Originalklausur mit Musterlösung

Größe: px
Ab Seite anzeigen:

Download "Originalklausur mit Musterlösung"

Transkript

1 Originalklausur mit Musterlösung Abitur Biologie Aufgabe I: Aufgabe II: Aufgabe III: Homo sapiens / Neandertaler MERFF-Syndrom Lebensgemeinschaft Ameisen / Ameisenpflanzen In den Aufgabenstellungen werden unterschiedliche Operatoren (Arbeitsanweisungen) verwendet; sie weisen auf unterschiedliche Anforderungsbereiche (Schwierigkeitsgrade) hin und bedeuten, dass unterschiedlich viele Punkte erzielt werden können. Die Lösungen zeigen beispielhaft, welche Antworten die verschiedenen Operatoren erfordern. Alles Wissenswerte rund um die Abiprüfung finden Sie im Buch im Kapitel Prüfungsratgeber und Prüfungsaufgaben. Originalklausuren mit Musterlösungen zu weiteren Fächern finden Sie auf in der Rubrik SMS Abi. Das Passwort zum Download befindet sich auf der vorderen Umschlagklappe. Die Veröffentlichung der Abitur-Prüfungsaufgaben erfolgt mit Genehmigung des zuständigen Kultusministeriums. Das Schnell-Merk-System fürs Abi aufschlagen, nachschlagen, merken Buch Prüfungswissen für Oberstufe und Abitur systematisch aufbereitet nach dem SMS-Prinzip Extrakapitel mit Prüfungsaufgaben zu allen Unterrichtseinheiten, zu Operatoren und Anforderungsbereichen und Download Originalklausuren mit Musterlösungen als Beispiele für den Umgang mit Operatoren kostenlos auf Für die Fächer Deutsch, Englisch, Mathematik, Geschichte, Biologie, Chemie, Physik sowie Politik und Wirtschaft

2 BI LK HT 1 Seite 1 von 6 Abiturprüfung 2008 Biologie, Leistungskurs Aufgabenstellung: Thema: Homo sapiens und Neandertaler I.1 Erläutern Sie die Bedeutung der DNA-Sequenzanalyse bei dem Erstellen von Stammbäumen. Werten Sie die in den Materialien A und B angeführten Informationen (Sequenzanalyse, Datierungen, räumliche Zuordnung) aus und entwickeln Sie im Hinblick auf die Verwandtschaftsbeziehungen der Neandertalerpopulationen Hypothesen zur Erklärung der dargestellten Befunde. (18 Punkte) I.2 Beschreiben Sie die PCR-Methode und erläutern Sie vor dem Hintergrund möglicher Untersuchungsaussagen den Einsatz der verschiedenen Primer. Fassen Sie das Ergebnis von Tabelle 2 (Material C) zusammen und erläutern Sie es. (22 Punkte) I.3 Werten Sie die Daten der Materialien D und E aus und diskutieren Sie auch unter Berücksichtigung von Material C, ob die Daten eine schlüssige Aussage bezüglich einer Vermischung oder Nichtvermischung der Neandertaler- und Homo-sapiens- Populationen erlauben. (12 Punkte) I.4 Erläutern Sie die globale Ausbreitung von Homo sapiens unter Hinweis auf DNA- Untersuchungen und Fossilfunde (Material F). Entwickeln Sie eine begründete Stammbaumhypothese zur Evolution von Homo sapiens und von Neandertalern unter Einbeziehung deren Ausbreitung, die von Homo erectus ausgeht, und erörtern Sie die Frage, ob Homo sapiens die Neandertaler in Europa verdrängt haben könnte. (14 Punkte) Zugelassene Hilfsmittel: Wörterbuch zur deutschen Rechtschreibung

3 BI LK HT 1 Seite 2 von 6 Material A: Stand der Forschung 1856 wurden in der Feldhofer Grotte im Neandertal bei Düsseldorf große Teile des Skeletts eines Mannes gefunden. Die deutlichen Unterschiede vor allem in der Anatomie des Schädels führten zu der Erkenntnis, dass es sich um eine ausgestorbene Menschenform (den Neandertaler ) handeln müsse. Das Alter des Skeletts wurde mit einer Radiokarbondatierung auf Jahre bestimmt. Seitdem wurden etwa 300 weitere Überreste von Neandertalern ausschließlich in Europa und Westasien gefunden. Die jüngsten Überreste von Neandertalern sind ca Jahre alt. Inzwischen geht man davon aus, dass es im Zuge der Eis- und Zwischeneiszeiten zu Veränderungen der Areale von verschiedenen Populationen gekommen ist. Material B: Ein neuer Fund aus Spanien 2005 wurde in einer Höhle in El Sidrón in Spanien ein Neandertaler-Oberschenkelknochen ausgegraben. Die Wissenschaftler haben mtdna (Mitochondrien-DNA) aus diesem Knochen untersucht und konnten eine Teilsequenz bestimmen. Tabelle 1 zeigt das Ergebnis im Vergleich zu bisher bekannten mtdna-sequenzen von anderen Fundorten (Abb. 1). Tabelle 1: Anzahl der Basenunterschiede von Neandertaler-mtDNA-Teilsequenzen El Sidrón ( Jahre alt) Düsseldorf ( Jahre alt) Monti Lessini ( Jahre alt) Vindija 77 ( Jahre alt) Mezmaiskaya ( Jahre alt) El Sidrón Düsseldorf Monti Lessini Vindija Mezmaiskaya

4 BI LK HT 1 Seite 3 von 6 Abb. 1: Fundorte von Neandertaler-Fossilien, deren DNA untersucht wurde.

5 BI LK HT 1 Seite 4 von 6 Material C: Verschiedene Primer als Test Um genügend Genmaterial für eine Analyse der DNA aus Fossilien zu gewinnen, wird normalerweise die PCR-Methode (polymerase chain reaction) eingesetzt. Entscheidend ist dabei die Verwendung der richtigen Primer. Der Leipziger Biologe David Serre hat 2004 zwei verschiedene Typen von Primern eingesetzt: Hominoiden-Primer, die auf homologe Mitochondrien-DNA-Stücke von Neandertalern, Homo sapiens und Menschenaffen passen und Neandertaler-Primer, die nach bisherigen Erkenntnissen die Vervielfältigung von Stücken der Neandertaler-DNA ermöglichen. Tabelle 2: DNA-Vervielfältigung mit Hominoiden-Primern und Neandertaler-Primern bei Neandertalern und frühen Homo-sapiens-Funden. Die Angabe 2/3 bedeutet: 2 erfolgreiche Vervielfältigungen bei 3 Versuchsansätzen Neandertaler-Funde Hominoiden-Primer Neandertaler-Primer Vindija 77 (Kroatien) Jahre 3/3 2/3 Engis 2 (Belgien) (Alter bisher nicht feststellbar) 2/3 2/3 La Chapelle-aux-Saints (Frankreich) Jahre 3/3 2/3 Homo-sapiens-Funde Mladec 25 C (Tschechien) Jahre 3/3 0/3 Mladec 2 (Tschechien) Jahre 2/2 0/2 Cro Magnon (Frankreich) Jahre 3/3 0/3 Abri Pataud (Frankreich) Jahre 3/3 0/3 La Madeleine (Frankreich) Jahre 2/3 0/3

6 BI LK HT 1 Seite 5 von 6 Material D: Ergebnisse der mtdna-analyse des Düsseldorfer Neandertalers Der deutsche Wissenschaftler M. Krings und seine Mitarbeiter haben Knochenmark aus dem Skelett des 1856 in der Nähe von Düsseldorf gefundenen Neandertalers untersucht und die Ergebnisse 1997 veröffentlicht. Es gelang ihnen, eine Sequenz zu rekonstruieren, die insgesamt 379 Basenpaare umfasste. Diese Sequenz wurde mit 994 verschiedenen mtdna-sequenzen verglichen, die von heute lebenden Menschen stammten. Auch heute lebende Menschen unterscheiden sich natürlich untereinander in ihren mtdna- Sequenzen. Diesbezügliche Untersuchungen ergaben, dass sich die Europäer um 5 Basen, Asiaten um 6 Basen und Afrikaner um 8 Basen im statistischen Mittel innerhalb der jeweiligen Bevölkerungsgruppe voneinander unterscheiden. Tabelle 3: Anzahl unterschiedlicher Basen der mtdna heute lebender Menschen im Vergleich zu der des Düsseldorfer Neandertalers Anzahl unterschiedlicher Basen Düsseldorfer Neandertaler Europäer 28 Düsseldorfer Neandertaler Ureinwohner Australiens 28 Düsseldorfer Neandertaler Afrikaner 27 Düsseldorfer Neandertaler Ureinwohner Nordamerikas 27 Düsseldorfer Neandertaler Asiaten 28

7 BI LK HT 1 Seite 6 von 6 Material E: Vergleich der mtdna des Düsseldorfer Neandertalers und des Kaukasus-Neandertalers aus Mezmaiskaya Die Analyse der Mitochondrien-DNA (mtdna) eines etwa zwei Monate alten Neandertaler-Säuglings aus der Berghöhle bei Mezmaiskaya im Kaukasus (ca km von Düsseldorf entfernt) konnte im Jahr 2000 durchgeführt werden. Radiokarbonuntersuchungen zeigten, dass der Fund etwa Jahre alt war. Tabelle 4: Anzahl unterschiedlicher Basen der mtdna (Die Längen der untersuchten mtdna- Sequenzausschnitte unterscheiden sich von denen in Material B.) Anzahl unterschiedlicher Basen (Mittelwerte) Neandertaler aus Mezmaiskaya Düsseldorfer Neandertaler 12 Neandertaler aus Mezmaiskaya heute lebende Afrikaner 23 Neandertaler aus Mezmaiskaya heute lebende Asiaten 23 Neandertaler aus Mezmaiskaya heute lebende Europäer 25 Material F: Die Ursprünge von Homo sapiens Homo erectus lebte vor 1,8 Millionen Jahren bis etwa Jahren vor heute in Afrika, Europa und Asien. Neandertaler-Fossilien fand man bisher nur in Europa und Westasien; die jüngsten Fossilien sind ca Jahre alt. Die ältesten Fossilien von Homo sapiens stammen aus Afrika (Äthiopien, Jahre); die ältesten Homo-sapiens-Funde aus Asien (China) sind Jahre alt und die ältesten Homosapiens-Funde in Europa ( Jahre alt) stammen aus Rumänien. Der amerikanische Biologe Allan Wilson veröffentlichte 1987 die Ergebnisse seiner Untersuchungen der Mitochondrien-DNA (mtdna) von 147 heute lebenden Individuen aus Afrika, Asien, Australien, Neuguinea und Europa. Das Ergebnis waren 133 verschiedene Typen von mtdna, die mit mathematischen Methoden in einem Ähnlichkeits-Stammbaum dargestellt werden konnten. Es stellte sich heraus, dass der Stammbaum in zwei Gruppen zerfiel: eine rein afrikanische und eine mit Vertretern aus allen untersuchten Kontinenten. Die afrikanische Gruppe zeigt relativ größere Unterschiede untereinander und ist älter. Das Alter des (weiblichen) gemeinsamen Vorfahren ( Eva ) schätzte Wilson auf ca Jahre.

8 BI LK HT 2 Seite 1 von 5 Abiturprüfung 2008 Biologie, Leistungskurs Aufgabenstellung: Thema: Das MERRF-Syndrom II.1 Begründen Sie, warum x-chromosomale Vererbung des MERRF-Krankheitsbildes, wie in Material C dargestellt, ausgeschlossen ist und eine autosomal rezessive Vererbung wenig wahrscheinlich ist. Erläutern Sie dies anhand geeigneter Falldarstellungen aus Abbildung 1. (16 Punkte) II.2 Beurteilen Sie, inwieweit eine mitochondriale Vererbung durch das Material A bis D abgesichert erscheint, und erklären Sie das Zustandekommen des Krankheitsbildes. (12 Punkte) II.3 Beschreiben Sie kurz die Vorgänge bei der Translation und gehen Sie dabei besonders auf die Rolle der trna ein. Erläutern Sie unter Bezug auf die in Material E dargestellten Erkenntnisse die molekulargenetische Ursache des MERRF- Krankheitsbildes. (24 Punkte) II.4 Stellen Sie dar, welche Inhalte eine genetische Beratung der Schwestern und Brüder der Mutter des Patienten in Material B anlässlich geäußerter Kinderwünsche haben muss. (14 Punkte) Zugelassene Hilfsmittel: Wörterbuch zur deutschen Rechtschreibung

9 BI LK HT 2 Seite 2 von 5 Material A: MERRF-Syndrom und Mitochondrien Beim MERRF-Syndrom, einer recht seltenen Krankheit, wurde nach seiner Entdeckung eine erbliche Komponente zunächst widersprüchlich diskutiert. MERRF bedeutet: Myoclonic epilepsy associated with ragged-red muscle fibers (Muskelschüttelkrämpfe verbunden mit ausgefransten roten Muskelfasern). Aufgrund der Symptome wurden die Mitochondrien in die Untersuchungen einbezogen. Mitochondrien vermehren sich durch eine vom Zellzyklus unabhängige Teilung, die der Zellteilung von Bakterien sehr ähnlich ist. Tatsächlich fand man Mitochondrien mit eingeschränkter Funktion ( defekte Mitochondrien ) in den Gewebszellen von MERRF-Kranken, daneben allerdings auch vollständig intakte Mitochondrien. Denn bei jeder Zellteilung erfolgt eine zufällige Verteilung der Mitochondrien, so dass in den Tochterzellen intakte und defekte Mitochondrien nebeneinander existieren (Heteroplasmie) oder alle Mitochondrien die gleiche Mutation in ihrer DNA tragen (Homoplasmie). Innerhalb eines Gewebes treten entsprechend gesunde Zellen neben krankhaft veränderten auf. Die Krankheit wird erst dann auffällig, wenn der Heteroplasmiegrad im entsprechenden Gewebe 50 80% beträgt. Material B: Patient mit MERRF-Syndrom (gekürzte Schilderung aus einem Patientenforum) Sven ist heute 6½ Jahre alt und die Diagnosesuche ging los, da war er fast 2 Jahre alt und bis wir die Diagnose hatten, gingen ca. 1½ Jahre ins Land. Bei uns war es auch so, dass die Ärzte die Muskelbiopsie, also die Entnahme und Untersuchung von Muskelzellen aus dem Oberschenkelmuskel erstmal nicht machen wollten, aber letztendlich nicht drum herum kamen.... Sven war leider noch ein Frühchen (Frühgeburt) aus der 27. Schwangerschaftswoche und da wurden viele Auffälligkeiten erstmal auf seine Frühgeburt geschoben. Trotzdem fiel auf, dass sich seine Muskulatur wie Wackelpudding anfühlte und auch sehr wenig Muskelgewebe überhaupt da war. Nach allen Seiten drehen konnte er sich erst mit fast 3 Jahren. Es hieß, er würde nie laufen lernen und nie sprechen lernen. Aber, die Ärzte irrten sich, Gott sei Dank. Er lernte sprechen, viel später, aber das ist egal. Und er lernte sogar das freie Laufen mit fast 5 Jahren. Allerdings hat er eine starke Belastungsintoleranz [...] aufgrund des Energiemangels. Kurze Strecken geht er, und für draußen hat er seinen Rolli. Er hat auch immer wieder sehr schlappe Phasen, wo er fast den ganzen Tag nur liegt.

10 BI LK HT 2 Seite 3 von 5 Material C: Stammbaum einer betroffenen Familie Abb. 1: MERRF-Stammbaum, Merkmalsträger sind schwarz dargestellt. Die Personen 3, 6 und 10 stammen aus Familien, in denen das Krankheitsbild nachweislich nie aufgetreten ist. Material D: Mitochondrien in Eizellen, Spermien und verschiedenen Geweben Jedes Spermium besitzt im Halsteil weniger als 50 Mitochondrien, jede Eizelle im Plasma Tausende. Bei der Befruchtung dringt nur der Kopf des Spermiums in die Eizelle ein. Den höchsten Mitochondriengehalt haben die Gewebe, in denen der Sauerstoffbedarf sehr hoch ist, dazu gehören die Skelettmuskulatur (vor allem Arme und Beine), das Gehirn und das Herz. Mitochondrien besitzen eigene DNA, eigene Ribosomen, eigene Proteine und vermehren sich unabhängig vom Zellzyklus. Abb. 2: Größenvergleich Eizelle/Spermium

11 BI LK HT 2 Seite 4 von 5 Material E: Molekulare Ursachen des MERRF-Krankheitsbildes Abb. 3: Karte der mitochondrialen DNA des Menschen. Dargestellt sind der ringförmige DNA-Strang eines Mitochondriums sowie beispielhaft für einige Bereiche die Position der Basen; so codiert z. B. der Bereich von 648 bis 1601 für die kleine Untereinheit der Ribosomen (12s rrna). Beschriftet sind außerdem Bereiche, die für bestimmte Proteine codieren, z. B. ND für NADH-Dehydrogenase und CO für Cytochrom c-oxidase, beides Enzyme, die an der Energiebereitstellung beteiligt sind. Zusätzlich erkennt man, welche Bereiche in trna transkribiert werden, so steht z. B. K für die trna Lysin und G für die trna Glycin.

12 BI LK HT 2 Seite 5 von 5 Genom: Homo sapiens, Mitochondrium, Positionen normal: CACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGA MERRF: CACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAGCCAACACCTCTTTACAGTGA Abb. 4: Ausschnitt aus der mitochondrialen DNA eines Gesunden und eines an MERRF Erkrankten Prozentzahl vollständiger Proteine (Vergleich mit Gesundem) Dargestellt ist der Prozentsatz vollständiger Proteine in den Mitochondrien eines MERRF-Kranken (verglichen mit einem gesunden Menschen) und zwar in Abhängigkeit von der Anzahl des in den Proteinen vorhandenen Aminosäurebausteins Lysin. Die Kurve stellt einen mathematischen Zusammenhang dar, der hier nicht berücksichtigt werden muss. Anzahl der Lysin-Bausteine im fertigen Protein Abb. 5: Proteine in Mitochondrien eines MERRF-Kranken. Außer den in Abbildung 5 angeführten Proteinen findet man in den Mitochondrien Erkrankter ein sogenanntes MERRF-Protein. Es handelt sich dabei um unvollständige Reste des Proteins COI; auch fand man unvollständige Reste des Proteins ND2 in hoher Konzentration in MERRF-Mitochondrien.

13 BI LK HT 3 Seite 1 von 7 Abiturprüfung 2008 Biologie, Leistungskurs Aufgabenstellung: Thema: Eine Lebensgemeinschaft von Ameisen und Ameisenpflanzen III.1 Fassen Sie die in den Materialien A und B dargestellten Ergebnisse der durchgeführten Versuche zusammen. (18 Punkte) III.2 Begründen Sie mit Hilfe der Materialien A und B, dass es sich bei der Lebensgemeinschaft von Ameisen und den verschiedenen Ameisenpflanzen um eine Symbiose entsprechend der in Material C angegebenen Definition handelt. Diskutieren Sie diese Lebensgemeinschaften vor dem Hintergrund von Aufwand und Nutzen. (22 Punkte) III.3 Fassen Sie die Aussagen der Abbildungen 3, 4 und 5 aus Material D zusammen und erläutern Sie mit Hilfe der Abbildung 6 und unter Einbezug aller Materialien, auf welche Weise die Produktion von Blattnektar über den Fraßdruck reguliert wird. Erklären Sie die biologische Funktion dieses Regulationsmechanismus in Bezug auf Aufwand und Nutzen. (26 Punkte) Zugelassene Hilfsmittel: Wörterbuch zur deutschen Rechtschreibung

14 BI LK HT 3 Seite 2 von 7 Material A: In Südostasien, speziell in West-Malaysia und auf Borneo, ist die Baumgattung Macaranga beheimatet. Auf vielen dieser Macaranga-Bäumen leben Ameisenkolonien der Gattung Crematogaster. Es handelt sich bei den Bäumen um ein Beispiel von so genannten Ameisenpflanzen. Das Verhalten dieser Ameisen gegenüber Insekteneiern und Raupen wird in Tabelle 1 dargestellt. Außerdem kappen sie die Ranken von Schlingpflanzen, sobald diese ihren Wirtsbaum berühren. Viele Macaranga-Bäume produzieren auf ihren Blättern so genannten extrafloralen Nektar (Blattnektar), der nicht der Anlockung von bestäubenden Insekten dient, sondern eine Nahrungsquelle für Ameisen, Wespen und andere räuberische Insekten darstellt. Außerdem werden Futterkörperchen von diesen Bäumen produziert. Sie werden von diesen Bäumen von ihren Nebenblättern als spezielle Produkte gebildet. Als fakultative Ameisenpflanzen bezeichnet man solche, die nur zum Nahrungserwerb besucht werden. Als obligate Ameisenpflanzen bezeichnet man Arten, die dauerhaft bewohnt werden. Versuch 1 In einem Versuch untersuchte man das Verhalten von Ameisen auf einer obligaten Ameisenpflanze. Tabelle 1: Untersuchungen zum Verhalten von Ameisen gegenüber Eiern von Insekten, Raupen und Futterkörperchen nach ihrer Entdeckung Eier von Insekten 90 % wurden von den Ameisen von den Blättern entfernt, keine Nahrungsquelle Raupen 80,5 % wurden von den Ameisen durch Bisse vertrieben, keine Nahrungsquelle Futterkörperchen wurden von den Ameisen gefressen

15 BI LK HT 3 Seite 3 von 7 Versuch 2 Eine Analyse der chemischen Zusammensetzung der Futterkörperchen unterschiedlicher fakultativer und obligater Ameisenpflanzen wurde durchgeführt. Ziel war es, die Bedingungen zu ermitteln, nach denen Ameisen obligate Pflanzen auswählen. Tabelle 2: Chemische Zusammensetzung und Energiegehalt der Futterkörperchen verschiedener obligater und fakultativer Ameisenpflanzen Pflanzenarten Vergesellschaftung Pflanze/ Ameise Kohlenhydrate (mg/g Frischgewicht) Proteine (mg/g Frischgewicht) Lipide (mg/g Frischgewicht) Energiegehalt (kj/g Frischgewicht) Macaranga triloba obligat 10,3 15,9 146,9 6,0 M. hullettii obligat 19,7 17,8 156,4 6,6 M. hosei obligat 22,4 21,8 91,5 4,2 M. tanarius fakultativ 39,3 6,1 82,6 3,9 Pseudomyrmextricuspidata fakultativ 14,8 6,0 5,0 0,5

16 BI LK HT 3 Seite 4 von 7 Material B: Versuch 3 Es wurde eine Langzeitstudie bei Pflanzen der Art Macaranga triloba durchgeführt, bei der während eines Jahres das relative Blattwachstum bzw. der relative Blattverlust bedingt durch pflanzenfressende Insekten untersucht wurden. Untersucht wurden Pflanzen, die von Ameisen bewohnt waren und solche ohne Ameisen. Die Ergebnisse dieser Studie werden in der folgenden Abbildung 1 dargestellt. 400 Macaranga triloba in Anwesenheit von Ameisen ohne Anwesenheit von Ameisen Nummer des Pflanzenpaares kennzeichnet eine Versuchspflanze, die während der Versuchsdauer wieder besiedelt wurde. Werte von zwei vergleichbaren Pflanzen (eine mit, eine ohne Ameisen) wurden nebeneinander gezeichnet und bilden ein Paar. Abb. 1: Relatives Blattwachstum bzw. relativer Blattflächenverlust (Zuwachs bzw. Verzehr durch pflanzenfressende Insekten bezogen auf einen Durchschnittswert) von Pflanzen der Art Macaranga triloba innerhalb eines Jahres mit und ohne Ameisen

17 BI LK HT 3 Seite 5 von 7 Versuch 4 Bei einem weiteren Versuch wurde bei jeweils 30 Ameisenpflanzen die Ausbildung von zusätzlichen Futterkörperchen angeregt (+ Futterkörperchen) bzw. entfernt (- Futterkörperchen) oder die Pflanzen wurden nicht manipuliert (Kontrolle). Nach 30 Tagen wurden die Anzahl der Ameisen und die Altersstruktur der Ameisenpopulation (Eier, Larven, Puppen) bestimmt (Abb. 2). Abb. 2: Abhängigkeit einer Ameisenkolonie von dem Vorhandensein bzw. Fehlen der Futterkörperchen Material C: In einem Schulbuch findet man folgende Definition für ein Beispiel einer interspezifischen Beziehung: Ein Symbiose ist eine Beziehung zwischen artverschiedenen Lebewesen, die für beide Partner vorteilhaft und durch enges räumliches Zusammenleben gekennzeichnet ist.

18 BI LK HT 3 Seite 6 von 7 Material D: In einem Experiment wurden 30 von Ameisen besiedelte Ameisenpflanzen sechs Wochen lang alle vier Tage mit Jasmonsäure besprüht, durch Fraß oder gezielt mit Nadelstichen beschädigt. Jasmonsäure ist ein Stoff, der in Pflanzen produziert wird und verschiedene Reaktionen bewirkt. Jasmonsäure kann auch in Experimenten auf die Pflanzen gesprüht werden und wirkt dann ebenfalls. Die Ergebnisse des Experiments zeigen Abb. 3, 4 und 5. Abb. 3: Nektarproduktion von Macaranga tanarius unter verschiedenen Bedingungen (Nektar: ausgeschiedener, stark zuckerhaltiger Pflanzensaft) Kontrolle: Pflanzen wurden nicht behandelt Sprüh-Kontrolle: die Pflanzen wurden nur mit dem Lösungsmittel und nicht mit Jasmonsäure besprüht Künstlicher Schaden: die Pflanzen wurden gezielt mit Nadelstichen beschädigt (Löcher) Fraß: man lässt Insekten fressen Jasmonsäure: wurde aufgesprüht Abb. 4: Auswirkung von einer mechanischen Beschädigung und einer Behandlung mit Jasmonsäure auf Fraßschäden durch pflanzenfressende Insekten. Die von Ameisen besiedelten Pflanzen wurden erst mit Jasmonsäure behandelt bzw. künstlich beschädigt. Anschließend wurde das Ausmaß an Fraßschäden ermittelt. Kontrolle: Die untersuchten Pflanzen wurden nicht behandelt bzw. nicht beschädigt.

19 BI LK HT 3 Seite 7 von 7 Abb. 5: Anzahl der auf mit Jasmonsäure behandelten und auf Kontrollpflanzen auftretenden räuberischen Insekten und nektarsuchenden Insekten (z. B. Ameisen) Abb. 6: Regulation der Blattnektar-Produktion von Ameisenpflanzen: Dargestellt sind die relative Konzentration an der von der Pflanze selbst im Gewebe gebildeten Jasmonsäure, die relative Menge des von der Pflanze gebildeten Nektars, die relative Anzahl der Raupen, die relative Anzahl der Ameisen, die relative Anzahl der Futterkörperchen sowie das Wachstum der Knospen in Symbolen.

20 Musterlösungen für die Prüfungsaufgaben Abitur Prüfungsfach: Biologie (Nordrhein-Westfalen 2008) Autor: Elke Schindler I. Aufgabe I: Homo sapiens und Neandertaler I.1 Bei einer DNA-Sequenzanalyse wird die exakte Reihenfolge der Nucleotide in einem DNA- Strang durch Sequenzierung ermittelt. Der Vergleich von DNA-Sequenzen z. B. mitochondrialer DNA kann ziemlich genau Aufschluss darüber geben, ob zwei Arten miteinander verwandt sind und wenn mehrere Arten oder Gruppen verglichen werden, welche näher miteinander verwandt sind als andere. Der Verwandtschaftsgrad wird dabei an Basen- bzw. Nucleotidunterschieden festgemacht. Jedoch ist sie als einzige Methode nicht ausreichend um Stammbäume zu erstellen, denn dies würde eine konstante Mutationsrate und damit konstante Austauschrate von Nucleotiden voraussetzen. Es scheint aber, dass die Mutationsrate unter wechselnden äußeren Bedingungen variabel ist. Daher erlaubt die DNA- Sequenzanalyse anhand der Basenunterschiede nur quantitative Aussagen wie näher verwandt oder nicht näher verwandt, nicht aber Aussagen darüber, wann sich z. B. verschiedene systematische Gruppen aufgespalten haben. Erst wenn beides bekannt ist, kann ein Stammbaum aufgestellt werden. Deshalb benötigt man zusätzlich zu DNA- Sequenzanalysen i. d. R. auch Fossilien, anhand derer die zeitliche Abfolge des Auftretens neuer Merkmale mithilfe von morphologischen Untersuchungen und Altersbestimmungen nachvollzogen werden kann. Die Fundorte der Neandertaler-Fossilien sind ausschließlich auf Europa und Westasien verteilt. Die jüngsten Überreste sind Jahre alt, die ältesten der in Material B untersuchten Neandertaler sind Jahre alt. Insgesamt gesehen sind die Basenunterschiede in den untersuchten mtdna-sequenzen mit 1 bis maximal 8 Basen Unterschied recht gering. Der größte Basenunterschied besteht zwischen dem ältesten (Monti Lessini, Jahre alt) und dem jüngsten Fund (Mezmaiskaya, Jahre alt). Ähnlich alte Funde haben nur wenige Basen Unterschied. Man könnte annehmen, dass z. B. die Funde von El Sidrón, Düsseldorf und Vindija, die ähnlich alt sind und sich nur durch 1 oder 2 Basen unterscheiden, ursprünglich einer Population entstammen, von der Teilpopulationen z. B. in Zwischeneiszeiten nach Norden gezogen bzw. bei Eintritt einer Eiszeit nach Süden gezogen sind. Zumindest scheinen die Individuen aus diesen drei Fundorten näher miteinander verwand zu sein, als mit den beiden Funden aus Monti Lessini und Mezmaiskaya und auch als die beiden Letzeren untereinander. Dafür spricht auch, dass sie mit 43000, und Jahren ähnlich alt sind. Dudenverlag, Bibliographisches Institut & F. A. Brockhaus AG, Mannheim,

21 I.2 Die Polymerase-Kettenreaktion ist eine Methode, die zur Vervielfältigung von DNA-Abschnitten eingesetzt wird, aber auch zum Nachweis bestimmter Gensequenzen. Hierzu wird die zu untersuchende doppelsträngige DNA bei 94 C denaturiert und in die Einzelstränge gespalten. Nach Abkühlung auf 50 C wird ein Primer zugesetzt, das ist ein künstlich hergestellter Polynucleotidabschnitt mit der komplementären Basensequenz des gesuchten DNA-Abschnitts. Will man eine bestimmte Gensequenz nachweisen, benötigt man zwei Primer, mit denen man Anfang und Ende des zu kopierenden Abschnitts festlegt. Die Primer heften sich an die nachzuweisende DNA-Sequenz an und nach Zugabe von DNA-Polymerase und Nucleotiden stellt die DNA-Polymerase eine Kopie der Ausgangs-DNA her. Dieser Zyklus aus Denaturierung, Zugabe und Bindung des Primers sowie DNA-Synthese wird so oft wiederholt, bis eine analytisch messbare Menge der gesuchten DNA-Sequenz vorhanden ist. In den Versuchen in Material C wurden von den zu testenden DNAs jeweils zwei Ansätze mit zwei verschiedenen Primern gefahren. Der Hominoiden-Primer ist komplementär zu Stücken aus der mtdna von Neandertaler, Homo sapiens und Menschenaffen und ermöglicht so deren Vervielfältigung. Der Neandertaler-Primer hingegen ist nach bisherigen Kenntnisstand nur komplementär zu Stücken aus der Neandertaler-mtDNA, d. h. man kann mit ihm ganz spezifisch diese Neandertaler-DNA vervielfältigen, nicht aber z. B. DNA von Homo sapiens. Mit jedem der acht Funde (drei Neandertaler-Funde und fün Homo sapiens-funde) wurden mit jedem der Primer je drei Ansätze gefahren und notiert, bei wie viel Ansätzen es zur Vervielfältigung kam. Alle Ansätze mit dem Hominoiden-Primer zeigten bei mindestens zwei der drei Ansätze Vervielfältigungen, egal ob es sich um Neandertaler- oder Homo sapiens-funde handelt. Dieses Ergebnis war zu erwarten, da dieser Primer auf homologe mtdna-stücke von Neandertaler und Homo sapiens (und Menschenaffen) passt. Beim Einsatz des Neandertaler-Primers zeigt sich ein anderes Bild: Bei den Neandertaler- Funden kommt es bei zwei von drei Ansätzen zu Vervielfältigungen. Bei den Homo sapiens Funden hingegen kommt es bei keinem der Ansätze zu einer Vervielfältigung. Dieses Ergebnis ist eindeutig und es bestätigt, dass die dem Neandertaler zugeordneten Funde auch wirklich Neandertaler sind und die Homo sapiens zugeordneten Funde auf jeden Fall keine Neandertaler sind, da der Primer spezifisch nur auf Neandertaler-mtDNA anspricht. I.3 Die Anzahl der Basenunterschiede zwischen Neandertaler und heute lebenden Menschen aller Kontinente liegen durchweg bei 27 bzw. 28 Basen. Hingegen liegen die Basenunterschiede zwischen den untersuchten Gruppen der heute lebenden Menschen bei fünf bis acht Basen, sind also deutlich geringer. Ein ähnliches Bild zeigte sich ja beim Vergleich der mtdna-teilsequenzen der Neandertaler aus den verschiedenen europäischen Fundorten (Material B). Auch bei ihnen beträgt die Zahl der unterschiedlichen Basen maximal acht, bei drei Gruppen untereinander sogar nur eins bis zwei Basen. Allerdings kann dies auch an der Länge der Teilstücke liegen, denn in Material E wurden immerhin 12 unterschiedliche Basen zwischen einem Neandertaler aus Düsseldorf und einem aus dem Kaukasus festgestellt. Dies ist aber immer noch höchstens die Hälfte der Unterschiede zwischen Neandertaler und Homo sapiens. Zwar kann aufgrund der Daten nicht vollkommen ausgeschlossen werden, dass es eine Vermischung von Neandertaler- und Homo-sapiens-Populationen gab, doch fand sie vermutlich, wenn überhaupt, nur in äußerst geringem Ausmaß statt bzw. führte nicht dazu, dass sich bedeutendere Mengen Neandertaler-DNA im Homo-sapiens-Erbgut wiederfinden. Selbst wenn es zu sexuellen Kontakten gekommen sein kann, ist es möglich, dass daraus entweder keine Nachkommen entstehen konnten (im Sinne einer Artbarriere zwischen Neandertaler und Homo sapiens) oder eventuelle Hybride von Neandertaler und Homo sapiens waren steril und das Erbgut konnte deshalb nicht an weitere Generationen weitergegeben werden. Außerdem muss auch berücksichtig werden, dass die in den Materialien betrachteten Basenunterschiede sich auf die mtdna beschränken. Dies ist ein geringer Teil der Gesamt-DNA, der zudem nur maternal vererbt wird. Um wirklich Dudenverlag, Bibliographisches Institut & F. A. Brockhaus AG, Mannheim,

22 verbindliche Aussagen treffen zu können, müssen die Ergebnisse weiterer Untersuchungen von Neandertaler und Homo-sapiens-DNA abgewartet werden. I.4 Globale Ausbreitung von Homo sapiens: Aus Material F geht hervor, dass aufgrund von Untersuchungen der mtdna die Linie des modernen Homo sapiens vor rund Jahren in Afrika entstanden ist. Davon ist eine Gruppe in Afrika verblieben, eine andere verließ Afrika und besiedelte die anderen Kontinente. Wann das geschah, geht aus dem Material nicht hervor. Sicher ist danach nur, dass Asien früher besiedelt wurde (älteste Funde in China Jahre alt) als Europa (älteste Funde Jahre alt). Dass die afrikanische Gruppe untereinander größere Unterschiede zeigt, als die über alle Kontinente verstreute Gruppe, lässt zumindest darauf schließen, dass die Auswanderungswelle erst deutlich später stattfand. Denn, bei Annahme einer konstanten Mutationsrate, sind die Basenunterschiede innerhalb einer Gruppe umso größer, je älter sie ist, je länger also Zeit für das Entstehen von Mutationen war. Wenn sich z. B. die Auswanderungsgruppe erst Jahre nach Entstehen des modernen Homo sapiens aufmachte, sich über die Erde verstreute und sich dabei wiederum in Populationen aufspaltete, die die verschiedenen Kontinente besiedelten, dann hatte deren mtdna nur Jahre (bis heute) Zeit, um untereinander wiederum Unterschiede zu entwickeln, sie sind demnach untereinander ähnlicher als mit ihrer afrikanischen (Stamm)Gruppe. Stammbaumhypothese: Aus Homo erectus, der bis vor rund Jahren in Afrika, Europa und Asien lebte entwickelten sich sowohl eine Linie, aus der später der Neandertaler hervorging, als auch eine Linie, aus der Homo sapiens hervorging. Diese Abspaltung geschah früh. Aus der Homo sapiens-linie spalteten sich dann von der (älteren) afrikanischen Gruppe die Gruppen ab, die auswanderten und nach und nach alle Kontinente besiedelten, wobei Letztere untereinander ähnlicher sind, als mit der (ursprünglichen) afrikanischen Gruppe, aus der sie stammen. Aus den Daten in Material B, D und E kann interpretiert werden, dass sich Neandertaler und Homo sapiens nicht oder nicht nennenswert miteinander vermischten. Sie müssen aber andererseits zumindest eine gewisse Zeit (Material F) gleichzeitig in Europa gelebt haben. Daher liegt es durchaus im Bereich des Möglichen, dass die Neandertaler von Homo sapiens in Europa verdrängt wurde. Wie dies geschehen sein soll, geht aus dem Material nicht hervor. Es gibt verschiedene Möglichkeiten: z. B. könnte Homo sapiens letztlich sich besser an das sehr wechselhafte Klima (Eiszeiten und Zwischeneiszeiten, Material A) angepasst und dadurch einen größeren Fortpflanzungserfolg gehabt haben. Homo sapiens könnte, zumindest regional, die erfolgreichere Art im Kampf um eventuell begrenzte Ressourcen gewesen sein und dadurch wiederum einen höheren Fortpflanzungserfolg gehabt haben. Vielleicht war aber auch insgesamt die Fortpflanzungsrate von Homo sapiens (artbedingt) höher als die der Neandertaler; vielleicht starben die Neandertaler aber auch aus, weil sie sich nicht dauerhaft an die Klimaschwankungen oder rauen Klimaverhältnisse so anpassen konnten, dass sie sich ausreichend fortpflanzen konnten. II. Aufgabe II: Das MERRF-Syndrom II.1 Bei Betrachtung des Stammbaums in Material C, fällt auf den ersten Blick auf, dass, wenn die Mutter am MERRF-Syndrom erkrankt ist, alle Nachkommen erkrankt sind, ist die Mutter gesund (Person 10), dann sind alle Nachkommen gesund. Da männliche und weibliche Nachkommen bei einer kranken Mutter gleichermaßen erkranken, müsste bei einer X-chromosomalen Vererbung der Erbgang dominant sein, sonst würden nicht alle weiblichen Nachkommen erkranken. Im Falle der Nachkommen der Eltern 9 und 10 sind die Nach- Dudenverlag, Bibliographisches Institut & F. A. Brockhaus AG, Mannheim,

23 kommen jedoch alle gesund, das aber kann überhaupt nur möglich sein, wenn der Erbgang rezessiv wäre. Daher ist eine X-chromosomale Vererbung auszuschließen. Ein autosomal rezessiver Erbgang kann eigentlich auch nicht vorliegen. Die Symptomträger müssten auf jeden Fall homozygot in Bezug auf das Merkmal sein, sonst hätten sie keine Symptome (ein krankes rezessives Allel wird durch ein gesundes dominantes kompensiert). Und wenn sicher ist, dass in den Familien der Personen 3,6 und 10 niemals das Krankheitsbild aufgetreten ist, sollte man davon ausgehen, dass diese Personen das kranke Allel überhaupt nicht besitzen. Dies aber wäre Voraussetzung, dass die Personen 3 und 4 sowie 6 und 7 überhaupt kranke Nachkommen haben, denn diese müssten ja wieder homozygot in Bezug auf das Merkmal sein, das kranke Allel also von beiden Eltern geerbt haben, was nach den vorliegenden Angaben nicht wahrscheinlich ist. Ein autosomal rezessiver Erbgang ist also ebenfalls weitgehend auszuschließen. II.2 Für eine mitochondriale Vererbung sprechen folgende Indizien: Mitochondrien spielen auf jeden Fall eine Rolle beim MERRF-Syndrom, denn wie aus Material A hervorgeht, wurden beim MERRF-Kranken defekte Mitochondrien gefunden, wobei die Krankheit erst auffällig wird, wenn der Anteil der defekten Mitochondrien im Gewebe mindestens 50 % beträgt. Mitochondrien besitzen eine eigene DNA, eigene Ribosomen und eigene Proteine und sie vermehren sich unabhängig vom Zellzyklus (Material D). In der mitochondrialen DNA können Mutationen entstehen, die dann bei der Teilung der Mitochondrien weitergegeben werden, sodass neben intakten auch defekte Mitochondrien gebildet werden. Da bei der Zellteilung die Mitochondrien zufällig auf die Tochterzellen verteilt werden (Material A), erklärt sich daraus die Tatsache, dass bei MERRF-Kranken in unterschiedlichem Verhältnis intakte und defekte Mitochondrien nebeneinander gefunden werden (Heteroplasmie). Mitochondrien sind besonders zahlreich in der Skelettmuskulatur (insbesondere der Arme und Beine) sowie im Gehirn und im Herz (Material D). Das erklärt sich daraus, dass Mitochondrien als Kraftwerke der Zelle für die Bereitstellung von Energie aus dem oxidativen Abbau (Atmungskette) zuständig sind und die betreffenden Gewebe einen sehr hohen Energiebedarf haben, den sie vorwiegend bis ausschließlich (Herz, Gehirn) aus dem oxidativen Abbau decken. MERRF-Kranke haben vor allem Probleme mit der Muskulatur (ausgefranste rote Muskelfasern und insgesamt wenig Muskelgewebe, das sich weich anfühlt, Material A und B). Außerdem haben sie neurologische Probleme (Muskelkrämpfe, Material A) und sie haben Probleme mit der (ausreichenden) Energiebereitstellung für jedwede Muskelarbeit (Material B). Diese Symptome sind mit einem mitochondrialen Defekt sehr gut in Einklang zu bringen. Aus allen Verbindungen, in denen die Mütter erkrankt waren, gehen ausschließlich kranke Nachkommen hervor. Aus Material D ist zu entnehmen, dass die Eizelle Tausende von Mitochondrien besitzt, das Spermium jedoch nur weniger als 50. Und diese wenigen Mitochondrien kommen bei der Befruchtung nicht in die Eizelle, da sie im Halsteil des Spermium sitzen, bei der Befruchtung jedoch nur der Kopf des Spermiums in die Einzelle dringt. Sind die Mitochondrien der Eizelle defekt, wird dies in jedem Fall auf alle Nachkommen vererbt, denn ein maternaler Erbgang folgt nicht den mendelschen Regeln. Ob die Krankheit dann auffällig wird oder nicht, hängt nur noch vom Anteil der defekten Mitochondrien in den betroffenen Geweben ab (Material A) und diese werden ungleichmäßig auf die Gewebe des Embryos verteilt, da die Verteilung der Mitochondrien bei der Zellteilung zufällig erfolgt. II.3 Bei der Translation werden die Basentripletts der mrna in die Aminosäuresequenz übersetzt und die entstehenden Aminosäuren in der vorgegebenen Reihenfolge aneinander geknüpft. Die Translation findet an den Ribosomen statt und für die Anlieferung der jeweils richtigen Aminosäure sorgt die trna. Für jedes mögliche Basentriplett gibt es eine passende trna, die am einen Ende ein dem Codon der mrna entsprechendes Basentriplett trägt, das Dudenverlag, Bibliographisches Institut & F. A. Brockhaus AG, Mannheim,

24 Anticodon. Am anderen Ende der trna wird bei Bedarf die dazu passende Aminosäure angehängt. Dies wird katalysiert durch das Enzym Aminoacyl-tRNA-Synthetase. Dieses Enzym hat eine sehr hohe Substratspezifität. Die eindeutige Zuordnung der trna wird durch die Komplementarität von Codon und Anticodon gewährleistet. Ein Ribosom besteht aus zwei Untereinheiten, von denen die kleinere Untereinheit die mrna gebunden wird, während die größere Untereinheit die katalytische Aktivität für die Ausbildung der Peptidbindung zur Verfügung stellt. Sie besitzt drei Bindungsstellen für die trna (A, P und E-Stelle), wobei immer zwei Bindungsstellen besetzt sind. An ein mrna-molekül lagern sich immer mehrere Ribosomen an, sodass immer zeitgleich mehrere Polypeptide synthetisiert werden. Diese Komplexe aus mehreren nebeneinander liegenden Ribosomen werden als Polysomen bezeichnet. Die wachsende Polypeptidkette beginnt schon am Ribosom damit, sich zur Sekundär- und Tertiärstruktur zu falten. Die Translation wird in drei Phasen unterteilt, die Initiation, Elongation und Termination bezeichnet werden: 1. Initiation: Die Bildung des Initiationskomplexes wird durch das Startcodon AUG initiiert. Hierbei vereinigen sich mrna, die erste trna (beladen mit Methionin) sowie die Untereinheiten des Ribosoms. Dabei ist die Met-tRNA an der Peptidylbindungsstelle (= P- Stelle) lokalisiert, das ist die mittlere der Bindungsstellen. 2. Elongation: An der Aminoacyl-Bindungsstelle (= A-Stelle) kommt es zur Codon-Anticodon-Paarung zwischen mrna und trna. Von der trna auf der P-Stelle (im ersten Durchgang Met) wird der Aminosäurerest (später die wachsende Peptidkette) auf die Aminosäure der trna in der A-Stelle übertragen (Peptidyltransfer). Dann kommt es zur Translokation, d. h. die neu beladene Peptidyl-RNA rückt mit der mrna von der A-Stelle ein Triplett weiter auf die P-Stelle und die vorher entladene trna rückt auf die E-Stelle, wo sie wieder freigegeben wird. Nun wird die frei gewordene A-Stelle durch die nächste trna besetzt und ein neuer Zyklus der Elongation beginnt. 3. Termination: Kommt eines der Stoppcodons (UAA, UAG, UGA) an die A-Stelle, dann wird die Proteinsynthese abgebrochen, das gebildete Protein freigesetzt und die Untereinheiten des Ribosoms trennen sich wieder. Wie aus Material E Abb. 3 und 4 hervorgeht, liegt beim MERRF-Syndrom eine Punktmutation der mitochondrialen DNA vor, die für die trna für Lysin codiert. Hierbei ist ein Adenin durch ein Guanin ersetzt. Die Folge ist, dass die trna für Lysin funktionsunfähig ist und die Folge davon ist, dass bei der Proteinbiosynthese (die Mitochondrien haben eine eigene Proteinbiosynthese) in die Proteine kein Lysin eingebaut wird. Dadurch werden die Proteine jedoch verändert bzw. unvollständig und zwar umso mehr, je höher der Lysinanteil im Protein ist. Dies geht aus der Abb. 5 hervor, in welcher der Anteil vollständiger Proteine in Prozent in Abhängigkeit von der Anzahl der Lysin-Bausteine im fertigen Protein aufgetragen ist. Die Ergebnisse entstammen den Mitochondrien eines MERRF-Kranken und der Anteil in Prozent vollständigen Proteins wird verglichen mit dem Anteil an vollständigen Proteinen eines Gesunden. Hierbei zeigt sich, dass der Ausfall der Lysin-Bausteine verheerende Folgen hat. Bereits bei etwa zwei Lysinbausteinen (Protein: NADH-Dehydrogenase 6) führt der Defekt dazu, dass nur noch etwa 60 % der gebildeten Proteine vollständig sind, bei etwa drei Lysinbausteinen sind nur noch 30 % vollständig (dies betrifft z. B. die Cytochrom-C-Oxidase III und die NADH-Dehydrogenase 3) und bei zehn Lysinbausteinen im Proteinmolekül (Cytochrom-C-Oxidase I) sind nur noch 10 % der gebildeten Proteine vollständig. Bei Proteinen, die noch mehr Lysin-Bausteine enthalten geht der Anteil der vollständigen Proteine gegen Null. Die betroffenen Enzyme, im Wesentlichen NADH-Dehydrogenasen und Cytochrom-C- Oxidasen, sind wichtige Enzyme der Atmungskette und damit essentiell für die Energiebereitstellung im Organismus. Dies erklärt auch die in Material B geschilderten Symptome. II.4 Den Brüdern der Mutter kann gesagt werden, dass sie bedenkenlos eigene Kinder bekommen können, selbst wenn sie selber vom MERRF-Syndrom betroffen sein sollten. Dies aus dem Grund, dass hier aufgrund der mitochondrialen Vererbung ein rein maternaler Erbgang vorliegt und Männer die Krankheit nicht weiter vererben können. Dudenverlag, Bibliographisches Institut & F. A. Brockhaus AG, Mannheim,

25 Bei den Schwestern der Mutter sollte vor der genetischen Beratung nach Anzeichen der Erkrankung gesucht werden: Muskelbiobsie mit Suche nach Cytochrom-C-Oxidase-negativen Muskelfasern und Aussehen der Muskelfasern (ragged-red muscle fibers), Laktatwerte im Blut (denn wenn der oxidative Energiestoffwechsel gestört ist, läuft die Energiegewinnung verstärkt über anaerobe Glykolyse höhere Laktatproduktion). Unabhängig von der Schwere der Erkrankung bei den Schwestern sollte ihnen Folgendes mitgeteilt werden: - der Nachweis der Erkrankung, v. a. in leichten Fällen ist schwierig, da Heteroplasmie vorliegt, also verschiedene Gewebe unterschiedlich stark betroffen sind. - der Erbgang ist maternal, d. h., wenn die Frau betroffen ist, vererbt sie die Krankheit. - Die Heteroplasmie durch die zufällige Verteilung der Chromosomen bei Zellteilungen macht die Einschätzung schwer, wie hoch das Risiko für die Nachkommen jeweils ist. Das Ausmaß der Erkrankung bei der Mutter lässt letztendlich keine Rückschlüssen darauf zu, wie sie bei ihren Kindern zum Ausbruch kommen wird. - Eine pränatale Diagnostik ist wenig aussagekräftig, da infolge der Heteroplasmie in den verschiedenen Geweben unterschiedliche Anteile an mutierter mitochondrialer DNA vorhanden sind. Es ist also sowohl bei der Chorionzottenbiopsie als auch bei der Amniozentese vom Zufall abhängig, ob mutierte DNA gefunden wird oder nicht und dies lässt keine verlässliche Aussage darüber zu, ob und wie stark der Fötus von der Mutation betroffen ist. -Entscheiden sich die Schwestern dafür, auch bei bestehendem Risiko eigene Kinder zu bekommen, sollten sie über Möglichkeiten der Früherkennung informiert werden bzw. auch den zuständigen Arzt über ihr Risiko informieren, damit notwendige medizinische Behandlungen möglichst frühzeitig einsetzen können. III. Aufgabe III: Eine Lebensgemeinschaft von Ameisen und Ameisenpflanzen III.1 In Tabelle 1 von Material A ist das Verhalten von Ameisen gegenüber Fressfeinden der von den Ameisen besiedelten Pflanze dargestellt und gegenüber den von der Pflanze produzierten Futterkörperchen. Es zeigt sich, dass die Ameisen sowohl die Eier von Insekten (die schlüpfenden Larven könnten die Pflanze befressen) als auch Raupen fast vollständig, nämlich zu 90 % bzw. 80,5 % von der Pflanze durch Beißen vertreiben, wobei beide keine Nahrungsquelle für die Ameisen darstellen. Die Ameisen handeln hier also vordergründig im Interesse der Pflanze. Gleiches gilt im Übrigen für das Kappen der Ranken von Schlingpflanzen. Auch diese sind keine Nahrungsquelle für die Ameise, könnten jedoch ihre Pflanze gefährden, indem sie sie zuwuchern. Die von der Pflanze produzierten Futterkörperchen hingegen werden von den Ameisen gefressen. Aus Tabelle 2, Material A geht nun hervor, dass die Zusammensetzung und der Energiegehalt der von verschiedenen Ameisenpflanzen produzierten Futterkörperchen einen Einfluss darauf hat, ob die Ameisen eine Pflanze dauerhaft besiedeln (obligate Ameisenpflanze) oder sie nur zum Nahrungserwerb besuchen (fakultative Ameisenpflanze). Die Tabelle zeigt die Gehalte an Kohlenhydraten, Proteinen und Lipiden (in mg/g Frischgewicht) sowie den Energiehalt (in kj/g Frischgewicht) von fünf verschiedenen Pflanzenarten und den Charakter der Vergesellschaftung zwischen Ameise und Pflanze. Die Ergebnisse zeigen, dass insbesondere der Proteingehalt ausschlaggebend dafür ist, ob die Pflanze eine obligate oder eine fakultative Ameisenpflanze ist. Alle obligaten Pflanzen zeigen einen Proteingehalt, der den 2,5- bis 3,5-fachen Wert der fakultativen Pflanzen hat. In zweiter Linie scheint der Lipidgehalt eine Rolle zu spielen, denn die obligaten Pflanzen haben deutlich höhere Lipidgehalte als die fakultativen. Die Unterschiede sind recht groß, ein relativ niedrigerer Lipidgehalt bei Macaranga hosei scheint durch den im Vergleich höheren Gehalt an Proteinen ausgeglichen zu werden. Zwar spielt die Höhe des Energiegehalts, der im Wesentlichen durch den Anteil an Lipiden bestimmt wird, auch eine Rolle, denn die Pflanzen Dudenverlag, Bibliographisches Institut & F. A. Brockhaus AG, Mannheim,

26 mit dem höheren Energiegehalt sind die obligaten Pflanzen. Doch bleibt der Anteil an Proteinen (die ja eigentlich einen niedrigeren Brennwert haben als Kohlenhydrate und Lipide) der ausschlaggebende Faktor. Der Anteil an Kohlenhydraten spielt für die Dauerbesiedlung offensichtlich keine Rolle, da die fakultativen Pflanzen höhere Kohlenhydratgehalte haben als die obligaten Pflanzen. Abb. 1 aus Material B zeigt die Ergebnisse eines Versuches, in dem während eines Jahres das relative Blattwachstum bzw. der relative Blattverlust durch pflanzenfressende Insekten an Pflanzen untersucht wurde. Dabei wurden 17 Pflanzenpaare aus miteinander vergleichbaren Pflanzen untersucht, von denen die eine Pflanze von Ameisen besiedelt ist und die andere nicht. Die Ergebnisse zeigen, dass bei den von Ameisen besiedelten Pflanzen 12 von 17 über den Versuchszeitraum einen Zuwachs an Blattfläche zeigen, während bei den nicht besiedelten Pflanzen 15 von 17 einen relativen Blattflächenverlust durch Verzehr aufweisen. Eine zuvor ameisenfreie Pflanze, die während des Versuchs durch Ameisen besiedelt wurde, zeigt ebenfalls einen Zuwachs an Blattfläche, der einem relativen Blattwachstum in der Größenordnung von 150 % entspricht. Die Werte für das relative Blattwachstum bei den besiedelten Pflanzen sind sehr unterschiedlich die höchsten Werte liegen bei 400 % (1 Individuum) bzw. 250 % (2 Individuen) und 160 % (2 Individuen), der Rest schwankt um die 50 % relatives Blattwachstum. Fünf besiedelte Pflanzen zeigen einen relativen Blattflächenverlust, der jedoch mit Werten für den relativen Blattflächenverlust um -10 % bis -50 % deutlich geringer ist, als derjenige bei den unbesiedelten Pflanzen. Hier schwanken die Werte für den relativen Blattflächenverlust um -100 %. Die Ergebnisse zeigen insgesamt, dass sich die Besiedlung mit Ameisen sehr positiv auf das relative Blattwachstum der besiedelten Pflanzen auswirkt. Besiedelte Pflanzen zeigen in diesem Versuch nur bei knapp 30 % der Individuen einen relativen Blattverlust und der ist dann im Vergleich zu nicht besiedelten deutlich geringer. In Abb. 2 von Material B ist die Abhängigkeit der Größe von Ameisenkolonien von dem Vorhandensein bzw. Fehlen der Futterkörperchen aufgetragen. Angegeben werden jeweils die mittlere Individuenzahl und die Altersstruktur, wobei differenziert wird zwischen adulten Ameisen sowie den einzelnen Entwicklungsstadien Eier, Larven und Puppen. Verglichen wurde eine Kontrollgruppe (ohne Manipulation der Pflanze) mit einer Gruppe, bei der die Ameisenpflanzen zur Bildung zusätzlicher Futterkörperchen angeregt wurden sowie mit einer Gruppe, bei der die Bildung der Futterkörperchen bei den Pflanzen unterdrückt wurde. Bei Anregung der Bildung der Futterkörperchen ist die Zahl der Individuen in den Ameisenpopulationen deutlich gestiegen (mittlere Individuenzahl 1800 gegenüber 1400 in der Kontrollgruppe). Die Altersstruktur ist dabei im Vergleich zur Kontrollgruppe gleich geblieben: 50 % adulte Ameisen und 50 % Entwicklungsstadien, wobei die Verteilung der drei Stadien auf die 50 % gleichmäßig ist, also je ein Drittel Eier, Larven und Puppen. Offensichtlich ist die Fortpflanzungsrate zwar gleichgeblieben, doch konnten sich mehr Eier erfolgreich bis zum adulten Tier entwickeln, sodass die Individuenzahl insgesamt anstieg. Wurden die Futterkörperchen entfernt, so zeigt sich ein anderes Bild: Die mittlere Individuenzahl ist auf 800 gesunken (Kontrollgruppe 1400) und auch die Altersstruktur hat sich verändert: Hier nehmen die verschiedenen Entwicklungsstadien nur noch ein Drittel der Gesamtindividuenzahl ein, d. h. die Fortpflanzungsrate ist deutlich gesunken und der Zuwachs an Individuen liegt unter der Sterberate, sodass auch die Zahl der adulten Ameisen und damit die Gesamtindividuenzahl abnimmt. Die Futterkörperchen als Nahrungsquelle scheinen demnach einen direkten Einfluss auf den Fortpflanzungserfolg der Ameisen zu haben. III.2 Um die Frage zu beantworten muss man prüfen, ob die verschiedenen Bedingungen erfüllt sind, damit die Lebensgemeinschaft zwischen Ameisen und Ameisenpflanzen als Symbiose bezeichnet werden kann. 1. Bedingung: Beziehung zwischen artverschiedenen Lebewesen. Diese Bedingung ist auf jeden Fall erfüllt, zumal die beiden Partner der Lebensgemeinschaft sogar verschiedenen Reichen zugehören, die Ameisen den Tieren und die Ameisenpflanzen eben den Pflanzen. Dudenverlag, Bibliographisches Institut & F. A. Brockhaus AG, Mannheim,

Abiturprüfung Biologie, Leistungskurs

Abiturprüfung Biologie, Leistungskurs Seite 1 von 5 Abiturprüfung 2008 Biologie, Leistungskurs Aufgabenstellung: Thema: Das MERRF-Syndrom II.1 Begründen Sie, warum x-chromosomale Vererbung des MERRF-Krankheitsbildes, wie in Material C dargestellt,

Mehr

Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende

Mehr

Posttranskriptionale RNA-Prozessierung

Posttranskriptionale RNA-Prozessierung Posttranskriptionale RNA-Prozessierung Spaltung + Modifikation G Q Spleissen + Editing U UUU Prozessierung einer prä-trna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Zellzyklus G 1 Phase: postmitotische Phase oder Präsynthesephase Zelle beginnt wieder zu wachsen

Mehr

Abiturprüfung Biologie, Grundkurs

Abiturprüfung Biologie, Grundkurs Seite 1 von 5 Abiturprüfung 2009 Biologie, Grundkurs Aufgabenstellung: Thema: Parasiten als Indikatoren der Primaten-Evolution I.1 Begründen Sie, warum der Vergleich von Aminosäure-Sequenzen und Basen-Sequenzen

Mehr

3.2. Welche Folgen hätte der Verlust einer Guaninbase im dargestellten codogenen Strang:... G G A C T T C T T..? Begründen Sie!

3.2. Welche Folgen hätte der Verlust einer Guaninbase im dargestellten codogenen Strang:... G G A C T T C T T..? Begründen Sie! Kurs: MOK und Externe Hilfsmittel: keine Aufgaben: Die Klausur besteht aus einem Zentralthema ( Bewertungsanteil 50 %) und vier Wahlthemen (Bewertungsanteile je 25 %), von denen je zwei zu bearbeiten sind.

Mehr

Translation. Auflesung- Proteinsynthese

Translation. Auflesung- Proteinsynthese Translation Auflesung- Proteinsynthese Proteinsynthese DNA mrna Transkription elágazási hely Translation Polypeptid Vor dem Anfang Beladen der trnas spezifische Aminosäure + spezifische trna + ATP Aminoacyl-tRNA

Mehr

Biologie für Mediziner

Biologie für Mediziner Biologie für Mediziner - Zellbiologie 1 - Prof. Dr. Reiner Peters Institut für Medizinische Physik und Biophysik/CeNTech Robert-Koch-Strasse 31 Tel. 0251-835 6933, petersr@uni-muenster.de Dr. Martin Kahms

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Regeln zur Vererbung Autosomal rezessiv: - Merkmal tritt auf in Nachkommen nicht betroffener Eltern

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

5. Endoplasmatisches Reticulum und Golgi-Apparat

5. Endoplasmatisches Reticulum und Golgi-Apparat 5. Endoplasmatisches Reticulum und Golgi-Apparat Institut für medizinische Physik und Biophysik Ramona Wesselmann Endoplasmatisches Reticulum Umfangreiches Membransystem endoplasmatisch im Cytoplasma reticulum

Mehr

Einstieg: Fortpflanzung

Einstieg: Fortpflanzung Einstieg: Fortpflanzung Wozu ist Sex gut? - Nachkommen werden gezeugt --> Erhalt der Spezies. - Es entstehen Nachkommen mit Merkmalen (z.b. Aussehen), die denen von Vater und Mutter ähneln. Beide Eltern

Mehr

Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung

Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung 97 Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung von Sandra Grilliot (Der Artikel wurde - mit unserem Dank - der Frühjahrsausgabe 1991 von TEXGENE entnommen.) Wie schwer

Mehr

Evolution und Entwicklung

Evolution und Entwicklung Evolution und Entwicklung Wie aus einzelnen Zellen die Menschen wurden: Phylogenese Klassische Genetik: Mendel Moderne Genetik: Watson & Crick Wie aus einer einzigen Zelle ein Mensch wird: Ontogenese Vererbung

Mehr

Stammbaumanalyse und Vererbungsmuster

Stammbaumanalyse und Vererbungsmuster Stammbaumanalyse und Vererbungsmuster Bei den meisten Tieren und Pflanzen lässt sich der eines Merkmals in der Regel zweifelsfrei durch mehr oder weniger umfangreiche Kreuzungsexperimente erheben. Bei

Mehr

KV: Translation Michael Altmann

KV: Translation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Translation Michael Altmann Herbstsemester 2008/2009 Übersicht VL Translation 1.) Genexpression 2.) Der genetische Code ist universell 3.) Punktmutationen

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist.

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist. Die Prüfungsarbeit besteht aus drei zu bearbeitenden Teilen Aufgabe I Aufgabe II A oder II B Aufgabe III A oder III B I Aufgabe I: Humangenetik / klassische Genetik / Molekulargenetik Mukoviszidose Mukoviszidose,

Mehr

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel).

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel). Mendelsche Regeln 1 + 2 (1) Merkmale wie die Blütenfarbe können dominant-rezessiv oder intermediär vererbt werden. Bei einem intermediären Erbgang wird die Merkmalsausprägung von beiden Allelen (z. B.

Mehr

Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung

Mehr

Autosomal-rezessiver Erbgang

Autosomal-rezessiver Erbgang 12 Autosomal-rezessiver Erbgang Bearbeitetes Informationsblatt herausgegeben vom Guy s and St. Thomas Hospital, London und dem London IDEAS Genetic Knowledge Park, entsprechend deren Qualitätsstandards.

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie)

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) Als Erbkrankheit werden Erkrankungen und Besonderheiten bezeichnet, die entweder durch ein Gen (monogen)

Mehr

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren

Mehr

Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken

Mehr

Max-Planck-Gesellschaft

Max-Planck-Gesellschaft Max-Planck-Gesellschaft Presse-Information PRI B 6/2001 (8) 14. Februar 2001 Blattnektar pflanzliche Heuer für Schutzinsekten Bäume und Sträucher können Schutzinsekten mit Blattnektar anlocken und sich

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Grundlagen der Vererbungslehre

Grundlagen der Vererbungslehre Grundlagen der Vererbungslehre Zucht und Fortpflanzung Unter Zucht verstehen wir die planvolle Verpaarung von Elterntieren, die sich in ihren Rassemerkmalen und Nutzleistungen ergänzen zur Verbesserung

Mehr

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz 1. Nennen Sie die verschiedenen RNA-Typen, die bei der Translation wichtig sind. Erklären Sie die Funktion der verschiedenen RNA-Typen. Skizzieren Sie die Struktur der verschiedenen RNA-Typen und bezeichnen

Mehr

"Chromosomen Didac 2" Einzelsatz Best.- Nr / Paket von 6 Sätzen

Chromosomen Didac 2 Einzelsatz Best.- Nr / Paket von 6 Sätzen "Chromosomen Didac 2" Einzelsatz Best.- Nr. 2013336 / 2013337 Paket von 6 Sätzen Zusammensetzung Der Einzelsatz besteht aus: 2 blauen Sätzen mit 3 Chromosomen + 1 Geschlechtschromosom + 1 Stück von einem

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

Abiturprüfung Biologie, Grundkurs

Abiturprüfung Biologie, Grundkurs Seite 1 von 6 biturprüfung 2008 Biologie, rundkurs ufgabenstellung: Thema: Ein Krankheitsbild unterschiedliche rsachen II.1 Werten Sie die Materialien und B hinsichtlich der Risikofaktoren für Diabetes

Mehr

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden

Mehr

Bei Einbeziehung von neun Allelen in den Vergleich ergibt sich eine Mutation in 38 Generationen (350:9); das entspricht ca. 770 Jahren.

Bei Einbeziehung von neun Allelen in den Vergleich ergibt sich eine Mutation in 38 Generationen (350:9); das entspricht ca. 770 Jahren. 336 DNA Genealogie Das Muster genetischer Variationen im Erbgut einer Person - zu gleichen Teilen von Mutter und Vater ererbt - definiert seine genetische Identität unveränderlich. Neben seiner Identität

Mehr

Ministerium für Schule und Weiterbildung NRW BI GK HT 2 Seite 1 von 7. Unterlagen für die Lehrkraft. Abiturprüfung Biologie, Grundkurs

Ministerium für Schule und Weiterbildung NRW BI GK HT 2 Seite 1 von 7. Unterlagen für die Lehrkraft. Abiturprüfung Biologie, Grundkurs Seite 1 von 7 Unterlagen für die Lehrkraft Abiturprüfung 2008 Biologie, Grundkurs 1. Aufgabenart Bearbeitung fachspezifischen Materials mit neuem Informationsgehalt 2. Aufgabenstellung Thema: Ein Krankheitsbild

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 2 (06.06. 10.06.) DNA-Schäden, Mutationen und Reparatur 1.

Mehr

Die α (alpha)-thalassämien- Informationen für Patienten

Die α (alpha)-thalassämien- Informationen für Patienten Die Alpha Thalassämien Seite 1 von 1 Die α (alpha)-thalassämien- Informationen für Patienten Erstellung Prüfung Prof. Dr. med. Roswitha Dickerhoff Prof. Dr. med. R. Dickerhoff Gültigkeitsbeginn 01.05.2013

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt: Genetik & Vererbung. Das komplette Material finden Sie hier:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt: Genetik & Vererbung. Das komplette Material finden Sie hier: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: : Genetik & Vererbung Das komplette Material finden Sie hier: Download bei School-Scout.de Inhalt Vorwort Seite 4 Einleitung Seite

Mehr

1 Regeln der Vererbung

1 Regeln der Vererbung 1 Regeln der Vererbung Natura Genetik 1 Regeln der Vererbung Lösungen zu den Aufgaben Seiten 6 7 1.1 Eltern geben genetisches Material weiter 1 Erstelle einen möglichen Karyogrammausschnitt für ein weiteres

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler

Mehr

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name Starzinski-Powitz, 6 Fragen, 53 Punkte Name Frage 1 8 Punkte Nennen Sie 2 Möglichkeiten, wie der Verlust von Heterozygotie bei Tumorsuppressorgenen (Z.B. dem Retinoblastomgen) zum klompletten Funktionsverlust

Mehr

Translation Teil 3 Proteinfaktoren und ihre Rolle in der Proteinsynthese

Translation Teil 3 Proteinfaktoren und ihre Rolle in der Proteinsynthese Translation Teil 3 Proteinfaktoren und ihre Rolle in der Proteinsynthese Damit die Proteinsynthese beginnen kann, müssen m-rna und fmet-trna zum Ribosom gebracht werden. Wie geschieht das??? Von entscheidender

Mehr

Grundlegendes zur Genetik

Grundlegendes zur Genetik Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Die genetische 'Grauzone' der Huntington Krankheit: Was bedeutet

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Schleswig-Holstein 2010 Leistungskurs Biologie Sachgebiet: Ökosysteme und deren Veränderung durch den Menschen

Schleswig-Holstein 2010 Leistungskurs Biologie Sachgebiet: Ökosysteme und deren Veränderung durch den Menschen Gemeinschaft macht stark - Zusammenleben von Ameisen und Ameisenpflanzen Aufgaben. Analysieren Sie anhand des Materials die ökologischen Beziehungen zwischen Ameisen und Ameisenpflanzen.. Erläutern Sie

Mehr

Eine einzige Art und mehrere Milliarden verschiedene Männer und Frauen! 1. Wie viele Menschen gibt es heute auf der Erde?...

Eine einzige Art und mehrere Milliarden verschiedene Männer und Frauen! 1. Wie viele Menschen gibt es heute auf der Erde?... Alle verwandt - alle verschieden Mittelstufe Tafel 1 Eine einzige Art und mehrere Milliarden verschiedene Männer und Frauen! 1. Wie viele Menschen gibt es heute auf der Erde?... 2. Können alle Männer und

Mehr

Chromosomen & Populationsgenetik (1)

Chromosomen & Populationsgenetik (1) Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: 1 Karyogramme Chromosomen & Populationsgenetik (1) Bestimmen Sie den Karyotyp der folgenden

Mehr

Ministerium für Schule und Weiterbildung NRW BI LK HT 2 Seite 1 von 8. Unterlagen für die Lehrkraft. Abiturprüfung 2008. Biologie, Leistungskurs

Ministerium für Schule und Weiterbildung NRW BI LK HT 2 Seite 1 von 8. Unterlagen für die Lehrkraft. Abiturprüfung 2008. Biologie, Leistungskurs Seite 1 von 8 Unterlagen für die Lehrkraft Abiturprüfung 2008 Biologie, Leistungskurs 1. Aufgabenart Aufgaben mit Untersuchungs- und Erhebungsdaten und/oder Texten 2. Aufgabenstellung Thema: Das MERRF-Syndrom

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Tutorium SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Tutorium SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Tutorium SS 2016 Fragen für die Tutoriumsstunde 5 (27.06. 01.07.) Mendel, Kreuzungen, Statistik 1. Sie bekommen aus

Mehr

Vergleich von Gliedmaßen mit gleicher Funktion

Vergleich von Gliedmaßen mit gleicher Funktion Station 13 Vergleich von Gliedmaßen mit gleicher Funktion Frage: Ist alles, was fliegt, gleicher Abstammung? Flügel eines Vogels und eines Insekts Vogelflügel Schmetterlingsflügel 1. Zeigen die Flügel

Mehr

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Fallkonferenz Schwerpunkt Humangenetik Genetische Beratung Genetische Beratung ist ein Kommunikationsprozess, der

Mehr

TRANSKRIPTION I. Die Herstellung von RNA bei E-Coli

TRANSKRIPTION I. Die Herstellung von RNA bei E-Coli TRANSKRIPTION I Die Herstellung von RNA bei E-Coli Inhalt Aufbau der RNA-Polymerase Promotoren Sigma-Untereinheit Entwindung der DNA Elongation Termination der Transkription Modifizierung der RNA Antibiotika

Mehr

biotischen Umweltfaktoren im Ökosystem Wald (Auswahl) Gewässer als Ökosysteme Projekt: Der See als Ökosystem gewusst gekonnt...

biotischen Umweltfaktoren im Ökosystem Wald (Auswahl) Gewässer als Ökosysteme Projekt: Der See als Ökosystem gewusst gekonnt... Inhaltsverzeichnis Bio 9 /10 3 Inhaltsverzeichnis 1 Ökologie... 8 1.1 Struktur und Vielfalt von Ökosystemen... 9 1 Lebensraum und abiotische Umweltfaktoren... 10 Lebensraum und biotische Umweltfaktoren...

Mehr

Die Urmutter lebte vor etwa Jahren in Ost-Afrika. "Auf der Suche nach unserer Ur- Mutter": Einleitung:

Die Urmutter lebte vor etwa Jahren in Ost-Afrika. Auf der Suche nach unserer Ur- Mutter: Einleitung: "EVA": Der genetische Stammbaum führt die Wissenschaftler zurück zum Ursprung. Fragen "Wer sind wir?" und "Woher kommen wir" erscheinen durch Analysen der mitochondrialen DNS in neuem Licht. Nach Erkenntnissen

Mehr

Seminar zur Grundvorlesung Genetik

Seminar zur Grundvorlesung Genetik Seminar zur Grundvorlesung Genetik Wann? Gruppe B5: Donnerstags, 11 15-12 00 Wo? Raum 133 Teilnahme obligatorisch, max. 1x abwesend Kontaktdaten Marcel Quint Leibniz-Institut für Pflanzenbiochemie - Nachwuchsgruppe

Mehr

Hilfe 1. Wissenschaft. Traditionen und. Hilfe 1

Hilfe 1. Wissenschaft. Traditionen und. Hilfe 1 Hilfe 1 Hilfe 1 Erklärt euch gegenseitig die Aufgabe noch einmal in euren eigenen Worten. Klärt dabei, wie ihr die Aufgabe verstanden habt und was euch noch unklar ist. Antwort 1 Wir sollen einen Stammbaum

Mehr

Gendefekte und Krankheiten. Frequenz monogener Erkrankungen: ~ 1%

Gendefekte und Krankheiten. Frequenz monogener Erkrankungen: ~ 1% endefekte und Krankheiten Frequenz monoener Erkrankunen: ~ 1% Katalo Mendelscher Krankheiten: > 6000 Einträe (OMIM TM : Online Mendelian Inheritance in Man) Mutationen in >2000 enen (monoene Erkrankunen)

Mehr

auf den Lösungsbogen.

auf den Lösungsbogen. Test-Fragen für die Klausur Humangenetik Test-Fragen für die Klausur Humangenetik Es folgen 9 Fragen und der Lösungsbogen (blanko). Sie haben 13,5 min Zeit zum Beantworten der Fragen und zum Übertragen

Mehr

4 Kompetenzen und Inhalte (Leistungskurs)

4 Kompetenzen und Inhalte (Leistungskurs) 4 (Leistungskurs) 4.1 Physiologische Grundlagen ausgewählter Lebensprozesse am Beispiel der Nervenzelle - Aufbau lebender Organismen aus Zellen - Vorgänge an Biomembranen - Enzyme und ihre Bedeutung -

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte

Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Frage 1: 10 Punkte a) Die Bildung der Gameten bei Diplonten und bei Haplonten erfolgt im Verlaufe von Kernteilungen. Ergänzen Sie die angefangenen Sätze (2

Mehr

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Einführung in die Grundlagen der Genetik Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Molekularbiologische Grundlagen Die Zelle ist die grundlegende, strukturelle und funktionelle

Mehr

Vererbungsgesetze, Modell

Vererbungsgesetze, Modell R Vererbungsgesetze, Modell 65564.00 Betriebsanleitung Das Model besteht aus einem Satz von 204 Symbolkarten und 3 Kreuzungs- und Nachkommenslinien. 81 der Symbolkarten zeigen Erscheinungsbilder (Phänotypen),

Mehr

SCHRIFTLICHE ABITURPRÜFUNG 2007 Biologie (Leistungskursniveau)

SCHRIFTLICHE ABITURPRÜFUNG 2007 Biologie (Leistungskursniveau) Biologie (Leistungskursniveau) Einlesezeit: Bearbeitungszeit: 30 Minuten 300 Minuten Der Prüfling wählt je ein Thema aus den Gebieten G (Grundlagen) und V (Vertiefung) zur Bearbeitung aus. Die zwei zur

Mehr

1 34 I Botanik 1 Morphologie

1 34 I Botanik 1 Morphologie 1 4 I Botanik 1 Morphologie Ein Beispiel für die Ausbildung von Urnenblättern ist Dischidia vidalii, eine epiphytische Schlingpflanze aus dem tropischen Asien. a) Erklären Sie, wie sich die Pflanze an

Mehr

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie Grundwissenkarten Gymnasium Vilsbisburg 9. Klasse Biologie Es sind insgesamt 10 Karten für die 9. Klasse erarbeitet. davon : Karten ausschneiden : Es ist auf der linken Blattseite die Vorderseite mit Frage/Aufgabe,

Mehr

Genetik, Evolution, Intelligenz und anthropologische Diversität: Was wissen wir daru ber?

Genetik, Evolution, Intelligenz und anthropologische Diversität: Was wissen wir daru ber? Genetik, Evolution, Intelligenz und anthropologische Diversität: Was wissen wir daru ber? Diethard Tautz Genetik der evolutionären Anpassung und Selektion Populationsgenetik und Artenstehung Max-Planck

Mehr

Kein Hinweis für eine andere Ursache der Demenz

Kein Hinweis für eine andere Ursache der Demenz die später nach ihm benannte Krankheit. Inzwischen weiß man, dass die Alzheimer-Krankheit eine sogenannte primär-neurodegenerative Hirnerkrankung ist. Das bedeutet, dass die Erkrankung direkt im Gehirn

Mehr

Frauenkrebs Kommunikationsprojekt. Krebs und die genetische Verbindung

Frauenkrebs Kommunikationsprojekt. Krebs und die genetische Verbindung Frauenkrebs Kommunikationsprojekt Koordiniert durch das Europäische Institut für Frauengesundheit http://www.eurohealth.ie/cancom/ Krebs und die genetische Verbindung In Irland ist Brustkrebs eine der

Mehr

BI BIL E GK?? 1 BI GK HT 2 Seite 1 von 5. Abiturprüfung Biologie, Grundkurs

BI BIL E GK?? 1 BI GK HT 2 Seite 1 von 5. Abiturprüfung Biologie, Grundkurs Seite 1 von 5 biturprüfung 2009 Biologie, rundkurs ufgabenstellung: Thema: endiagnostik am Beispiel von Faktor-V-Leiden II.1 Erläutern Sie anhand von Material und Material D, welche Mutation auf dem codogenen

Mehr

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 1. Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 2. Wieviele DNA-Stränge finden sich in einem Bivalent (= ein in der Metaphase der ersten meiotischen Teilung vorliegendes

Mehr

FACH: BIOLOGIE JAHRGANG: 11

FACH: BIOLOGIE JAHRGANG: 11 ca. 6 Wochen Folge der Einheiten Dauer der Einheit (ca.) 1 Thema: Zellen Tier-/Pflanzenzelle Biomembran Zelldifferenzierung Prokaryot/Eukaryot Diffusion/Osmose vergleichen komplexe Vorgänge auf zellulärer

Mehr

1 Schulinterner Kernlehrplan Biologie Q2 Evolution

1 Schulinterner Kernlehrplan Biologie Q2 Evolution 1 Schulinterner Kernlehrplan Biologie Q2 Evolution 1 Inhaltsfelder Schwerpunkt Basiskonzept Konkretisierte Kompetenzen Evolution Evolutionstheorien LK Evolutionstheorie Biodiversität und Systematik Entwicklung

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig Restriktionsenzyme Füllen Sie den Lückentext aus. PCR 1a Mit dem folgenden Quiz können Sie Ihr Wissen zum Thema PCR überprüfen. Klicken Sie jeweils die richtige Antwort an. PCR 1b Mit dem folgenden Quiz

Mehr

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.)

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.) Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen Die verschiedenen Ribosomen-Komplexe können im Elektronenmikroskop beobachtet werden Durch Röntgenkristallographie wurden

Mehr

kam zum Prozess vor einem Gericht in Los Angeles, Kalifornien. Chaplin erwirkte einen Bluttest, um anhand der Blutgruppen zu zeigen, dass er nicht

kam zum Prozess vor einem Gericht in Los Angeles, Kalifornien. Chaplin erwirkte einen Bluttest, um anhand der Blutgruppen zu zeigen, dass er nicht kam zum Prozess vor einem Gericht in Los Angeles, Kalifornien. Chaplin erwirkte einen Bluttest, um anhand der Blutgruppen zu zeigen, dass er nicht der Vater war. Er kannte die Blutgruppe des Kindes nicht,

Mehr

AUFGABENSAMMLUNG Lösungen. Homologie, Analogie. Lösungen

AUFGABENSAMMLUNG Lösungen. Homologie, Analogie. Lösungen Homologie, Analogie Lebewesen können Übereinstimmungen in ihren Merkmalen haben. Je nach Ursprung dieser Ähnlichkeiten werden sie als homolog oder analog bezeichnet. Ordne die Kennzeichen von homologen

Mehr

Autotrophe Ernährung. Heterotrophe Ernährung. Ernährungsweise von grünen Pflanzen und manchen Bakterien

Autotrophe Ernährung. Heterotrophe Ernährung. Ernährungsweise von grünen Pflanzen und manchen Bakterien 2 2 Autotrophe Ernährung Ernährungsweise von grünen Pflanzen und manchen Bakterien Sie stellen energiereiche organische Verbindungen (z.b. Zucker) zum Aufbau körpereigener Stoffe selbst her. Die Energie

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation

Mehr

erläutern Eigenschaften des genetischen Codes und charakterisieren mit dessen Hilfe Experimentelle Entschlüsselung (SF)

erläutern Eigenschaften des genetischen Codes und charakterisieren mit dessen Hilfe Experimentelle Entschlüsselung (SF) Schulinterner Kernlehrplan Biologie Q1 : Genetik Inhaltsfelder Schwerpunkt Basiskonzept Konkretisierte Kompetenzen 1.1 Vom Gen zum Genprodukt Wiederholung - DNA und Replikation Aufgaben DNA und Replikation

Mehr

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4 S 4 M 2 Studien an eineiigen Zwillingen Was ist für die Unterschiede bei eineiigen Zwillingen verantwortlich? Aufgaben 1. Fassen Sie die Informationen des Textes zusammen. 2. Wie sind die im Text beschriebenen

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Proseminarvortrag. Markov-Ketten in der Biologie (Anwendungen)

Proseminarvortrag. Markov-Ketten in der Biologie (Anwendungen) Proseminarvortrag Markov-Ketten in der Biologie (Anwendungen) von Peter Drössler 20.01.2010 2 Markov-Ketten in der Biologie (Peter Drössler, KIT 2010) Inhalt 1. Das Wright-Fisher Modell... 3 1.1. Notwendige

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Evolution, Genetik und Erfahrung

Evolution, Genetik und Erfahrung Chromosomen, Fortpflanzung und Genkopplung Entscheidende Entdeckung: Gene sind auf Chromosomen lokalisiert! 1 CHROMOSOM fadenförmige Strukturen im Kern der Zellen (wikipedia) Chromosomen in Körperzellen

Mehr

Lösungsvorschlag - Material 2:

Lösungsvorschlag - Material 2: Lösungsvorschlag - Material 2: Gentechnisch veränter Mais als Ursache für das sterben Ihr gehört einer Gruppe von Wissenschaftlern an, die sich mit gentechnisch veränten Pflanzen, insbesone dem so genannten

Mehr

Die Erbinformation ist in Form von Chromosomen = Kopplungsgruppen organisiert

Die Erbinformation ist in Form von Chromosomen = Kopplungsgruppen organisiert Die Erbinformation ist in Form von Chromosomen = Kopplungsgruppen organisiert Chromosom Chromatin Ausschnitt aus DNA-Doppelhelix Nukleosomen (Chromatin) Chromatinfaden höherer Ordnung Teil eines Chromosoms

Mehr

1. Mendelsche Vererbung, Stammbäume:

1. Mendelsche Vererbung, Stammbäume: 1. Mendelsche Vererbung, Stammbäume: typische Stammbäume atypische Stammbäume 2. Allelische und nicht-allelische Mutationen, Komplementationstests 3. Hardy-Weinberg Gleichgewicht 4. Mutation und Selektion,

Mehr

1 Was ist Leben? Kennzeichen der Lebewesen

1 Was ist Leben? Kennzeichen der Lebewesen 1 In diesem Kapitel versuche ich, ein großes Geheimnis zu lüften. Ob es mir gelingt? Wir werden sehen! Leben scheint so selbstverständlich zu sein, so einfach. Du wirst die wichtigsten Kennzeichen der

Mehr