut.-rez.

Mehr

AVWS Diagnostik aus sprachtherapeutischer Sicht

AVWS Diagnostik aus sprachtherapeutischer Sicht AVWS Diagnostik aus sprachtherapeutischer Sicht Birke Peter, Klinische Sprechwissenschaftlerin Klinik und Poliklinik für Hals-, Nasen-, Ohrenheilkunde Universitätsmedizin Leipzig Direktor: Univ.-Prof.

Mehr

B. A. Michel P. Brühlmann. Rheumatologie MUSTERSEITE. Klinische Untersuchung

B. A. Michel P. Brühlmann. Rheumatologie MUSTERSEITE. Klinische Untersuchung B. A. Michel P. Brühlmann Rheumatologie Klinische Untersuchung Vorwort Diagnostik und Verlaufsbeurteilung beruhen in der Rheumatologie hauptsächlich auf Anamnese und klinischer Untersuchung. Zusatzuntersuchungen

Mehr

Official Journal of the Academy of Education of the Society for Neuropediatrics (Gesellschaft für Neuropädiatrie) Herausgeber: F.

Official Journal of the Academy of Education of the Society for Neuropediatrics (Gesellschaft für Neuropädiatrie) Herausgeber: F. Zeitschrift für Neurologie des Kindes- und Jugendalters und ihre Grenzgebiete 5. Jg. A 58655 Official Journal of the Academy of Education of the Society for Neuropediatrics (Gesellschaft für Neuropädiatrie)

Mehr

Rumpf- und Atemmuskelschwäche in der Muskelambulanz

Rumpf- und Atemmuskelschwäche in der Muskelambulanz Rumpf- und Atemmuskelschwäche in der Muskelambulanz Deutsche Gesellschaft für Neurologie Mannheim 24.9.2010 Bertold Schrank Deutsche Klinik für Diagnostik Wiesbaden Atemmuskulatur Kehlkopf - Glottisschluss

Mehr

Das klinische Spektrum der ALS. Albert C. Ludolph, Ulm

Das klinische Spektrum der ALS. Albert C. Ludolph, Ulm Das klinische Spektrum der ALS Albert C. Ludolph, Ulm Die häufigste Motoneuronerkrankung: die amyotrophe Lateralsklerose (ALS) Rasch fortschreitende, erst fokale, sich kontinuierlich ausbreitend, dann

Mehr

Perikarditis - Was sagen die neuen Leitlinien?

Perikarditis - Was sagen die neuen Leitlinien? Perikarditis - Was sagen die neuen Leitlinien? M. Pauschinger Ärztlicher Leiter Universitätsklinik für Innere Medizin 8 Schwerpunkt Kardiologie Paracelsus Medizinische Privatuniversität Nürnberg EHJ 2015,

Mehr

2. Informationsveranstaltung über die Multiple Sklerose

2. Informationsveranstaltung über die Multiple Sklerose 2. Informationsveranstaltung über die Multiple Sklerose Botulinumtoxin und Multiple Sklerose Johann Hagenah Die Geschichte des Botulinumtoxins 1817 Justinus Kerner publiziert in den Tübinger Blättern für

Mehr

Molekulargenetische und biochemische Untersuchungen zur Pathogenese der Spinalen Muskelatrophie mit Atemnot Typ 1 (SMARD1)

Molekulargenetische und biochemische Untersuchungen zur Pathogenese der Spinalen Muskelatrophie mit Atemnot Typ 1 (SMARD1) Molekulargenetische und biochemische Untersuchungen zur Pathogenese der Spinalen Muskelatrophie mit Atemnot Typ 1 (SMARD1) Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften

Mehr

Zweigbibliofhek Medizin

Zweigbibliofhek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliofhek Medizin

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Kolorektales Karzinom

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Kolorektales Karzinom Medizin im Vortrag Herausgeber: Prof. Dr. med. Christoph Frank Dietrich Kolorektales Karzinom Autoren: Dr. med. Stefan Krüger Dr. med. Edgar Hartung Kerstin Siehr Prof. Dr. med. Christoph Frank Dietrich

Mehr

Symptome und Diagnosestellung des Morbus Parkinson

Symptome und Diagnosestellung des Morbus Parkinson meine Hand zittert habe ich etwa Parkinson? Symptome und Diagnosestellung des Morbus Parkinson Dr. med. Sabine Skodda Oberärztin Neurologische Klinik Morbus Parkinson chronisch fortschreitende neurodegenerative

Mehr

Postpolio Syndrom Behandlungsmöglichkeiten am Mediclin Reha Zentrum Roter Hügel in Bayreuth

Postpolio Syndrom Behandlungsmöglichkeiten am Mediclin Reha Zentrum Roter Hügel in Bayreuth MediClin integriert. Postpolio Syndrom Behandlungsmöglichkeiten am Mediclin Reha Zentrum Roter Hügel in Bayreuth 10 Jahre Polioselbsthilfe Bayreuth 26.06.2010 Dr. Günther Beer Chefarzt Neurologie/Geriatrie

Mehr

Einleitung. Canine Ceroid Lipofuszinose, CCL (neuronale Ceroid- Lipofuszinose, neuronal ceroid lipofuscinosis, NCL)

Einleitung. Canine Ceroid Lipofuszinose, CCL (neuronale Ceroid- Lipofuszinose, neuronal ceroid lipofuscinosis, NCL) Molekulargenetische Untersuchungen zur Aufklärung der caninen CeroidLipofuszinose beim Tibet Terrier A. Wöhlke1, R. Brahm2 und O. Distl1 1 2 Institut für Tierzucht und Vererbungsforschung, Stiftung Tierärztliche

Mehr

Das Post-Polio-Syndrom (PPS) im Alter

Das Post-Polio-Syndrom (PPS) im Alter Das Post-Polio-Syndrom (PPS) im Alter Prof. Dr. Andreas Hetzel, Chefarzt Neurologie Park-Klinikum Bad Krozingen Quellen: Internet:www.who.org; www.dgm.org; Weber, Nervenarzt 2004;347, Pongratz, Das Post-Polio-Syndrom,

Mehr

Abiturprüfung Biologie, Leistungskurs

Abiturprüfung Biologie, Leistungskurs Seite 1 von 5 Abiturprüfung 2008 Biologie, Leistungskurs Aufgabenstellung: Thema: Das MERRF-Syndrom II.1 Begründen Sie, warum x-chromosomale Vererbung des MERRF-Krankheitsbildes, wie in Material C dargestellt,

Mehr

X-Linked Myotubular Myopathy

X-Linked Myotubular Myopathy X-Linked Myotubular Myopathy MTM1 Familientreffen Göttingen, 5th of June 2015 Dr Laurent SERVAIS, MD PhD Charlotte LILIEN, PT 05/06/2015 Laurent Servais MD PHD - NatHis-MTM 1 Institute of Myology Paris

Mehr

Information zum Patientenregister im Rahmen des Deutschen Netzwerks für mitochondriale Erkrankungen (mitonet)

Information zum Patientenregister im Rahmen des Deutschen Netzwerks für mitochondriale Erkrankungen (mitonet) Information zum Patientenregister im Rahmen des Deutschen Netzwerks für mitochondriale Erkrankungen (mitonet) Das wesentliche Ziel des mitonet ist der Aufbau eines deutschlandweiten Netzwerks aus Klinikern

Mehr

Faktor-V-Leiden Mutation: Diagnose und Klinik

Faktor-V-Leiden Mutation: Diagnose und Klinik INRswiss-Tag Solothurn, 21. November 2009 Faktor-V-Leiden Mutation: Diagnose und Klinik Dr. Giuseppe Colucci Universitätsklinik für Hämatologie und Hämatologisches Zentrallabor Inselspital Bern Faktor-V-Leiden

Mehr

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose Morbus Fabry - Niereninsuffizienz Kardiomyopathie Neurologische Störungen - Vom unklaren Sympto Morbus Fabry Niereninsuffizienz Kardiomyopathie Neurologische Störungen Vom unklaren Symptomkomplex zur ganzheitlichen

Mehr

Giessen und Marburg hhhh Zentrum für Kinderheilkunde und. hhh Abteilung für Neuropädiatrie, Sozialpädiatrie und Epileptologie

Giessen und Marburg hhhh Zentrum für Kinderheilkunde und. hhh Abteilung für Neuropädiatrie, Sozialpädiatrie und Epileptologie UNIVERSITÄTSKLINIKUM Giessen und Marburg hhhh Zentrum für Kinderheilkunde und Jugendmedizin hhh Abteilung für Neuropädiatrie, Sozialpädiatrie und Epileptologie Warum? Interesse an klinischer Psychologie

Mehr

Populationsrelevanz der Hämochromatose und klinische Konsequenzen

Populationsrelevanz der Hämochromatose und klinische Konsequenzen Populationsrelevanz der Hämochromatose und klinische Konsequenzen 60. Tagung der DGVS Köln, 15.09.2005 Prof. Dr. med. Manfred Stuhrmann-Spangenberg Institut für Humangenetik Medizinische Hochschule Hannover

Mehr

Metabolische Myopathien

Metabolische Myopathien Metabolische Myopathien Kurs Muskelerkrankungen: Leitpfade für Diagnostik und Therapie Marcus Deschauer Was sind metabolische Myopathien? Hereditäre Myopathien durch Defekte im Energiestoffwechsel des

Mehr

Workshop Undine-Syndrom. Yvonne Keiper exam. Krankenschwester

Workshop Undine-Syndrom. Yvonne Keiper exam. Krankenschwester Workshop Undine-Syndrom Yvonne Keiper exam. Krankenschwester Definition Zentrales Hypoventilationssyndrom = CHS Erstmals in 1970er Jahren erkannt Eine Gruppe von Störungen die zu einer Unteratmung führen

Mehr

Fettmoleküle und das Gehirn

Fettmoleküle und das Gehirn Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Spezielle "Gehirn Fett Injektion hilft Huntington Mäusen Direktes

Mehr

Psychotherapie bei Kindern und Jugendlichen mit geistiger Behinderung - ein Einblick

Psychotherapie bei Kindern und Jugendlichen mit geistiger Behinderung - ein Einblick Psychotherapie bei Kindern und Jugendlichen mit geistiger Behinderung - ein Einblick Vortrag Stefan Meir PIA der St. Lukas-Klinik Zum Vierteljahrestreffen der KJPP-Kliniken Baden - Württemberg am 23.03.2015

Mehr

Sinnvoller Umgang mit DNA-Tests

Sinnvoller Umgang mit DNA-Tests Sinnvoller Umgang mit DNA-Tests - Eine Zuchtmethode - - Kleine Hundepopulation - Helga Eichelberg Welpenstatistik Eingetragene Welpen 2006 2005 2004 Pinscher 384 237 246 ca. 80 Würfe Zwerge 197 250 251

Mehr

Myasthenia gravis. abnorme Ermüdbarkeit der Willkürmuskulatur unter Belastung, die sich -anfänglich- in Ruhe wieder zurückbildet.

Myasthenia gravis. abnorme Ermüdbarkeit der Willkürmuskulatur unter Belastung, die sich -anfänglich- in Ruhe wieder zurückbildet. abnorme Ermüdbarkeit der Willkürmuskulatur unter Belastung, die sich -anfänglich- in Ruhe wieder zurückbildet. Epidemiologie und Ätiologie Prävalenz ca. 3-10:100.000 Frauen : Männer = 3 : 2 am häufigsten

Mehr

Diagnostisches Vorgehen bei Leberraumforderungen. H. Diepolder

Diagnostisches Vorgehen bei Leberraumforderungen. H. Diepolder Diagnostisches Vorgehen bei Leberraumforderungen H. Diepolder Bei 20% aller Routinesonographien fällt eine Leberraumforderung auf Problem Problem Bei 20% aller Routinesonographien fällt eine Leberraumforderung

Mehr

Stand der Forschung. Jahresversammlung CFCH Philipp Latzin

Stand der Forschung. Jahresversammlung CFCH Philipp Latzin Stand der Forschung Jahresversammlung CFCH 2015 Philipp Latzin Forschung bei CF In 2014: 1981 Publikationen Nur eine Auswahl kann vorgestellt werden Diese Auswahl ist sehr subjektiv Versuch, einen Bezug

Mehr

Eigenstudium / Wahlcurriculum

Eigenstudium / Wahlcurriculum Eigenstudium / Wahlcurriculum Stundenplan des Studienblocks "Bewegungsapparat" im Wintersemester 2016/17 (Stand: 09.11.2016) Der Studienblock "Bewegungsapparat" wird im Wintersemester 2016/17in den Semesterwochen

Mehr

Physiologische (normale) Gelenkbeweglichkeit:

Physiologische (normale) Gelenkbeweglichkeit: Chiropraktik für Pferde Dr. Conny Schulz Mitglied IVCA Inhalt: Einleitung Was ist Chiropraktik? Was ist eine chiropraktische Blockade? Wie behandelt man Blockaden? Ursachen für Blockaden Mögliche Symptome

Mehr

Fachhandbuch für BP04 - Blockpraktikum Frauenheilkunde (10. FS)

Fachhandbuch für BP04 - Blockpraktikum Frauenheilkunde (10. FS) Fachhandbuch für BP04 - Blockpraktikum Frauenheilkunde (10. FS) Inhaltsverzeichnis 1. Übersicht über die Unterrichtsveranstaltungen... 2 1.1. Blockpraktikum... 2 2. Beschreibung der Unterrichtsveranstaltungen...

Mehr

Eigenstudium / Wahlcurriculum / Zusatzveranstaltungen

Eigenstudium / Wahlcurriculum / Zusatzveranstaltungen Stundenplan des Studienblocks "Bewegungsapparat" im Sommersemester 2016 (Stand: 21.04.2016) Der Studienblock "Bewegungsapparat" wird im Sommersemester 2016 in den Semesterwochen 5 bis 8 (09.05. 03.06.2016)

Mehr

Anlage zur Akkreditierungsurkunde D-ML-13135-02-00 nach DIN EN ISO 15189:2013

Anlage zur Akkreditierungsurkunde D-ML-13135-02-00 nach DIN EN ISO 15189:2013 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13135-02-00 nach DIN EN ISO 15189:2013 Gültigkeitsdauer: 22.08.2014 bis 21.08.2019 Ausstellungsdatum: 22.08.2014 Urkundeninhaber:

Mehr

Genetische Beratung und Diagnostik. All is genetics. Familiäre Tumore Personalisierte Medizin

Genetische Beratung und Diagnostik. All is genetics. Familiäre Tumore Personalisierte Medizin Seminar Humangenetik 2015 Genetische Beratung und Diagnostik All is genetics. Familiäre Tumore Personalisierte Medizin 9. Dezember 2015 Seminarraum Seminar Humangenetik 2015 Genetische Beratung und Diagnostik

Mehr

Peer Review Verfahren Ergebnisse 2013

Peer Review Verfahren Ergebnisse 2013 Peer Review Verfahren Ergebnisse 2013 Erstmals fassen wir die Ergebnisse der Peer Review Verfahren eines Jahres in einem kurzen Handout zusammen, um Ihnen einen zusammenfassenden Überblick über die wesentlichen

Mehr

Fachhandbuch für F11 - Innere Medizin (8. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2

Fachhandbuch für F11 - Innere Medizin (8. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2 Fachhandbuch für F11 - Innere Medizin (8. FS) Inhaltsverzeichnis 1. Übersicht über die Unterrichtsveranstaltungen... 2 1.1. Vorlesung... 2 1.2. Unterricht am Krankenbett... 3 2. Beschreibung der Unterrichtsveranstaltungen...

Mehr

Bildgebende und interventionelle Strategien bei pavk und akutem peripheren Arterienverschluss

Bildgebende und interventionelle Strategien bei pavk und akutem peripheren Arterienverschluss Bildgebende und interventionelle Strategien bei pavk und akutem peripheren Arterienverschluss J. Tonak N. Panagiotopoulos - P. Bischoff - J.P. Goltz Jörg Barkhausen Definition pavk: periphere arterielle

Mehr

K-M-A. Kölner Mutismus Anamnesebogen

K-M-A. Kölner Mutismus Anamnesebogen K-M-A Kölner Mutismus Anamnesebogen Anleitung Der K-M-A wurde entwickelt, um Risikofaktoren bei den Familienangehörigen und den Betroffenen zu dokumentieren, die für die Entstehung einer mutistischen Symptomatik

Mehr

Erblichkeit von Krebserkrankungen Was ist für den Hausarzt wichtig?

Erblichkeit von Krebserkrankungen Was ist für den Hausarzt wichtig? Erblichkeit von Krebserkrankungen Was ist für den Hausarzt wichtig? Jochen Heymanns Koblenz 28.08.2013 Einführung Warum dieses Thema? Einführung da heutige Familien klein sind, Familienmitglieder über

Mehr

Epilepsie. Ein Vortrag von Sarah Matingu und Fabienne Brutscher

Epilepsie. Ein Vortrag von Sarah Matingu und Fabienne Brutscher Epilepsie Ein Vortrag von Sarah Matingu und Fabienne Brutscher Inhalt Allgemeines Definition Formen der Epilepsie Elektroenzophalografie (EEG) Molekulare Ursachen Genetische Ursachen Ionenkanäle Kandidatengene

Mehr

Untersuchung. Klassifikation der angeborenen Anomalien des Stütz- und Bewegungsapparates

Untersuchung. Klassifikation der angeborenen Anomalien des Stütz- und Bewegungsapparates Klinik und Poliklinik für Orthopädie und orthopädische Chirurgie Kinderorthopädie Direktor : Univ.-Prof. Dr. H. Merk Kinder und Neuroorthopädie - Untersuchung - Fehlbildungen und angeborene Entwicklungsstörungen

Mehr

Zwei alternative Methoden in der Legasthenietherapie: Eine Eye Tracking Studie

Zwei alternative Methoden in der Legasthenietherapie: Eine Eye Tracking Studie Zwei alternative Methoden in der Legasthenietherapie: Eine Eye Tracking Studie Linda Bruch Salzburg, 19. Oktober 2012 1 Legasthenie: Definition Die Legasthenie ist eine spezifische Lernschwierigkeit, die

Mehr

Auswertung von Unterschieden der Androgene bei SBMA-Patienten

Auswertung von Unterschieden der Androgene bei SBMA-Patienten Auswertung von Unterschieden der Androgene bei SBMA-Patienten Nicholas Di Prospero, MD, PhD National Institute of Neurological Disorders and Stroke NIH Von der Genetik zu einem Gen Spinale und Bulbäre

Mehr

Curriculum zur Weiterbildung im Schwerpunkt. Neuropädiatrie

Curriculum zur Weiterbildung im Schwerpunkt. Neuropädiatrie Anlage 2 Curriculum zur Weiterbildung im Schwerpunkt Neuropädiatrie Das nachfolgend ausgeführte Curriculum bietet die Vermittlung der wesentlichen Kenntnisse, Erfahrungen und Fertigkeiten, zur Erlangung

Mehr

Autismus-Spektrum-Störung neuropädiatrische Einführung in das Thema

Autismus-Spektrum-Störung neuropädiatrische Einführung in das Thema Autismus-Spektrum-Störung neuropädiatrische Einführung in das Thema P. Weber Universitäts-Kinderspital beider Basel Abteilung Neuro-/Entwicklungspädiatrie Peter.Weber@ukbb.ch Kernmerkmale des Autismus

Mehr

Informationen für Patienten

Informationen für Patienten Informationen für Patienten Viele Wege führen nach Rom. Dieser Spruch wird vielfach genutzt wenn es darum geht, welche Therapie in einer bestimmten Situation am geeignetsten ist. Unser Weg ist das Nervensystem.

Mehr

Inhalt. Vorwort Diagnostik peripherer Nervenerkrankungen. 1 Der Patient mit neuropathischen Beschwerden... 15

Inhalt. Vorwort Diagnostik peripherer Nervenerkrankungen. 1 Der Patient mit neuropathischen Beschwerden... 15 Inhalt Vorwort................................................ 11 A Diagnostik peripherer Nervenerkrankungen 1 Der Patient mit neuropathischen Beschwerden............. 15 2 Schlüsselinformationen aus Anamnese

Mehr

Meine Gene, meine Gesundheit

Meine Gene, meine Gesundheit AIW-Hauptversammlung, SportSchloss Velen, 4. Mai 2006 Prof. Dr. Dr. Christian De Bruijn IPMG Institut für präventiv-medizinisches Gesundheitsmanagement, Velen Die Molekularmedizin ist die Medizin von Morgen

Mehr

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Koronare Herzkrankheit

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Koronare Herzkrankheit Medizin im Vortrag Herausgeber: Prof. Dr. med. Christoph Frank Dietrich Koronare Herzkrankheit Autoren: Priv.-Doz. Dr. med. Christoph Frank Dietrich Priv.-Doz. Dr. med. Claudius Teupe Text- und Grafikbausteine

Mehr

Diagnostik von Traumafolgestörungen bei unbegleiteten minderjährigen Flüchtlingen

Diagnostik von Traumafolgestörungen bei unbegleiteten minderjährigen Flüchtlingen Diagnostik von Traumafolgestörungen bei unbegleiteten minderjährigen Flüchtlingen Sabine Korda Fachärztin für Kinder- und Jugendpsychiatrie und Psychotherapie Fachärztin für Psychiatrie und Psychotherapie

Mehr

Infektionskrankheiten mit respiratorischer Symptomatik. Thomas Nicolai, Cihan Papan, Johannes Hübner. Tanja Bittner, Cihan Papan, Johannes Hübner

Infektionskrankheiten mit respiratorischer Symptomatik. Thomas Nicolai, Cihan Papan, Johannes Hübner. Tanja Bittner, Cihan Papan, Johannes Hübner XIII I Infektionskrankheiten mit respiratorischer Symptomatik 1 15-jähriger Junge mit Husten und Fieber........................................ 3 2 17-jähriges Mädchen mit Husten und Atemnot..................................

Mehr

admedicum Experten für Patienten Information

admedicum Experten für Patienten Information admedicum Experten für Patienten Information Treatrush 2014/2 - Freigegeben Stand: Januar 2015 Um was geht/ging es? TREATRUSH, ein Projekt zum Usher-Syndrom Was wurde veröffentlicht? Die Zusammenfassung

Mehr

Study Guide Klinik für Kardiologie, Pneumologie und Angiologie

Study Guide Klinik für Kardiologie, Pneumologie und Angiologie Study Guide Klinik für Kardiologie, Pneumologie und Angiologie Task: Schmerzen in der Brust [103] Autoren: Dr. med. S. Keymel/Univ.-Prof. Dr. med. T. Rassaf Version 02.10.2013 Krankheitsbilder in Verbindung

Mehr

Brustkrebs Nachsorge. Diagnostik und Therapie primärer und metastasierter Mammakarzinome. AGO e.v. in der DGGG e.v. sowie in der DKG e.v.

Brustkrebs Nachsorge. Diagnostik und Therapie primärer und metastasierter Mammakarzinome. AGO e.v. in der DGGG e.v. sowie in der DKG e.v. Diagnostik und Therapie primärer und metastasierter Mammakarzinome Brustkrebs Nachsorge Brustkrebs Nachsorge Version 2002: Thomssen / Scharl Version 2003 2008: Bauerfeind / Bischoff / Blohmer / Böhme /

Mehr

Fachgruppensitzung 21. Jänner Fachgruppensitzung. P. Voitl.

Fachgruppensitzung 21. Jänner Fachgruppensitzung. P. Voitl. Fachgruppensitzung P. Voitl Programm Peter Voitl Aktuelles aus der Standespolitik Neue Tarifpositionen für die GKK-Verhandlungen Prim. Univ.-Prof. Dr. Beatrix Volc-Platzer Update AKNE FSME - Preise Honorarverhandlungen

Mehr

Study Guide Klinik für Kardiologie, Pneumologie und Angiologie

Study Guide Klinik für Kardiologie, Pneumologie und Angiologie Study Guide Klinik für Kardiologie, Pneumologie und Angiologie Task: Zyanose [35] Autoren: Dr. med. S. Keymel/Univ.-Prof. Dr. med. T. Rassaf Version 02.10.2013 Krankheitsbilder in Verbindung mit dem Behandlungsanlass

Mehr

1 Historische Konzepte der Frontalhirnfunktionen und -erkrankungen... 1 H. Förstl

1 Historische Konzepte der Frontalhirnfunktionen und -erkrankungen... 1 H. Förstl Inhaltsverzeichnis 1 Historische Konzepte der Frontalhirnfunktionen und -erkrankungen......................... 1 H. Förstl Neurobiologie und Neuropsychologie 2 Neurobiologische Grundlagen der Stirnhirnfunktionen.....

Mehr

Bluterkrankungen bei Menschen mit Down-Syndrom

Bluterkrankungen bei Menschen mit Down-Syndrom Bluterkrankungen bei Menschen mit Down-Syndrom oder Besonderheiten des Blutbildes bei Trisomie 21 Prim. Univ.-Prof. Dr. Milen Minkov Facharzt für Kinder- und Jugendheilkunde Pädiatrische Hämatologie und

Mehr

Wie können wir in Zukunft diese Fragen beantworten?

Wie können wir in Zukunft diese Fragen beantworten? Parkinson Krankheit: Diagnose kommt sie zu spät? Prof. Dr. med. Claudia Trenkwalder Mannheim (23. September 2010) - Die Frage, ob derzeit die Diagnosestellung einer Parkinson-Erkrankung zu spät kommt,

Mehr

Neues aus Diagnostik und Therapie beim Lungenkrebs. Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln

Neues aus Diagnostik und Therapie beim Lungenkrebs. Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln Neues aus Diagnostik und Therapie beim Lungenkrebs Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln Über was ich Ihnen heute berichten will: Lungenkrebs ist nicht gleich Lungenkrebs

Mehr

Medikamentöse Therapie und klinische Studien bei Spinaler Muskelatrophie

Medikamentöse Therapie und klinische Studien bei Spinaler Muskelatrophie Medikamentöse Therapie und klinische Studien bei Spinaler Muskelatrophie Jan Kirschner Klinik Neuropädiatrie und Muskelerkrankungen SMA-Symposium 30.09. 03.10.2016 Hohenroda Klinische Präsentation Neonatale

Mehr

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Demenz und Demenzkrankheiten

Medizin im Vortrag. Herausgeber: Prof. Dr. med. Christoph Frank Dietrich. Demenz und Demenzkrankheiten Medizin im Vortrag Herausgeber: Prof. Dr. med. Christoph Frank Dietrich Demenz und Demenzkrankheiten Autoren: Dr. med. Michael Poremba Prof. Dr. med. Christoph Frank Dietrich Text- und Grafikbausteine

Mehr

Magen-Darm-Trakt und Sjögren-Syndrom 7. Deutscher Sjögren Tag,

Magen-Darm-Trakt und Sjögren-Syndrom 7. Deutscher Sjögren Tag, Magen-Darm-Trakt und Sjögren-Syndrom 7. Deutscher Sjögren Tag, 08.03.2008 Dr. med. J. Rosendahl Department für Innere Medizin Medizinische Klinik & Poliklinik II Übersicht I -Speiseröhre - Schluckstörungen

Mehr

Neonatalerhebung Baden-Württemberg 2003

Neonatalerhebung Baden-Württemberg 2003 Neonatalerhebung Baden-Württemberg 2003 Version 2.1 Druckdatum: 21.06.2004 Erstellungsdatum: 11.05.2004 15. März 2000 Gesamtstatistik Landesärztekammer Baden-Württemberg, Abt. Fortbildung und Qualitätssicherung

Mehr

Perinatalzentrum Level I - Ergebnisqualitätsdaten

Perinatalzentrum Level I - Ergebnisqualitätsdaten Perinatalzentrum Level I - Ergebnisqualitätsdaten Neben den nachfolgender Daten zur Aufnahmestatistik finden Sie Informationen zur Ergebnisqualität des Esslinger Perinatalzentrums auf der Internetseite:

Mehr

Inhaltsübersicht. Teil 1 Einführung in die klinische Medizin. Teil 2 Leitsymptome von Krankheiten

Inhaltsübersicht. Teil 1 Einführung in die klinische Medizin. Teil 2 Leitsymptome von Krankheiten Inhaltsübersicht Vorwort der Herausgeber Vorwort des Verlegers Vorwort der Originalausgabe Nachruf George W. Thorn Zusammenfassungen der Kapitel e1 bis e39 Kapitelherausgeber der deutschen Auflage Autoren

Mehr

Entdeckungen unter der Schädeldecke. Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie

Entdeckungen unter der Schädeldecke. Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie Entdeckungen unter der Schädeldecke Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie Inhalt 1. GFP, das Wunderprotein 2. Die Nervenzellen bei der Arbeit beobachten 3. Nervenzellen mit Licht

Mehr

Eine Broschüre der Schweizerischen Muskelgesellschaft

Eine Broschüre der Schweizerischen Muskelgesellschaft Tags: Muskelabbau, Muskelkrankheit, Muskelschwund, muskelkrank, Morbus Pompe Kategorien: Krankheitsbild & Diagnose, Publikationen Zielgruppen: Angehörige, Betroffene, Fachperson, Lehrperson, Medienschaffende

Mehr

Konventionelle Röntgendiagnostik des Thorax. Fallbeispiele aus der Praxis

Konventionelle Röntgendiagnostik des Thorax. Fallbeispiele aus der Praxis INSTITUT FÜR ROENTGENDIAGNOSTIK UND KLINIK UND POLIKLINIK FÜR INNERE MEDIZIN I Konventionelle Röntgendiagnostik des Thorax Fallbeispiele aus der Praxis S. Thieler/ J. Rennert Fallbeispiel 1 Patient MT

Mehr