Psoriasin is a major Escherichia coli-cidal factor of the female genital tract

Save this PDF as:

Größe: px
Ab Seite anzeigen:

Download "Psoriasin is a major Escherichia coli-cidal factor of the female genital tract"


1 Psoriasin is a major Escherichia coli-cidal factor of the female genital tract Mildner M, Stichenwirth M, Abtin A, Eckhart L, Sam C, Gläser R, Schröder JM, Gmeiner R, Mlitz V, Pammer J, Geusau A, Tschachler E.

2 Antimikrobielle Peptide AMP sind evolutionär konservierte Bestandteile des angeborenen Immunsystems die in allen Lebensformen vorkommen Targets: Gram+, Gram-, Mykobakterien, Viren, Pilze, transformierte/kanzeröse Zellen

3 Antimikrobielle Peptide Beim Menschen 3 Gruppen nachgewiesen 1) Defensine: auf Haut u Schleimhaut, bilden bis zu 30% des Inhalts der Granula von neutrophilen Granulozyten

4 Antimikrobielle Peptide Beim Menschen 3 Gruppen nachgewiesen 2) Cathelicidine: befinden sich in Lysosomen von Makrophagen und neutrophilen Granulozyten

5 Antimikrobielle Peptide Beim Menschen 3 Gruppen nachgewiesen 3) Histatine: kommen im Speichel vor.

6 Wirkungsweise Enthalten hohen Anteil basischer Aminosäuren -> unter physiologischen Bedingungen kationische Eigenschaften Docken somit an Membran der Pathogene an

7 Wirkungsweise

8 Wirkungsweise Störung der Membranintegrität Störung des Metabolismus Angriff cytoplasmatischer Bestandteile Keine Resistenzen bekannt

9 Hypothese Im weiblichen Genitaltrakt besteht eine ständige Bedrohung durch virale, bakterielle und fungale Pathogene. Balance zwischen Wachstum der physiologischen Mikroorganismen und eindringender Pathogene daher unerlässlich

10 Immunsystem

11 Vaginale Epithelzellen Epithelzellen der vaginalen Mukosa sezernieren 1) Chemokine und Cytokine um Zellen des Immunsystems zu rekrutieren 2) Antimikrobielle Peptide um Pathogene direkt anzugreifen

12 Hypothese E. Coli-cidale AMPs schützen den Genitaltrakt der Frau vor Infektionen durch E.Coli Weiblicher Urogenitaltrakt besonders durch E. Coli gefährdet aufgrund anatomischer Nahebeziehung zu Unterem GI-Trakt. Gray s Anatomy, Lea and Febinger 1918, Philadelphia, USA

13 Psoriasin AMP aus Keratinozyten mit starker Wirkung gegen E. Coli. Wichtigster E. Coli-cidaler Faktor der Haut. Glaser, R. et al. Antimicrobial psoriasin (S100A7) protects human skin from Escherichia coli infection Als Hauptinduktor wurde das Flagellum der E. Coli Bakterien identifiziert Abtin, A. et al. Flagellin is the principal inducer of the antimicrobial peptide S100A7c (psoriasin) in human epidermal keratinocytes exposed to Escherichia coli

14 Verteilung Psoriasin

15 Wirkungsweise Psoriasin 1) Hohe Affinität zu Zink, Bestandteil der Kupfer-Zink-Superoxid-Dismutase im Periplasma von Bakterien Antimicrobial psoriasin protects human skin from E. Coli infection, Gläser R et al. 2) Permeabilisierung von bakteriellen Membranen The human antimicrobial protein psoriasin acts by permeabilization of bacterial membranes, Michaelek M et al.

16 Results E. Coli Suspension für 3 Stunden mit 20%igem Vaginalsekret inkubiert, anschließend auf LB Agar aufgetragen und über Nacht inkubiert. Weiters wurde das Vaginalsekret auf 10, 5, 2.5 und 1 Prozent verdünnt und auf ihre bakterizide Wirkung untersucht. Danach wurden Kolonien gezählt und Anteil der vernichteten berechnet.

17 Results a) E. Coli inkubiert mit 20% Vaginallavage von 8 gesunden Spenderinnen für 3 Stunden, danach über Nacht auf LB-Agar. b) E.Coli inkubiert mit zwischen 20 und 1% verdünnten Vaginallavagen für 3 Stunden, danach über Nacht auf LB-Agar. Alle Bakterien wurden bereits bei einer 5%igen Verdünnung vernichtet.

18 Results Um Beteiligung des Psoriasins an der E. Colicidalen Wirkung des Vaginalsekrets nachzuweisen, wurde mit Biopsaten aus Vulva (n=5), Vagina (n=10) und Cervix (n=10) eine Immunhistochemie durchgeführt.

19 Results

20 Results Um zu untersuchen ob die Psoriasin Expression konstitutiv und/oder durch E.Coli induziert ist wurde ein three-dimensional organotypic vaginal epithelial model benutzt. Dieses wurde mittels Immunhistochemie und western blot untersucht.

21 Results a) Immunhistochemie des 3D organotypic models unter normalen Bedingungen b) Immunhistochemie des 3D organotypic models nach 24h Exposition mit hitzeinaktivierten E.Coli Überständen

22 Results c) Western Blot Analyse ergab eine konstitutive Expression von Psoriasin im organotypic vaginal model. d) ELISA: Psoriasin im Medium unbehandelter und mit E.Coli Überstand inkubierten Modellen. Im inkubierten Modell Expression um 6.6 faches erhöht

23 Results a) Psoriasin im Vaginalsekret wurde mittels ELISA quantifiziert b) Western Blot: 3μl Vaginalflüssigkeit (VF1-4), verglichen mit 30μl Stratum Corneum Extrakt.

24 Results 2 Dimensionale Elektrophorese Links- ca. 30 Proteine wurden im Vaginalsekret von gesunden Spenderinnen gefunden Rechts- Psoriasin wurde mit einem anti-psoriasin Antikörper detektiert (Anteil am Gesamtprotein 2.5-3%, 11.3kDa,isoelektrischer Punkt 5.6)

25 HPLC stationäre Phase mobile Phase


27 HPLC b) Bei 4 von 10 Patientinnen zeigte sich ein weiterer Peak einer unbekannten niedermolekularen Substanz mit E.Colicidaler Wirkung die in einigen Fällen auch die des Psoriasins übertraf.

28 Discussion Obwohl E. Coli eines der häufigsten Pathogene im weiblichen Genitaltrakt ist, kommt es- im Gegensatz zu den Harnwegen- nur selten zu Infektionen. Im Gegensatz zur normalen Haut wird Psoriasin im weiblichen Genitaltrakt konstitutiv exprimiert, eventuell aufgrund einer ständigen E. Coli Exposition

29 Discussion Subrabasale Zellen könnten als Speicher für Psoriasin dienen im Falle einer Beschädigung des Epithels.

30 Discussion Der höchste Psoriasingehalt der Vaginalflüssigkeit besteht wenn gleichzeitig die AMPs Lysozym und HNP-1 anwesend sind. Anwesenheit deutet auf Einwanderung neutrophiler Granulozyten hin, daher könnten auch Cytokine/Chemokine an der Regulierung von Psoriasin beteiligt sein.

31 Discussion Die niedermolekulare Substanz die in einigen Proben die E. Colicidale Wirkung von Psoriasin übertraf konnte nicht identifiziert werden. Obwohl die Einnahme von Antibiotika ein Ausschlusskriterium darstellte, kann die exogene Herkunft dieser Substanz nicht ausgeschlossen werden.

32 Summary Psoriasin wird von vaginalem Epithel produziert und freigesetzt Bis zu 3% der Proteine im Vaginalsekret Aufgrund seiner hohen E.Colicidalen Wirkung und seiner konstitutiven Expression spielt es eine wichtige Rolle im angeborenen Immunsystem des weiblichen Genitaltrakts

Grundlagen des Immunsystems. Rainer H. Straub

Grundlagen des Immunsystems. Rainer H. Straub Grundlagen des Immunsystems Rainer H. Straub Aufbau des Immunsystems Das unspezifische, angeborene Immunsystem (engl. innate) Das spezifische, erworbene, erlernte Immunsystem (engl. adaptive) zelluläre


Auch Bakterien haben Sex- Biofilme und ihre Bedeutung (nicht nur) für die Lebensmittelhygiene

Auch Bakterien haben Sex- Biofilme und ihre Bedeutung (nicht nur) für die Lebensmittelhygiene Auch Bakterien haben Sex- Biofilme und ihre Bedeutung (nicht nur) für die Lebensmittelhygiene Fachtagung am 2. Juni in Coesfeld mikrologos GmbH Definition Biofilm Ein Biofilm ist eine aus Mikroorganismen


Antimikrobielle Peptide

Antimikrobielle Peptide Friedrich-Schiller- Universität Jena Antimikrobielle Peptide -Natürliche Antibiotika gegen resistent gewordene Krankheitserreger- Michèle Uting 1 Antibiotikaresistenz -ein ernst zu nehmendes Problem- Wachsende


Antimikrobielle Peptide als funktionale Moleküle für die Oberflächenbeschichtung

Antimikrobielle Peptide als funktionale Moleküle für die Oberflächenbeschichtung Antimikrobielle Peptide als funktionale Moleküle für die berflächenbeschichtung K. apsch, F.F. Bier und M. von Nickisch-osenegk Fraunhofer Institut für Biomedizinische Technik (IBMT) Inhaltsverzeichnis


Mikrobiologisches Grundpraktikum: Ein Farbatlas

Mikrobiologisches Grundpraktikum: Ein Farbatlas Steve K. Alexander / Dennis Strete Mikrobiologisches Grundpraktikum: Ein Farbatlas Deutsche Bearbeitung von Erika Kothe Aus dem Amerikanischen von Hans W. Kothe und Erika Kothe Ein Imprint von Pearson


Einführung in die Immunologie Zellen & Organe

Einführung in die Immunologie Zellen & Organe Das Immunsystem Einführung in die Immunologie Zellen & Organe Kirsten Gehlhar Das Immunsystem (lat.: immunis = frei, unberührt) ist kein einzelnes Organ. Es besteht aus spezialisierten Zellen im Blut und


Abwehrmechanismen des Immunsystems Prof. Dr. Rainer H. Straub

Abwehrmechanismen des Immunsystems Prof. Dr. Rainer H. Straub KLINIK UND POLIKLINIK FÜR INNERE MEDIIN I Abwehrmechanismen des Immunsystems Prof. Dr. Rainer H. Straub Aufbau des Immunsystems Das unspezifische, angeborene Immunsystem (engl. innate) Das spezifische,


antimikrobielle Barriere

antimikrobielle Barriere Die intestinale Mukusschicht als antimikrobielle Barriere Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) Fakultät Naturwissenschaften Universität Hohenheim Institut


NEU NEU. Das Wirkprinzip:

NEU NEU. Das Wirkprinzip: Das Wirkprinzip: D-Mannose gelangt über den Blutkreislauf unverändert in Blase und Harnwege D-Mannose und Cranberry binden sich gemeinsam an die Fimbrien der entzündungsverursachenden Bakterien (zu 90%



RNase 7 IM BLUTSERUM VON PATIENTEN MIT CHRONISCH- ENTZÜNDLICHEN HAUTERKRANKUNGEN Aus der Klinik für Dermatologie, Venerologie und Allergologie (Direktor: Prof. Dr. T. Schwarz) im Universitätsklinikum Schleswig-Holstein, Campus Kiel an der Christian Albrechts-Universität zu Kiel RNase


Gefahren bei unsterilem Arbeiten. Dr. Gerhard Eich Abteilung Infektiologie und Spitalhygiene Stadtspital Triemli

Gefahren bei unsterilem Arbeiten. Dr. Gerhard Eich Abteilung Infektiologie und Spitalhygiene Stadtspital Triemli Gefahren bei unsterilem Arbeiten Dr. Gerhard Eich Abteilung Infektiologie und Spitalhygiene Stadtspital Triemli Injektion von Bakterien Pyrogene Reaktion Beispiel: Infusion von bakteriell kontaminierten


Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1


5 Zusammenfassung. Zusammenfassung 76

5 Zusammenfassung. Zusammenfassung 76 Zusammenfassung 76 5 Zusammenfassung 1. Aminosäuren sind als Bausteine der Proteine essentiell zur Aufrechterhaltung vitaler Prozesse. Eine besondere Rolle im Zellmetabolismus der Haut spielen dabei kationische


Alien Invasion I. Univ.-Prof. Dr. Albert Duschl

Alien Invasion I. Univ.-Prof. Dr. Albert Duschl Alien Invasion I Univ.-Prof. Dr. Albert Duschl Bakterien und wir Bakterien sind ein normaler und notwendiger Teil unserer Umwelt. Unser Körper enthält 10 14 Bakterien, aber nur 10 13 Eukaryontenzellen.


Unser Immunsystem. Antikörper und Impfung

Unser Immunsystem. Antikörper und Impfung Unser Immunsystem Antikörper und Impfung Allgemeine Definition Biolog. Abwehrsystem höherer Lebewesen, das Gewebeschädigungen durch Krankheitserreger verhindert Komplexes Netzwerk aus verschiedenen Organen,


Movie dendritic cell migration_iv_8_2. Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe

Movie dendritic cell migration_iv_8_2. Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe Komponenten und Aufbau des Immunsystems Initiation von Immunantworten lymphatische Organe Erkennungsmechanismen Lymphozytenentwicklung Entstehung und Verlauf adaptiver Immunantworten T-Zellen gelangen


Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt.

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. - 22-4 Ergebnisse 4.1 RT-PCR Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. 4.1.1 Struma nodosa Histologie Fas Fas CD 97


Inflammasom bei der Wundheilung

Inflammasom bei der Wundheilung MolCare Consulting Dr. Bernd Becker Schulsiedlung 6 D-93109 Wiesent Mobil: +49 173 66 79 505 - Tel: +49 9482 9099 036 - Fax: +49 9482 9099 037 - E-Mail: Inflammasom bei der


Rekombinante Antikörper

Rekombinante Antikörper Frank Breitling und Stefan Dübel 2008 AGI-Information Management Consultants May be used for personal purporses only or by libraries associated to network. Rekombinante Antikörper Technische


Prüfungsfragenkatalog für für Grundlagen der Gentechnik und Biotechnologie (Prof. Prof. Rudolf Bauer und Prof. Karin Ardjomand-Wölkart)

Prüfungsfragenkatalog für für Grundlagen der Gentechnik und Biotechnologie (Prof. Prof. Rudolf Bauer und Prof. Karin Ardjomand-Wölkart) Prüfungsfragenkatalog für für Grundlagen der Gentechnik und Biotechnologie (Prof. Prof. Rudolf Bauer und Prof. Karin Ardjomand-Wölkart) Stand: September 2014 Termin: 29.09.2014 1. Was ist Western Blot?


Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe. Erkennungsmechanismen. Lymphozytenentwicklung

Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe. Erkennungsmechanismen. Lymphozytenentwicklung Komponenten und Aufbau des Immunsystems Initiation von Immunantworten lymphatische Organe Erkennungsmechanismen Lymphozytenentwicklung Entstehung und Verlauf adaptiver Immunantworten 196 Dendritische Zellen


Mikrobiologisches Grundpraktikum: Ein Farbatlas

Mikrobiologisches Grundpraktikum: Ein Farbatlas Steve K. Alexander / Dennis Strete Mikrobiologisches Grundpraktikum: Ein Farbatlas Deutsche Bearbeitung von Erika Kothe Aus dem Amerikanischen von Hans W. Kothe und Erika Kothe PEARSON Studium Ein Imprint


Biofilme und ihre Bedeutung (nicht nur) für die Lebensmittelsicherheit

Biofilme und ihre Bedeutung (nicht nur) für die Lebensmittelsicherheit Biofilme und ihre Bedeutung (nicht nur) für die Lebensmittelsicherheit Fachtagung der Hauswirtschaft Schwalmstadt, 18. März 2016 Dr. Elke Jaspers mikrologos GmbH Definition Biofilm Ein Biofilm ist eine


Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe. Erkennungsmechanismen. Lymphozytenentwicklung

Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe. Erkennungsmechanismen. Lymphozytenentwicklung Komponenten und Aufbau des Immunsystems Initiation von Immunantworten lymphatische Organe Erkennungsmechanismen Lymphozytenentwicklung Entstehung und Verlauf adaptiver Immunantworten 1 Dendritische Zellen


Immunologische Methoden und Enzymassays

Immunologische Methoden und Enzymassays Immunologische Methoden und Enzymassays 1. Antikörper (Ak) Aufbau, Struktur monoklonale und polyklonale Ak 2. Immunpräzipitation 3. Affinitätschromatographie 4. Immundetektion 5. Immunblot 6. Immunhistochemie


Antibiotika (Einleitung) Penicillium Schimmelpilze

Antibiotika (Einleitung) Penicillium Schimmelpilze Antibiotika (Einleitung) Penicillium Schimmelpilze Grundlagen I Definition Antibiotika sind natürliche Stoffwechselprodukte von Pilzen und Bakterien, die andere Mikroorganismen abtöten oder an ihrem Wachstum


Komponenten und Aufbau des Immunsystems. 1) Zelltypen 2) angeborene und erworbene Immunität 3) humorale und zelluläre Immunfunktion

Komponenten und Aufbau des Immunsystems. 1) Zelltypen 2) angeborene und erworbene Immunität 3) humorale und zelluläre Immunfunktion Komponenten und Aufbau des Immunsystems 1) Zelltypen 2) angeborene und erworbene Immunität 3) humorale und zelluläre Immunfunktion 50 humorale Funktionen Zelluläre Funktionen anti-microbials Phagozyten


Projektskizze: Studie/ Auswertung/ Publikation

Projektskizze: Studie/ Auswertung/ Publikation Projektskizze: Studie/ Auswertung/ Publikation Name: PD Dr. Dr. Robert Bals, CAPNetz C11 Datum: 30. 8. 2007 Institution(en)/Autor(en): Klinikum der Universität Marburg Klinik für Innere Medizin mit Schwerpunkt


Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors

Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors Inauguraldissertation zur Erlangung der Doktorwürde am Fachbereich Biologie/Chemie/Pharmazie der Freien Universität



Antibiotikaresistenz Unter versteht man die Eigenschaft von Mikroorganismen, die Wirkung antibiotisch aktiver Substanzen abschwächen oder gänzlich aufheben zu können. Grundsätzlich kann es in allen Bereichen, in denen Antibiotika


Immunologie und Mikrobiologie Motor für innovative Prävention, Diagnostik und Therapie? Annette Oxenius, Professorin für Immunologie, ETH Zürich

Immunologie und Mikrobiologie Motor für innovative Prävention, Diagnostik und Therapie? Annette Oxenius, Professorin für Immunologie, ETH Zürich Immunologie und Mikrobiologie Motor für innovative Prävention, Diagnostik und Therapie? Annette Oxenius, Professorin für Immunologie, ETH Zürich Infektionen Viren Bakterien Pilze Würmer Annette Oxenius


Toll-like receptors: Studies on cellular activation and involvement in rheumatoid arthritis

Toll-like receptors: Studies on cellular activation and involvement in rheumatoid arthritis DISS. ETH NO. 15257 Toll-like receptors: Studies on cellular activation and involvement in rheumatoid arthritis A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH for the degree


Bakterizidie von Akacid Plus. Bakterizide Wirkung Prüfverfahren und Anforderung nach ÖNORM EN 1040 (1997)

Bakterizidie von Akacid Plus. Bakterizide Wirkung Prüfverfahren und Anforderung nach ÖNORM EN 1040 (1997) MEDIZINISCHE UNIVERSITÄT WIEN UNIVERSITÄTSKLINIK FÜR INNERE MEDIZIN I Abteilung für Infektionen und Chemotherapie Mikrobiologische Laboratorien 3P Univ. Prof. DDr. A. Georgopoulos Währinger Gürtel 18-20,


We love inflammation. Prof. Dr. Albert Duschl

We love inflammation. Prof. Dr. Albert Duschl We love inflammation Prof. Dr. Albert Duschl Klinische Definition Die klassischen klinischen Zeichen der Entzündung: 1. Rötung (rubor) 2. Überwärmung (calor) 3. Schwellung (tumor) 4. Schmerz (dolor) 5.


Immunologie. immunis (lat.) = frei, unberührt. Wissenschaft vom Abwehrsystem von Lebewesen gegen fremde Substanzen und Krankheitserreger

Immunologie. immunis (lat.) = frei, unberührt. Wissenschaft vom Abwehrsystem von Lebewesen gegen fremde Substanzen und Krankheitserreger Immunologie immunis (lat.) = frei, unberührt Wissenschaft vom Abwehrsystem von Lebewesen gegen fremde Substanzen und Krankheitserreger Historisches Louis Pasteur (1822-1895): aktive Immunisierung gegen


Wissenschaftliche Gesellschaft zur Forschung und Weiterbildung im Bereich nahrungsmittelbedingter Intoleranzen

Wissenschaftliche Gesellschaft zur Forschung und Weiterbildung im Bereich nahrungsmittelbedingter Intoleranzen Wissenschaftliche Gesellschaft zur Forschung und Weiterbildung im Bereich nahrungsmittelbedingter Intoleranzen Newsletter Q1/2015 Das faszinierende Immunsystem Einer sehr jungen Wissenschaftsdisziplin,


Inhalt. Entdeckung und allgemeine Informationen. Klassifizierung. Genom Viren untypische Gene Tyrosyl-tRNA Synthetase. Ursprung von grossen DNA Viren

Inhalt. Entdeckung und allgemeine Informationen. Klassifizierung. Genom Viren untypische Gene Tyrosyl-tRNA Synthetase. Ursprung von grossen DNA Viren Mimivirus Inhalt Entdeckung und allgemeine Informationen Klassifizierung Genom Viren untypische Gene Tyrosyl-tRNA Synthetase Ursprung von grossen DNA Viren Entstehung von Eukaryoten Entdeckung 1992 in


Angeborene und erworbene Immunantwort

Angeborene und erworbene Immunantwort Molekulare Mechanismen der Pathogenese bei Infektionskrankheiten Angeborene und erworbene Immunantwort Hans-Georg Kräusslich Abteilung Virologie, Hygiene Institut INF 324, 4.OG


Human Papilloma Virus

Human Papilloma Virus Human Papilloma Virus Gliederung Allgemeine Informationen Virusstruktur Infektion Verschiedene Arten des Infektionsverlaufs nach Infizierung mit HPV Lebenszyklus des HPV Tumorinduktion Virusstruktur Papillomaviren


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Einführung in die Immunbiologie. Das komplette Material finden Sie hier:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Einführung in die Immunbiologie. Das komplette Material finden Sie hier: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Einführung in die Immunbiologie Das komplette Material finden Sie hier: S 2 M 2 Das Immunsystem eine Übersicht Das


Monitoring von Resistenzen in der Humanmedizin. Tim Eckmanns Robert Koch-Institut

Monitoring von Resistenzen in der Humanmedizin. Tim Eckmanns Robert Koch-Institut Monitoring von Resistenzen in der Humanmedizin Tim Eckmanns Robert Koch-Institut Unterschied Monitoring und Surveillance von Antibiotikaresistenzdaten Another task of epidemiology is monitoring or surveillance


Molekulargenetischer Nachweis und Genotypisierung von HPV

Molekulargenetischer Nachweis und Genotypisierung von HPV Molekulargenetischer Nachweis und Genotypisierung von HPV Dr. Sabine Sussitz-Rack Institut für Labordiagnostik und Mikrobiologie Vorstand: Prim. Prof. DDr. Pranav Sinha Humanes Papillomavirus HPV HPV ist


Sexuelle Übertragbarkeit von Borrelien- Erste Ergebnisse der Studie mit der Universität Jyväskylä, Finnland

Sexuelle Übertragbarkeit von Borrelien- Erste Ergebnisse der Studie mit der Universität Jyväskylä, Finnland Sexuelle Übertragbarkeit von Borrelien- Erste Ergebnisse der Studie mit der Universität Jyväskylä, Finnland Ärztliche Fortbildung Augsburg, 27.2.2016 Dr. H.G.Maxeiner, BCA-lab, Augsburg, Germany Literatur


Matthias Birnstiel. Allergien. Modul. Medizinisch wissenschaftlicher Lehrgang CHRISANA. Wissenschaftliche Lehrmittel, Medien, Aus- und Weiterbildung

Matthias Birnstiel. Allergien. Modul. Medizinisch wissenschaftlicher Lehrgang CHRISANA. Wissenschaftliche Lehrmittel, Medien, Aus- und Weiterbildung Matthias Birnstiel Modul Allergien Medizinisch wissenschaftlicher Lehrgang CHRISANA Wissenschaftliche Lehrmittel, Medien, Aus- und Weiterbildung Inhaltsverzeichnis des Moduls Allergien Immunsystem und


Molecular Farming-Produktion von therapeutischen Eiweißen in Pflanzen

Molecular Farming-Produktion von therapeutischen Eiweißen in Pflanzen Molecular Farming-Produktion von therapeutischen Eiweißen in Pflanzen Zellbiologische und methodische Grundlagen Spinnenseidenproteine aus Pflanzen Vogelgrippevakzine aus Pflanzen Therapeutische antibakterielle


Lassen Sie Ihre Kunden die gesunde Welt von COMPLETE EASY RUB erleben. Kontaktlinsenpflege in Bestform

Lassen Sie Ihre Kunden die gesunde Welt von COMPLETE EASY RUB erleben. Kontaktlinsenpflege in Bestform Lassen Sie Ihre Kunden die gesunde Welt von erleben Kontaktlinsenpflege in Bestform Verbessert die Compliance und fördert gesundes Kontaktlinsentragen Mit 3 Schritten zu besserer Kontaktlinsenpflege Bietet


Silke Hofmann: Wenn der Körper sich gegen die eigene Haut wehrt

Silke Hofmann: Wenn der Körper sich gegen die eigene Haut wehrt Powered by Seiten-Adresse: Silke Hofmann: Wenn der Körper sich gegen die eigene


Monoklonale Antikörper sind Antikörper, immunologisch aktive Proteine, die von einer auf einen einzigen B-Lymphozyten zurückgehenden Zelllinie

Monoklonale Antikörper sind Antikörper, immunologisch aktive Proteine, die von einer auf einen einzigen B-Lymphozyten zurückgehenden Zelllinie Monoklonale AK Monoklonale Antikörper sind Antikörper, immunologisch aktive Proteine, die von einer auf einen einzigen B-Lymphozyten zurückgehenden Zelllinie (Zellklon) produziert werden und die sich gegen


Q1 B1 KW 46. Krebs, Virengenetik, Bakteriengenetik, Antibiotika und genetische Aspekte des Immunsystems

Q1 B1 KW 46. Krebs, Virengenetik, Bakteriengenetik, Antibiotika und genetische Aspekte des Immunsystems Q1 B1 KW 46 Krebs, Virengenetik, Bakteriengenetik, Antibiotika und genetische Aspekte des Immunsystems Krebs und/durch Viren? Video und Text Aufgaben: 1) Bau und Vermehrung von Viren und Buch 10.6, S.


Biofilm und seine potentielle Rolle in der Wundheilung

Biofilm und seine potentielle Rolle in der Wundheilung Biofilm und seine potentielle Rolle in der Wundheilung Steven L. Percival, Philip G. Bowler Wounds 16 (7) 2004: 234-240 Zusammenfassung Der Begriff Biofilm beschreibt eine Gemeinschaft von Mikroorganismen,


Biochemische Übungen

Biochemische Übungen Dr. Arnulf Hartl Biochemische Übungen Proteine Tag 1: Tag 2: Tag 3: Konzentrieren Denaturierende und native Fällungen Protein Konzentrationsbestimmung Entsalzen Gelchromatographie Dialyse Elektrophorese


Patientenratgeber. Flora der Frau. weibliches Immunsystem für Intimbereich und Blasenfunktion

Patientenratgeber. Flora der Frau. weibliches Immunsystem für Intimbereich und Blasenfunktion Patientenratgeber Flora der Frau weibliches Immunsystem für Intimbereich und Blasenfunktion Warum sind Bakterien für den Körper wichtig? Welche Rolle spielt meine Intimflora? Wie hängt eine intakte Vaginalflora


Influenza des Schweines

Influenza des Schweines Influenza des Schweines Historie: - erstmals beobachtet 1918 in USA, China, Ungarn - zeitgleich mit der Pandemie beim Menschen (> 20 Mill. Tote) - Virus-Subtyp H1N1 - Übertragung sehr wahrscheinlich vom


Pathogene Mikroorganismen im Trinkwasser

Pathogene Mikroorganismen im Trinkwasser Pathogene Mikroorganismen im Trinkwasser Dipl. Ing. (FH) Thorsten Dilger Geschichte 1665 Entwicklung des Mikroskops 1866 Louis Pasteur 1843-1910 Robert Koch Milzbrand Morbus Koch = Tuberkulose


Nutra Nuggets Nahrungslehre

Nutra Nuggets Nahrungslehre Nutra Nuggets Nahrungslehre Hunde- und Katzenfutter in höchster Die Hauptbestandteile sind: Protein Fett Rohfaserstoffe Qualität PROTEIN Die besten Proteinquellen sind im Fleisch enthalten Geflügelfleischmehl


Angeborene Immunabwehr Klinische Relevanz der endogenen antimikrobiellen Peptide in Innerer Medizin und Dermatologie

Angeborene Immunabwehr Klinische Relevanz der endogenen antimikrobiellen Peptide in Innerer Medizin und Dermatologie ÜBERSICHT Angeborene Immunabwehr Klinische Relevanz der endogenen antimikrobiellen Peptide in Innerer Medizin und Dermatologie Jan Wehkamp, Robert Bals, Burkhard Kreft Jens-M. Schröder, Eduard F. Stange


Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32 Inhaltsverzeichnis 1. Einleitung... 9 1.1 Posttranslationale Modifikationen... 10 1.2 N-Glykosylierung... 11 1.3 O-Glykosylierung... 12 1.4 Veränderungen der Glykosylierung bei der Tumorentstehung... 13


Text: Octapharma GmbH Illustrationen: Günter Hengsberg Layout: nonmodo, Köln

Text: Octapharma GmbH Illustrationen: Günter Hengsberg Layout: nonmodo, Köln Unser Immunsystem Text: Octapharma GmbH Illustrationen: Günter Hengsberg Layout: nonmodo, Köln Bakterien und Viren können uns krank machen. Wir bekommen dann Husten, Schnupfen oder Durchfall. Unser Körper


1971: Manipulation eines Viren-Genoms mit Restriktionsenzymen. 1973: Erstes gentechnisch verändertes Bakterium - Geburt der "Gentechnik"

1971: Manipulation eines Viren-Genoms mit Restriktionsenzymen. 1973: Erstes gentechnisch verändertes Bakterium - Geburt der Gentechnik Geschichte der Gentechnik Ein kleiner Überblick: 1970-1983 1/28 1966: Entschlüsselung des genetischen Codes 1970: Entdeckung der Restriktionsenzyme in Bakterien. 1971: Manipulation eines Viren-Genoms mit



AntibiotikaResistenzmechanismen AntibiotikaResistenzmechanismen 20. Oktober 2011 Patricia Kahl Charlotte Schäfer Definition: Antimikrobielle Medikamentenresistenz Erworbene Fähigkeit eines Mikroorganismus, der Wirkung einer chemotherapeutisch


Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin


Phagozytose, Pathogen Associated Molecular Pattern (PAMPs), Pathogen Pattern Receptors, Komplement

Phagozytose, Pathogen Associated Molecular Pattern (PAMPs), Pathogen Pattern Receptors, Komplement Grundlagen der Immunologie 5. Semester - Dienstags 11.15 Uhr Ruhr-Universität Bochum, HMA 20 Phagozytose, Pathogen Associated Molecular Pattern (PAMPs), Pathogen Pattern Receptors, Komplement Albrecht


HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie HIV-Infektion und AIDS Seminar aus funktioneller Pathologie Retroviren des Menschen Lentiviren von Primaten Das Virion des HI-Virus schematisch und elektronenmikroskopisch Virale Gene Bindungssequenzen


Pille und Scheidentrockenheit bei Hormonmangel

Pille und Scheidentrockenheit bei Hormonmangel Pille und Scheidentrockenheit bei Hormonmangel? Inhalt Scheidentrockenheit, Urogenitalinfektionen und die Pille Lokaler Hormonmangel trotz Pille Verminderter Östrogengehalt im Scheidengewebe erhöhte Infektionsneigung


Neue Enzyme für ein altes Organeil: Kryptische peroxisomale Lokalisationssignale in Pilzen. Dissertation

Neue Enzyme für ein altes Organeil: Kryptische peroxisomale Lokalisationssignale in Pilzen. Dissertation Neue Enzyme für ein altes Organeil: Kryptische peroxisomale Lokalisationssignale in Pilzen Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) Dem Fachbereich Biologie der


CENTROGUARD. Antimikrobielle Wirksamkeit

CENTROGUARD. Antimikrobielle Wirksamkeit CENTROGUARD Antimikrobielle Wirksamkeit Problematik: Bakterielle Ausbreitung und mögliche Krankheitsfolgen Das Wachstum von krankheitserregenden Mikroorganismen (Keimen) wie Algen, Bakterien und Pilze


Inhalt 1 Das Immunsystem Rezeptoren des Immunsystems

Inhalt 1 Das Immunsystem Rezeptoren des Immunsystems Inhalt 1 Das Immunsystem 1.1 Bedeutung des Immunsystems..................................... 1 1.2 Das Immunsystem unterscheidet zwischen körpereigen und körperfremd.................................................


Der Verlauf ist individuell sehr unterschiedlich. Die Infektion verläuft in mehreren Stadien:

Der Verlauf ist individuell sehr unterschiedlich. Die Infektion verläuft in mehreren Stadien: HIV / Aids Was bedeutet HIV, was Aids? HIV steht für Human Immunodeficiency Virus (menschliches Immunschwächevirus). Dieses Virus schwächt das Immunsystem, mit dem der Körper Krankheiten abwehrt. Mit Aids


Man kann die Fähigkeit des Körpers, körperfremde Strukturen (Antigene) abzuwehren in 2 Kategorien einteilen:

Man kann die Fähigkeit des Körpers, körperfremde Strukturen (Antigene) abzuwehren in 2 Kategorien einteilen: Immunbiologie 1 Zum Immunsystem gehören verschiedene Organe, hochspezialisierte Zellen und ein Gefäßsystem, die alle zusammenarbeiten, um den Körper von Infektionen zu befreien. Rechts sind die verschiedenen


Adoptive Immuntherapie dendritische Zellen, Killerzellen, T-Zellen

Adoptive Immuntherapie dendritische Zellen, Killerzellen, T-Zellen Adoptive Immuntherapie dendritische Zellen, Killerzellen, T-Zellen Priv. Doz. Dr. med. Torsten Tonn Institut für Transfusionsmedizin und Immunhämatologie Johann Wolfgang Goethe Universitätsklinikum Frankfurt


Was ist Progesteron?

Was ist Progesteron? Was ist Progesteron? Das C 21 -Steroidhormon Progesteron ist der wichtigste Vertreter der Gestagene (Gelbkörperhormone) Die Verbindung gehört zur Gruppe der Sexualhormone Quelle Dr.Kade Pharma Wo wird



24-STUNDEN-SAMMELURIN Blutfarbstoffs (Hämoglobin), wird normalerweise nicht mit dem Urin ausgeschieden. Erst bei einer erhöhten Konzentration im Blutserum enthält auch der Urin Bilirubin dies ist der Fall, wenn eine Funktionsstörung


Grundlagen der Wasserhygiene Mikrobiologie. R. Holländer. Institut für Allgemeine Hygiene, Krankenhaushygiene und Umwelthygiene

Grundlagen der Wasserhygiene Mikrobiologie. R. Holländer. Institut für Allgemeine Hygiene, Krankenhaushygiene und Umwelthygiene Grundlagen der Wasserhygiene Mikrobiologie R. Holländer Institut für Allgemeine Hygiene, Krankenhaushygiene und Umwelthygiene Hygiene Lehre von der Erhaltung und Pflege der Gesundheit Mikroorganismen im


Prüfungsfragenkatalog für Pharmazeutische Analytik, Bio- und Umweltanalytik (Prof. Andreas Kungl) stand: Oktober 2014

Prüfungsfragenkatalog für Pharmazeutische Analytik, Bio- und Umweltanalytik (Prof. Andreas Kungl) stand: Oktober 2014 Termin: 30. Oktober 2014 Prüfungsfragenkatalog für Pharmazeutische Analytik, Bio- und Umweltanalytik (Prof. Andreas Kungl) stand: Oktober 2014 1. Erklären Sie möglichst ausführlich das Prinzip der HPLC,


4.2 Kokulturen Epithelzellen und Makrophagen

4.2 Kokulturen Epithelzellen und Makrophagen Ergebnisse 4.2 Kokulturen Epithelzellen und Makrophagen Nach der eingehenden Untersuchung der einzelnen Zelllinien wurden die Versuche auf Kokulturen aus den A549-Epithelzellen und den Makrophagenzelllinien


Sabine Sondermann. Martin Sondermann Heilpraktiker & APM Therapeut

Sabine Sondermann. Martin Sondermann Heilpraktiker & APM Therapeut Sabine Sondermann Heilpraktikerin & Ernährungsberaterin Martin Sondermann Heilpraktiker & APM Therapeut 11.10.2013 1 Wer sind wir & was bieten wir? Sabine Sondermann, Heilpraktikerin & Ernährungsberaterin


4.5. Ergebnisse der Expression und Aufreinigung von rekombinanten Proteinen aus Escherichia coli

4.5. Ergebnisse der Expression und Aufreinigung von rekombinanten Proteinen aus Escherichia coli 4.5. Ergebnisse der Expression und Aufreinigung von rekombinanten Proteinen aus Escherichia coli Für die Auswertung des ELISAs wurden Positivkontrollen benötigt. Dazu wurde einem Teil der Tiere subcutan


3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34 Ergebnisse 34 3 Ergebnisse 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC 3.1.1 Nachweis auf RNA-Ebene Zum Nachweis der Transkription des y + -Systems in kutanen Zellen, wurden








Titer. französisch titre: Feingehalt

Titer. französisch titre: Feingehalt Serologie Testverfahren (in der Mikrobiologie und Virologie) zur Bestimmung spezifischer Antikörper im Serum oder in anderen Körperflüssigkeiten gegen infektiöse Erreger Titer französisch titre: Feingehalt


IMMUNOLOGIE II. Kapitel 12 - Zytokine. Britta Engelhardt Theodor Kocher Institut Universität Bern.

IMMUNOLOGIE II. Kapitel 12 - Zytokine. Britta Engelhardt Theodor Kocher Institut Universität Bern. IMMUNOLOGIE II Kapitel 12 - Zytokine Britta Engelhardt Theodor Kocher Institut Universität Bern Immunolgie II Eigenschaften von Zytokinen Zytokine = Polypeptide die von Zellen das angeborenen


Der gleichzeitige Anti-Haarverlust und Haar Wachstums Complex

Der gleichzeitige Anti-Haarverlust und Haar Wachstums Complex Capixyl TM Der gleichzeitige Anti-Haarverlust und Haar Wachstums Complex Wie wichtig Haare in unserem Leben sind, kann nicht oft genug erwähnt werden. Wenn Männer, aber auch Frauen ihre Haare verlieren,


Gesellschaft zur Förderung Kynologischer Forschung. Abschlussbericht. Aktive Allergie-Gene

Gesellschaft zur Förderung Kynologischer Forschung. Abschlussbericht. Aktive Allergie-Gene Gesellschaft zur Förderung Kynologischer Forschung Abschlussbericht Aktive Allergie-Gene aus der gkf-info 38 Juni 2014 Abschlussbericht Aktive Allergie-Gene Warum kratzt sich ein Hund nach dem Kontakt


Immunbiologie. Teil 3

Immunbiologie. Teil 3 Teil 3 Haupthistokompatibilitätskomplex (1): - es gibt einen grundlegenden Unterschied, wie B-Lymphozyten und T-Lymphozyten ihr relevantes Antigen erkennen - B-Lymphozyten binden direkt an das komplette


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Antibiotikaresistenz bei Pseudomonaden

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Antibiotikaresistenz bei Pseudomonaden Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Antibiotikaresistenz bei Pseudomonaden Das komplette Material finden Sie hier: S 1 M 6 M 7 Erarbeitung II, Präsentation


System im Körper, das ihn vor Krankheiten schützt. Es zerstört deshalb fremde Substanzen, die in den Körper eindringen.

System im Körper, das ihn vor Krankheiten schützt. Es zerstört deshalb fremde Substanzen, die in den Körper eindringen. Bestandteile des Immunsystems Das Immunsystem des Menschen ist eines der wichtigsten Systeme des menschlichen Körpers, denn mit einem defekten Immunsystem führen viele Erkrankungen durch Keime unweigerlich


T-Lymphozyten. T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. verantwortlich.

T-Lymphozyten. T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. verantwortlich. T-Lymphozyten T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. Sie sind für die zellvermittelte Immunität verantwortlich. Antigenerkennung B Zellen erkennen


Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt


Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax)

Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax) Aus der Abteilung Innere Medizin II der Medizinischen Universitätsklinik der Albert-Ludwigs-Universität Freiburg im Breisgau Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres


Umgang mit Zellen und Zellkulturen

Umgang mit Zellen und Zellkulturen Jenal & Partners Biosafety Consulting 1 10-11-15 Umgang mit Zellen und Zellkulturen Eigenschaften von Zellkulturen Einstufung in Gruppen und Klassen Arbeitspraktiken HELA Zellen


Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern.

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Plasmidisolierung Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Was können Sie lernen? Sie lernen eine ringförmige DNA, ein Plasmid, zu isolieren. Mit diesem


Pyodermien. 03.03.2008 Klinik und Diagnostik. Claudia S. Nett-Mettler Dr., DACVD & DECVD 1

Pyodermien. 03.03.2008 Klinik und Diagnostik. Claudia S. Nett-Mettler Dr., DACVD & DECVD 1 Pyodermien Klinik und Diagnostik Dr., DACVD & DECVD Dermatologie und Allergologie für Tiere c/o Kleintierklinik Rigiplatz Hünenbergerstrasse 4/6 CH-6330 Cham Einleitung


BIOGELAT UroAkut D-Mannose + Cranberry Granulat

BIOGELAT UroAkut D-Mannose + Cranberry Granulat BIOGELAT UroAkut D-Mannose + Cranberry Granulat Harnwegsinfekt ein leidvolles Thema für viele Frauen! Harnwegsinfekt eine der häufigsten Infektionskrankheiten Frauen sind aufgrund der kürzeren Harnröhre


4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch


These 1: Daten-Basis zur Abschätzung der Transfusion leukozytenantikörperhaltiger Blutprodukte in Deutschland I

These 1: Daten-Basis zur Abschätzung der Transfusion leukozytenantikörperhaltiger Blutprodukte in Deutschland I TRALI aus Sicht einer UNIVERSITÄREN TME Hans-Gert Heuft Hannover, Februar 16 th, 2008 TRALI 4 Thesen 1. Der Einfluss von AK gegen Leukozyten wird stark überschätzt 2. Der Druck auf das weibliche Spenderpotential


Sexuell übertragbare Infektionen MUSTER. Sexuell übertragbare. Was muss ich wissen?

Sexuell übertragbare Infektionen MUSTER. Sexuell übertragbare. Was muss ich wissen? Sexuell übertragbare Infektionen Sexuell übertragbare Infektionen Was muss ich wissen? Was sind STDs? Sexuell übertragbare Infektionen (STD sexually transmitted diseases) werden durch verschiedene Erreger


Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005

Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 F1 Molekulare Zoologie Teil II: Expressionsanalyse Proteinexpressionsanalyse


Hygiene im Alltag. Massnahmen bei Patienten mit cystischer Fibrose (CF)

Hygiene im Alltag. Massnahmen bei Patienten mit cystischer Fibrose (CF) Hygiene im Alltag Massnahmen bei Patienten mit cystischer Fibrose (CF) Luzia Vetter, Rolf Kuhn Spitalhygiene LUKS 1 0 2 Bakterien - Pseudomonas aeruginosa - Burkholderia cepacia - Staphylococcus aureus


Biomembranen Zellkontakte (adhesive junction, tight junction, gap junction, Plasmodesmata)

Biomembranen Zellkontakte (adhesive junction, tight junction, gap junction, Plasmodesmata) Biomembranen Zellkontakte (adhesive junction, tight junction, gap junction, Plasmodesmata) Zellkontakte: dienen der mechanischen Fixierung der Zellen => Gewebestabilisierung: adhesive junction dienen der
