INAUGURAL-DISSERTATION

Transkript

1 INAUGURAL-DISSERTATION submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the degree of Doctor of Natural Sciences presented by M.Sc. Agnieszka Zdanowicz born in Olsztyn (Poland) Oral examination: 17 th May 2010

2

3 Translational repression by micrornas: mechanistic dissection using a cell-free Drosophila melanogaster embryo system Referees: 1. Dr. Anne Ephrussi 2. Prof. Dr. Felix Wieland

4

5 Summary Understanding the molecular mechanism(s) of how micrornas (mirnas) repress or destabilize messenger RNAs represents a fundamental challenge in RNA biology. Cell-free and in vivo systems have been used to analyze these processes and multiple mechanisms of mirna action have been proposed. However, many of the applied experimental approaches altered the rate and/or mode of translation (internal ribosome entry sites (IRES)-containing or A-capped mrnas), rendering interpretation of these mechanistic data difficult and causing ambiguity in the field of mirna research. Consequently, I sought a way to probe mirna-mediated control without detectably affecting general translation initiation. With this aim, I adopted a chemical biology approach and screened a library of chemically modified cap structure analogs for variants that do not affect general translation, but specifically alter mirna-mediated repression. Among the tested cap structure analogs I identified two variants, designated cap 16 and 21, with modifications of the triphosphate linker that are neutral for general translation but augment mirna-mediated silencing in vitro and in vivo. Moreover, both cap analogs reinforce the previously described mechanism of mir2 function, repressing translation initiation at a step preceding recruitment of the small ribosomal subunit to mrna. In addition, challenging translation mediated by these newly identified cap analogs with different inhibitors of cap-dependent translation revealed their selective sensitization to both 4E-BP and the mir2-repressor complex. This suggests that the mir2-repressor complex may use a mechanism similar to 4E-BP (4E-binding protein) to target cap function, which interferes with the eif4e-eif4g interaction. i

6 Summary ii

7 Zusammenfassung Eine der großen heutigen Herausforderungen im Feld der RNA Biologie ist die Aufklärung des molekularen Mechanismus von micrornas (mirnas), und insbesondere das Verständnis der Art und Weise, in welcher mirnas zur Hemmung der Proteinsynthese ihrer Ziel-mRNAs beitragen. Um Einblicke in den Mechanismus von mirnas zu erlangen, wurden in den letzten Jahren sowohl Zell-freie als auch in vivo Systeme benutzt, welche zu unterschiedlichen Ergebnissen und Interpretationen führten. Diese unterschiedlichen Beobachtungen sind nicht nur auf die verschiedenen experimentellen Systeme sondern auch auf die abweichenden Untersuchungsmethoden zurückzuführen, welche in vielen Fällen die Art und Weise der Proteinsynthese beeinflussen, zum Beispiel durch die Benutzung von A-cap oder IRES-haltigen RNAs. Da sich jedoch Veränderungen der Proteinsynthese-Rate auf die Interpretation von Daten über den molekularen Mechanismus von mirnas auswirken, gibt es bisher noch kein einheitliches Verständnis der molekularen Funktionsweise von mirnas. Aus diesem Grund entwickelte ich in der vorliegenden Arbeit eine Methode, mit welcher der molekulare Mechanismus von mirnas ergründet werden kann, ohne auf die generelle Proteinsynthese messbar Einfluss zu nehmen. Insbesondere untersuchte ich in meiner Arbeit eine Bibliothek von chemischmodifizierten cap-strukturanalogen, um Analoge zu finden, welche keinen Einfluss auf die generelle Proteinsynthese haben, jedoch den Effekt von mirnas spezifisch verändern. Unter den getesteten cap-strukturanalogen konnte ich speziell zwei Analoge identifizieren, hier als cap 16 und 21 bezeichnet, welche sich als neutral in Bezug auf die generelle Proteinsynthese erwiesen, jedoch den Effekt von mirnas sowohl in vitro als auch in vivo verstärkten. Analysen, welche mit beiden Analogen durchgeführt wurden, bestätigten den zuvor beschriebenen molekularen Mechanismus für mir2, namentlich die Repression der Proteinsynthese durch die mirna, welche während der Initiation in einer Phase vor der Rekrutierung der kleinen ribosomalen Untereinheit zur Ziel-mRNA iii

8 Zusammenfassung stattfindet. Wenn Proteinsynthese-Inhibitoren getestet wurden, reagierten beide cap-analoge spezifisch auf den mir2-repressorkomplex und auch auf 4E- BP (4E-bindende Proteine). Diese Daten deuten darauf hin, dass der mir2- Repressorkomplex einen ähnlichen Mechanismus wie 4E-BP verwenden könnte, welcher die Interaktion zwischen eif4e und eif4g beeinträchtigt, um die cap- Funktion zu beeinflussen. iv

9 Dedication z dedykacją dla moich kochanych rodzicόw (with a dedication to my beloved parents) v

10 Dedication vi

11 Table of Contents SUMMARY...i ZUSAMMENFASSUNG...iii DEDICATION...v TABLE OF CONTENTS...vii LIST OF FIGURES AND TABLES... ix 1. INTRODUCTION Translational control of gene expression Translation of eukaryotic mrnas Canonical translation initiation Translation elongation and termination Non-canonical translation initiation (internal initiation) Mechanisms of translational control Global control mrna specific control micrornas microrna discovery microrna biogenesis Argonaute proteins GW182 proteins micrornas mode of action Translational repression mrna degradation microrna-mediated translational activation Modulation of microrna function Aim of the thesis: exploration of the role of the cap structure to investigate the mechanism of microrna-mediated repression MATERIALS AND METHODS Materials Chemicals and reagents Buffers, solutions and media used Laboratory materials Instruments vii

12 Table of Contents Constructs PCR primers Bacterial strains Methods Molecular biology methods Specific techniques for studying microrna-mediated translational repression RESULTS Screen of chemically modified cap structure analogs for variants that are neutral for cap-dependent translation Test of the chemically modified cap structure analogs in translation Modifications of the cap triphosphate linker specifically augment microrna-mediated repression in vitro and in vivo Test of the chemically modified cap structure analogs in mir2-mediated repression in vitro Test of mir2 dependence in repression of mrnas with cap 16 and Investigating the cause of augmented repression of mrnas with cap 16 and Test of the chemically modified cap structure analogs in mir2-mediated repression in vivo Validation of mir2-mediated repression of mrnas with cap 16 and Using modified caps as a tool to dissect the repression mechanism Challenging translation mediated by cap 16 and 21 with inhibitors of cap-dependent translation DISCUSSION AND OUTLOOK Chemically modified cap structure analogs bring new insight into the mechanism of microrna-mediated translation repression Future avenues of this project Exploring the scope of the mir2 mode of action Investigation of microrna-mediated regulation of TOP mrnas Identification of mir2-associated translation repression proteins Further applications of the chemically modified cap structure analogs REFERENCES PUBLICATIONS AND PRESENTATIONS Publications Presentations ABBREVIATIONS ACKNOWLEDGEMENTS viii

13 List of Figures and Tables Figure 1. Model of the canonical pathway of eukaryotic translation initiation... 8 Figure 2. Schematic representation of translation elongation Figure 3. Generic model for the regulation of initiation by 3 UTR-protein interactions Figure 4. Representation of a minimal RISC Figure 5. mirna biogenesis pathway Figure 6. Domain organization of Drosophila melanogaster Ago Figure 7. Domain organization of GW182 proteins Figure 8. Possible mechanisms of mirna-mediated repression Figure 9. Bioluminescent reactions catalyzed by firefly and Renilla luciferases Figure 10. Structures of chemically modified cap analogs used for screening Figure 11. mirna-mediated translational repression is faithfully recapitulated in the Drosophila embryo cell-free system Figure 12. Structures of the cap analogs that augment mir2-mediated repression and are inert for general translation Figure 13. Identification of cap structure analogs that are neutral for cap-dependent translation but act as gain-of-function variants for mirna-mediated repression in vitro Figure 14. Translational repression via cap 16 and 21 is mir2-dependent Figure 15. mrna reporters with cap 16 or 21 are not degraded during mir2-mediated repression Figure 16. Cap 16 and 21 also augment mir2-mediated repression in vivo Figure 17. The mir2-mediated repression of mrnas with cap 16 and cap 21-ARCA involves the interaction between DmAgo1 and DmGW Figure 18. mirnas block stable small ribosomal subunit binding to reporters with cap 16 and Figure 19. Pseudo-polysomes form on WT reporters with similar efficiency, irrespective of the cap analog type Figure 20. Validated inhibitors of translation initiation and their mode of action Figure 21. Cap 16 and 21-ARCA specifically augment inhibition by 4E-BP Figure 22. Cap 16 and 21-ARCA specifically augment inhibition by 4E-BP and the mir2-repressor complex Figure 23. Structure of the murine eif4e-7-methyl-gdp complex Figure 24. Model summarizing a mode of action of the mir2-repressor complex ix

14 List of Figures and Tables Table 1. Chemically modified cap structure analogs in translation Table 2. Chemically modified cap structure analogs in repression x

15 1. Introduction 1

16 1. Introduction 2

17 1. Introduction 1.1 Translational control of gene expression The main purpose of regulated gene expression is the establishment of the biologically appropriate proteome of the cell. Since the process of protein synthesis is complex and requires significant energy and sophisticated molecular machinery, it needs to be tightly controlled. However, viewed from a broader perspective, translation occupies a position somewhere in the middle of the complex gene expression pathway that begins with transcription, continues with RNA processing and transport, and ends with protein translocation, modification, folding, assembly and degradation. If transcription is subject to elaborate control, why does translation need to be controlled as well? There are several compelling reasons for cells to implement translational control in their arsenal of regulatory mechanisms (Mathews, 2007; 2000), including: Directness and rapidity: Translational control is applied to the last step of the flow of genetic information and thus avoids the delay imposed by mrna transcription, nuclear processing and export. Reversibility: Most translational control is imposed through reversible modifications of translation factors (mainly through phosphorylation), which is energetically economical (reviewed by Gebauer and Hentze (2004)). In addition, RNA binding proteins were shown to reversibly modulate microrna function in situations such as stress or memory formation (Chekulaeva and Filipowicz, 2009 and see below). Fine-tuning: In most cases the changes in transcription rates are significantly greater in magnitude than the changes brought by translational regulation, implying that the latter provides a means for fine tuning. Systems that lack transcriptional control: In some systems (e.g. oocytes, reticulocytes and RNA viruses) there is hardly any opportunity for transcriptional control. Therefore, gene expression is modulated primarily at the level of translation. 3

18 1. Introduction Spatial control: Localization of protein synthesis within a cell can generate a protein concentration gradient. This has advantages over protein targeting and allows for a fast response to local requirements. Precise localization of protein synthesis within a cell is crucial for maintenance of cellular asymmetry of polarized cells such as fibroblasts, endothelial cells and neurons, where it facilitates synaptic plasticity (Bramham and Wells, 2007). Moreover, protein gradients established through spatially controlled translation are also known to determine patterning in early development (Du et al., 2007; Ephrussi and St Johnston, 2004). Flexibility: The wide repertoire of translation control permits on the one hand specificity via effector mechanisms targeting one or a few genes/cistrons and on the other hand generality, to affect the whole class of mrnas. This flexibility provides the cell with a powerful and adaptable mode of gene expression regulation. Owing to the properties mentioned before, protein synthesis has emerged as a commonly targeted process for gene expression regulation during development. A number of essential developmental processes, such as axis formation, neurogenesis, spermatogenesis and X-chromosome dosage compensation are controlled by translational mechanisms (Kuersten and Goodwin, 2003). Furthermore, regulated translation governs other biological processes such as basic metabolism, apoptosis, learning and memory formation as well as cancer (Sonenberg and Hinnebusch, 2009; Holcik and Sonenberg, 2005; Klann et al., 2004). 1.2 Translation of eukaryotic mrnas Eukaryotic mrna transcribed in the nucleus needs to carry specific terminal modifications: a 7-methylguanosine cap structure at the 5 end and a nucleotide long (or longer) poly-adenosine stretch at the 3 end of the mrna to be transported into the cytoplasm. These two elements are involved not only in (i) 4

19 1. Introduction RNA export from the nucleus, but also in (ii) RNA stability/protection against exonucleases, (iii) RNA integrity control prior to translation and (iv) translational efficiency. One translational cycle, whose aim is to decode a messenger RNA into a protein, can be divided into three phases: (i) initiation, (ii) elongation and (iii) termination. During translation initiation the two ribosomal subunits assemble at the AUG codon to form a translation-competent 80S ribosome. Next, in the elongation phase, the 80S ribosome translates the genetic code into a chain of amino acids through successive rounds of peptide bond formation. Finally, in the termination phase, translation elongation pauses at a stop codon, the synthesized peptide is then released and the ribosomal subunits dissociate. Throughout the whole process of translation, a wide repertoire of factors binds to the ribosome and/or mrna to facilitate the efficiency of the process. In the following sections the aforementioned translation steps will be described in detail Canonical translation initiation According to the current model (Figure 1), the eukaryotic initiation pathway includes the following steps (reviewed by Jackson et al., (2010) and Mathews (2007)): 1. Ribosome recycling involves dissociation of the 80S ribosome into subunits and prevents their re-association. This process is mediated by eif6 binding to the 60S, and by eif1, eif1a and eif3 binding to the 40S ribosomal subunit (Ceci et al., 2003; Trachsel and Staehelin, 1979; Thompson et al., 1977). Recycling at higher Mg 2+ concentrations (which stabilizes ribosomal subunit association) additionally requires a recently identified ATP-binding cassette subfamily E member 1 (ABCE1) protein, which splits posttermination ribosomal complexes into free 60S subunits and trna- and mrna-bound 40S subunits, prior to release of P-site trna and mrna from the 40S subunits by eif1, eif1a and eif3 (Pisarev et al., 2010). 5

20 1. Introduction 2. Ternary complex formation is the assembly of eif2, GTP and MettRNA Met Met i. Its role is the delivery of Met-tRNA i to the 40S subunit and identification of the start codon within the mrna (Olsen et al., 2003). 3. Formation of the 43S pre-initiation complex by the ternary complex and 40S subunit is facilitated by eif1, eif1a, eif3 and eif5, using a mechanism involving direct interaction of eif2 with 40S, interaction between factors, and induced conformational changes in the 40S subunit (Majumdar et al., 2003; Olsen et al., 2003; Valasek et al., 2002; Chaudhuri et al., 1999). 4. mrna activation is strongly promoted by the interaction of the cap with the eukaryotic initiation factor eif4f complex. The proposed role of eif4f in initiation is to increase the mrna competence by: (i) binding the 5 end, (ii) melting the secondary structure around the 5 cap to facilitate attachment of the 40S ribosomal subunit, and (iii) bridging the ribosomal subunit to the mrna (Marintchev and Wagner, 2004). The eif4f complex consists of three subunits: eif4e: the 5 cap-binding subunit, eif4g: the multi-interacting protein and eif4a: the RNA ATP-dependent helicase, whose activity is additionally promoted by eif4b (Oberer et al., 2005). eif4g is the central organizer of the assembly of the ribosomal subunit on the mrna (Prevot et al., 2003). It binds eif4e as well as eif4a, and enhances each of their functions, which are to stabilize the eif4f-mrna interaction and to enhance unwinding of the 5 cap-proximal structure, respectively. eif4g also interacts with the poly(a) tail binding protein, PABP, which in turn binds the 3 poly(a) tail, bringing the mrna into a closed-loop conformation (Wells et al., 1998; Gallie, 1991). The physical circularization of the mrna has been proposed to serve several roles, including: (i) increasing the stability of the mrna, (ii) enhancement of the translation factor interaction with the mrna, which, as a result, becomes highly competent to bind the 40S subunit, and (iii) recycling of the terminating ribosomes back to the 5 end (Gallie, 1998). Once eif4f is positioned, the 43S pre-initiation complex is ready to load via the eif3-eif4g interaction. 5. Loading of the 43S pre-initiation complex on the mrna can proceed independently of any other factors if the 5 end of the mrna lacks secondary 6

21 1. Introduction structure (Pestova and Kolupaeva, 2002), but is strongly promoted by the interaction of the cap with the eukaryotic initiation factor eif4f complex, which in turn interacts with eif3 (LeFebvre et al., 2006). This cap-eif4eeif4g-eif3-40s chain of interactions is responsible for recruitment of 43S complexes, which is facilitated by eif1- and eif1a-induced open latch conformation of 40S subunits (Passmore et al., 2007). 6. Ribosomal scanning on mrna proceeds in the 5 to 3 direction until the 43S complex encounters the first AUG codon. If the 5 UTR of an mrna contains even weak secondary structure, this process is dependent on ATPhydrolysis (Kozak, 1980) and helicase activity of eif4a and eif4b. Although it is unclear whether the 43S complex remains physically associated with the cap structure during scanning, the eif4f complex has been shown to support this process (Pestova and Kolupaeva, 2002). 7. Recognition of the initiation codon is determined by its complementarity with the anticodon in the Met-tRNA Met i. The initiation codon is usually the first AUG triplet in an optimum context: GCC(A/G)CCAUGG, with a purine at the -3 and a G at the +4 positions (relative to the A of the AUG codon, which is designated +1) (Kozak, 1991). In a current model, eif1, together with eif1a, promotes a scanningcompetent open conformation of the 43S complex (Passmore et al., 2007), but to establish stable codon anticodon base-pairing, ribosomal complexes must undergo conformational changes that are antagonized by eif1. Establishment of codon anticodon base pairing is accompanied by tightening of the eif1a 40S interaction (Passmore et al., 2007) and eif1 s displacement (Maag et al., 2005; Unbehaun et al., 2004), which switches the complex to a closed conformation that is locked onto the mrna. 8. Ribosomal subunit joining requires eif5 to catalyze the hydrolysis of eif2-bound GTP, which is thought to release most of the initiation factors including eif2-gdp from the small ribosomal subunit, but to leave eif1, eif3 and the initiator trna (Unbehaun et al., 2004). Next, eif5b (a second GTPase) binds to the 48S initiation complex and allows the 60S subunit to join (Pestova et al., 2000). 7

22 1. Introduction 9. Hydrolysis of eif5b-bound GTP and release of eif5b and eif1a. Eventually, ribosome-stimulated GTP hydrolysis on eif5b releases eif5b-gdp, eif1, eif1a, eif3 as well as residual eif2 and allows the formation of an elongation competent 80S ribosome (Pestova et al., 2000). Figure 1. Model of the canonical pathway of eukaryotic translation initiation. The canonic pathway of eukaryotic initiation is divided into eight stages (2-9). These stages follow the recycling of post-termination complexes (post-tcs; 1), to yield separated 40S and 60S ribosomal subunits ready for the next round of translation (figure taken from Jackson et al., 2010). 8

23 1. Introduction As mentioned before, efficient translation initiation and optimal stability of most eukaryotic mrnas depends on the formation of a closed-loop structure and the resulting synergistic interplay between the 5 m 7 GpppN-cap and the 3 poly(a) tail (Gallie, 1991). The cap stacks between two Trp residues on eif4e s concave surface while additional contacts with the methylated cap-proximal nucleotide stabilize eif4e s binding to m 7 G-capped mrna (von der Haar et al., 2004). A segment of eif4g wraps around eif4e s N-terminus, inducing structural changes that enhance eif4e s affinity for the cap (Volpon et al., 2006). In contrast, the non-physiological, unmethylated ApppN cap does not bind the eif4e/eif4f complex and it is therefore uncertain whether the A-capped mrnas acquire a closed-loop conformation during translation Translation elongation and termination In contrast to eukaryotic initiation, elongation is a simpler process (Figure 2). Its requirements are to maintain the reading frame, to select and deliver the correct aminoacyl-trnas to the 80S ribosome, and to form peptide bonds. Only two elongation factors are required for these tasks: eef1a, which helps bring the charged trnas to the ribosome, and eef2, which promotes translocation of the ribosome along the mrna (Mathews, 2007). 9

24 1. Introduction Figure 2. Schematic representation of translation elongation. One complete elongation cycle is depicted, which involves: eef1a recycling mediated by eef1b; ternary complex formation; binding to the ribosome and trna selection; GTP hydrolysis in eef1 followed by peptidyl transfer; and the final translocation step (graphic created by Karsten Beckmann). Translation termination is mediated by the release factor erf1, which recognizes one of three stop codons and binds to the ribosome in place of a trna. This event, along with binding of erf3, stimulates GTP hydrolysis and release of the peptide chain (Fan-Minogue et al., 2008; Mathews, 2007) Non-canonical translation initiation (internal initiation) While the presence of the cap is a key element for translation, many viral and some eukaryotic mrnas obviate this need by employing the mechanism of internal initiation. Internal initiation requires special structural elements inside mrna molecules, termed internal ribosome entry sites (IRESs), which vary greatly in length, sequence and structure, but are all capable of recruiting the 40S ribosomal 10

25 1. Introduction subunit to close proximity of the initiation site (Kieft, 2008; Hellen and Sarnow, 2001). Since this form of translation initiation obviates the need for cap recognition or ribosomal scanning from the 5 end of the mrna, it requires a non-canonical set of translation factors and/or IRES trans-acting factors (ITAFs), whose composition depends on the autonomy of the virus. For example, it was shown that translation initiation driven by the Encephalomyocarditis virus (EMCV) IRES, a member of picornaviruses that were the first viruses discovered to mediate internal initiation (Nomoto et al., 1977), is independent of eif4e, PABP, and the N- and C-terminal parts of eif4g (Pestova et al., 1996b; Pestova et al., 1996a). The central 4A-binding part of eif4g (eif4g ) was shown to interact specifically with the EMCV IRES, thus mediating 48S complex formation on the viral mrna (Lomakin et al., 2000; Pestova et al., 1996a). However, the most extreme internal initiation mechanism is used by the Cricket paralysis virus intergenomic region IRES (CrPV IGR IRES) (Sasaki and Nakashima, 2000; Sasaki and Nakashima, 1999). This virus assembles the elongation competent Met ribosomes independently of any initiation factors, Met-tRNA i or an AUG. The secondary structure of the IRES mimics a trna structure, which lures the ribosome and places the non-canonical initiation codon into the A-site of the ribosomal subunit (Wilson et al., 2000a; Wilson et al., 2000b). Interestingly, IRESs have been found not only in viruses but also in a number of cellular mrnas engaged in oncogenesis, growth control, transcription, translation and other processes (Komar and Hatzoglou, 2005; Hellen and Sarnow, 2001). Not surprisingly, the first IRES element discovered in a cellular mrna (encoding the immunoglobulin heavy chain binding protein BiP) was detected by its continued expression in poliovirus-infected cells, when most cellular/host mrnas were repressed (Sarnow, 1989). 11

26 1. Introduction 1.3 Mechanisms of translational control Regulation of translation leads to protein synthesis being switched on or off in response to external stimuli. It can occur at various stages of translation, but the main level of control is initiation. We can distinguish: (1.3.1) global control of translation, which affects the general pool of mrnas, and (1.3.2) mrna specific control of translation, which targets defined subsets of transcripts Global control Global control of translation is implemented by changes in the activity of the general components of the translation machinery, such as eif2 and eif4e. Their control is mediated primarily by changes in the phosphorylation state of these initiation factors or their regulators (e.g. 4E-binding proteins) (reviewed by Gebauer and Hentze (2004)). As previously described, eif2 plays an important role in the selection and transfer of the initiator trna onto the small 40S ribosomal subunit (reviewed by Mathews (2007)). In its active GTP-bound state, eif2 forms the ternary complex with the Met-tRNA Met i. eif5 activates the GTPase activity of eif2 upon the commitment of a 40S subunit to a start codon, which results in irreversible hydrolysis of the GTP, followed by the release of eif2 from the 40S ribosomal unit, in the GDP-bound form. Active eif2 is rapidly regenerated for a new round of translation through the exchange of a GTP with the bound GDP. This is catalyzed by eif2b, a guanine nucleotide exchange factor. The activity of eif2 in the formation of the 43S preinitiation complex is regulated by its phosphorylation state. Once phosphorylated, eif2 remains tightly bound to eif2b. This sequestration of eif2b, which is in limiting supply within the cell, prevents further GTP-GDP exchange and therefore results in an accumulation of inactive GDP-bound eif2 (Pavitt, 2005). This rapidly results in a deprivation of the ternary complex, which leads to a general decrease of translation. 12

27 1. Introduction The second target in the global control of translation is the formation of the eif4f complex, regulated by the translation repression proteins: the 4E-binding proteins (4E-BPs), of which there are three paralogs in mammals and a single one in Drosophila. 4E-BP proteins compete with eif4g for the same binding site on eif4e. The 4E-BP-eIF4E interaction prevents the assembly of the eif4f complex, and therefore results in a general inhibition of cap-dependent translation. 4E-BP affinity for eif4e is regulated by its phosphorylation state. Hypo-phosphorylated 4E-BP binds eif4e, while its hyper-phosphorylated form loses affinity for eif4e and therefore favors eif4e/eif4g interaction. The phosphorylation state of 4E-BP is controlled by the mtor signal transduction pathway, which activates protein kinases in response to extracellular stimuli such as growth factors, hormones, cell stress and amino acid deprivation (Gingras et al., 1999). A positive regulation of translation is found in vertebrates, where eif4e is also directly targeted for phosphorylation by MnK1 kinase, which is bound to eif4g. Phosphorylated eif4e has an increased affinity for eif4g and for the cap, which results in higher translation efficiency (Gingras et al., 1999) mrna specific control mrna specific regulation of translation is mediated by trans-acting factors binding to untranslated regions of a target. This process of regulation, which can result either in translation repression or activation, modulates temporally and spatially controlled events such as cell differentiation and embryonic development. mrna specific control of translation occurs at different stages of translation and can be either ( ) protein- or ( ) RNA-mediated (reviewed by Jackson et al., (2010)). Examples of such control are described below. 13

28 1. Introduction Protein-mediated control Regulation of 43S preinitiation complex recruitment to the 5 end of the mrna The recruitment of the 43S preinitiation complex to the 5 end of the mrna represents a rate-limiting step in translation initiation. Therefore, not surprisingly, many translation regulators binding to the 5 and/or 3 UTR inhibit exactly this step, both by steric hindrance as well as by functional interference with translation initiation factors. The following sections will illustrate a few examples of regulation at this early step of translation. (i) Steric hindrance of 43S pre-initiation complex recruitment by IRP/IRE complex The best studied example of protein-mediated translational inhibition via steric hindrance is the regulation of ferritin (Paraskeva et al., 1999; Muckenthaler et al., 1998; Gray and Hentze, 1994). Ferritin is the major iron-binding protein that sequesters excess intracellular iron, thereby protecting cells from the generation of reactive oxygen and nitrogen free radicals that could damage DNA. Translation of ferritin heavy- and light-chains is switched on or off by the iron-response proteins (IRP1 and IRP2). In the absence of Fe 3+, the IRP proteins have a strong affinity for a specific stem-loop motif, the Iron Responsive Element (IRE), which is present in the 5 UTR of ferritin mrna. Binding of IRP does not affect the association of the eif4f cap-binding complex with the mrna but blocks entry of the 43S ribosomal subunit. In the presence of iron ions, the affinity of IRP for IRE decreases and allows translation of ferritin, which then binds and titrates the excess of Fe 3+. The translation repression of ferritin is also relieved when the IRE is shifted away from the cap-proximal position, suggesting that the IRE/IRP complex sterically occludes 43S binding. Furthermore, IRP/IRE can be functionally repressed by another protein-rna complex, which is normally not involved in translational repression. For example, UA1 spliceosomal protein UA1 and the UA1-binding sequence can mediate translation repression via steric hindrance with efficiency comparable to IRP/IRE. 14

29 1. Introduction (ii) Inhibition of 43S pre-initiation complex recruitment by transcript specific 3 UTR binding proteins The most widespread mode of specific, protein-mediated translation regulation involves proteins binding to the 3 UTR of the regulated mrna (reviewed by Jackson et al., (2010)). Many of the better understood examples of such regulation conform to the generic model shown (Figure 3), in which protein X binds in a sequence-specific manner to an explicit 3 UTR motif of mrna and interacts with an intermediate bridging protein (protein Y), which in turn interacts with a capbinding protein (protein Z). Such an arrangement of inhibitory proteins leads to the formation of an inhibitory closed loop that precludes access of the eif4f complex to the 5 end of the mrna (Figure 3). As protein X is the only sequence-specific RNA-binding protein amongst the three, its identity in the complex differs more widely between different mrnas or groups of mrnas than the identities of protein Y and protein Z (table in Figure 3). The functions of protein X and protein Y can be embodied in a single protein (for example Bicoid) or in a group of proteins (Nanos, Pumilio and Brat) (Sonenberg and Hinnebusch, 2009). Figure 3. Generic model for the regulation of initiation by 3 UTR-protein interactions. CPEB: cytoplasmic polyadenylation element-binding protein; 4EHP: eif4e homologous protein; eif: eukaryotic initiation factor; eif4e-t: eif4e transporter. *CPEB homologs with the same function are present in D. melanogaster (ORB) and C. elegans (FOG-1), but not in budding yeast. 4E-T homologs with the same function are present in D. melanogaster (CUP) and C. elegans (SNP-2), but not in budding yeast. D. melanogaster has eight eif4e-like proteins, including one 4E-HP, but no equivalent of mammalian eif4e1b. eif4e1a is by far the most abundant species in embryos, and thus is likely to be protein Z. Fulfils the functions of both protein X and protein Y (figure taken from Jackson et al., 2010). 15

30 1. Introduction (iii) Dual repression of oskar mrna translation by impairment of 43S pre-initiation complex recruitment and promotion of mrna oligomerization mrna localization is used in many organisms to target proteins to their site of function and is often coupled to translation inhibition to prevent pre-mature protein production before the mrna is localized (Besse and Ephrussi, 2008). oskar mrna encodes the posterior determinant of Drosophila (Lehmann and Nusslein- Volhard, 1986), Oskar protein, whose localized accumulation at the posterior pole of the oocyte and embryo is essential for the formation of the abdomen and germline. Before reaching the posterior pole of the Drosophila oocyte, oskar mrna is translationally silenced by Bruno binding to BREs in the 3 UTR (see Figure 3). Bruno has been proposed to inhibit translation initiation via two mechanisms: an interaction with the Cup protein (cap-dependent, (Nakamura et al., 2004; Wilhelm et al., 2003)) and sequestration of oskar mrna in silencing particles (cap- and Cupindependent (Chekulaeva et al., 2006)). In addition to the BRE/Bruno repression mechanism inhibiting 43S pre-initiation complex recruitment to oskar mrna according to the generic model described in the previous paragraph, the second silencing mechanism involves oskar mrna oligomerization and formation of large (50-80S) particles that cannot be accessed by ribosomes (Chekulaeva et al., 2006). The latter repression mechanism seems to be very well suited to couple translation inhibition to mrna transport within the cell. In addition, this repression mechanism allows coordinated repression and derepression of multiple oskar mrnas, and possibly other colocalizing mrnas. (iv) Fail-safe inhibition of 43S complex recruitment and scanning on male-specificlethal-2 mrna Male-specific-lethal-2 (MSL-2) protein is a limiting component of the dosage compensation complex in Drosophila that assembles on the single male X chromosome and promotes its hypertranscription in order to equalize the expression of X-linked genes in males and females (Bashaw and Baker, 1995). In female flies, MSL-2 is not produced, because msl-2 is translationally repressed by 16

31 1. Introduction the female-specific Sex-lethal protein (SXL) bound to specific sites in both the 5 and 3 UTR of msl-2 mrna (Gebauer et al., 1998; Bashaw and Baker, 1997; Kelley et al., 1997). Sucrose density gradient analysis and toeprint assays revealed that SXL functions via a dual failsafe mechanism: SXL bound to the 3 UTR of msl-2 interferes with the initial recruitment of 43S pre-initiation complexes to the mrna, while 5 UTR-bound SXL stalls any residual scanning 43S complexes that have escaped the first inhibitory mechanism (Beckmann et al., 2005). Such a fail-safe mechanism ensures a tight control of MSL-2 expression. Translational control can also be executed by numerous other modes such as: (i) inhibition of 60S subunit joining, (ii) shortening of a poly(a) tail, (iii) upstream open reading frames, (iv) specific localization of mrna within a cell, etc. (reviewed by Besse and Ephrussi (2008) and Sonenberg and Hinnebusch (2009)) which for reasons of focus will not be described here RNA-mediated control The recently discovered RNA-mediated control of mrna translation and stability involves binding of a trans-acting RNA to a target site, which is usually positioned in the 3 UTR of the mrna target. Two types of non-coding RNAs are mostly involved in this type of regulation: ~21-25-nt short interfering RNAs (sirnas) and ~22-nt micrornas (mirnas) (Filipowicz et al., 2005). The first class, sirnas, originate from long double-stranded RNA (dsrna) molecules that result from RNA virus replication, convergent transcription of cellular genes or mobile genetic elements, self-annealing transcripts or experimental transfection. These small RNAs mediate RNA interference (RNAi) by downregulating target RNA levels through endonucleolytic cleavage, also called slicing. In contrast, the second class of small regulatory RNAs, micrornas, are encoded in the genome and their mechanism of action is more complex. In cases of perfect or near-perfect complementarity to the mirna, target mrna can be cleaved and the fragments degraded. Otherwise, the mrna expression is inhibited by mechanism(s) that are not yet completely-defined (see below). The consensus regarding the 17

32 1. Introduction mechanism of mirna-mediated repression identifies its two major components: repression of mrna translation sensu stricto, and an accelerated rate of mrna degradation through a deadenylation-dependent pathway (Behm-Ansmant et al., 2006) (see below). The relative importance of these two components seems to vary between different mirna-mrna pairs for unknown reasons. The fate of the target mrna depends also on the nature of the Argonaute protein (one of the essential RISC components, introduced below). Regardless of the mrna fate, the mirna-mediated repression normally requires perfect base-pairing of the mrna target with the seed region of the mirna (residues 2-8) (Brennecke et al., 2005; Doench and Sharp, 2004). In contrast, basepairing between the mrna target site and the 3 -proximal part of the mirna is less stringent. However, good base-pairing in this position can compensate for a suboptimal seed match. Recent studies suggest that the exact configuration of the mismatches, mrna sequences flanking the target sites, the number of target sites, the distance separating them, and their position in the 3 UTR may all influence the efficiency of repression (Grimson et al., 2007). 1.4 micrornas micrornas can be regarded as adaptors that confer sequence-specific binding of associated repressor proteins to a target mrna. The minimal RISC (RNA-induced silencing complex) consists of a mirna complementary to the target mrna, Argonaute (Ago) and GW182 proteins (Figure 4), which will be described in detail in the following sections. The evidence that mirnas recruit Ago, which in turn recruits GW182, the most downstream effector of translational repression identified so far, is best demonstrated by experiments where tethering of the Drosophila or any of the three human GW182 paralogs results in full repression of the reporter mrna, bypassing the requirement for both Ago and mirna (Zipprich et al., 2009; Behm-Ansmant et al., 2006). 18

33 1. Introduction Figure 4. Representation of a minimal RISC constituted by a microrna partially complementary to the 3 UTR of a messenger RNA and two repressor proteins: Argonaute (Ago) and GW microrna discovery lin-4 encoding a ~22-nt non-coding RNA (Lee et al., 1993; Wightman et al., 1993) is the founding member of the microrna family that, in the field of RNA research, was first considered a peculiarity of C. elegans developmental regulation. In the meantime, thousands of mirnas have been identified in plants, animals and viruses by molecular cloning and by bioinformatic approaches (Sandmann and Cohen, 2007; Lagos-Quintana et al., 2001; Lee and Ambros, 2001). Moreover, mirnas have been implicated in a wide range of biological processes including: development, cellular differentiation, proliferation and apoptosis (Bushati and Cohen, 2007). It is estimated that even half of the human genome could be controlled by mirnas, as there are ~ 1000 mirnas and each of these controls approximately ~10 mrnas (Sonenberg and Hinnebusch, 2009), suggesting that mirnas constitute a broad new layer of regulatory control over gene expression programs microrna biogenesis The following chapter briefly summarizes key aspects of the genesis of micrornas that are known to originate from: (a) their own genes, (b) mrna introns and (c) splicing reactions (Figure 5) (reviewed by Kim et al., (2009)). 19

34 1. Introduction (a) mirnas originating from their own genes Most mirna genes are transcribed by RNA polymerase II (Pol II) to generate primary mirnas (pri-mirnas), which have a stem-loop shape and range in size from several hundred nucleotides to tens of kilobases (Cai et al., 2004; Lee et al., 2004). An exception to this rule are mirnas lying within repetitive Alu elements, which are transcribed by RNA polymerase III (Borchert et al., 2006). Like mrnas, Pol II transcribed pri-mirnas bear 5 cap structures, are polyadenylated, and may be spliced (Bracht et al., 2004; Cai et al., 2004). The next step of ~70 nt pre-mrna generation, called cropping, is mediated by the Drosha DiGeorge syndrome critical region gene 8 (DGCR8; Pasha in D. melanogaster and C. elegans) complex (also known as the Microprocessor complex). Pre-miRNA has a short stem plus a ~2 nt 3 overhang, which is recognized by the nuclear export factor Exportin 5, which binds to and transports the pre-mirna into the cytoplasm via a Ran-GTP-dependent mechanism (Bohnsack et al., 2004; Yi et al., 2003). On export from the nucleus, Dicer, interacting with the dsrbd proteins TRBP/PACT or Loquacious (LOQS) in flies, catalyzes the second processing (dicing) step, which leads to the production of ~22 nt mirna/mirna* duplexes (Lee et al., 2006; Chendrimada et al., 2005; Hutvagner et al., 2001). Subsequently, TRBP/LOQS recruits the Argonaute protein, and, together with Dicer, forms a trimeric complex that initiates the assembly of the RISC (Tomari et al., 2007; Gregory et al., 2005). In Drosophila, mirna/mirna* duplexes containing a central mismatch are loaded into an Ago1-containing RISC (Tomari et al., 2007), whereas those whose central region is base-paired are loaded into both, Ago1- and Ago2-containing RISCs (Forstemann et al., 2007). The mirna strand with relatively lower thermodynamic stability of base-pairing at its 5 end is incorporated into the mirisc, whereas the passenger strand, or mirna* strand, is degraded (Khvorova et al., 2003; Schwarz et al., 2003) (Figure 5A). (b) mirnas originating from mrna introns Canonical intronic mirnas are processed co-transcriptionally before splicing. The splicing commitment complex is thought to tether the introns, while Drosha cleaves the mirna hairpin. The pre-mirna enters the mirna pathway, whereas the rest of the transcript undergoes pre-mrna splicing and produces mature mrna for protein synthesis (Figure 5B). 20

35 1. Introduction (c) mirnas originating from splicing reactions Non-canonical intronic small RNAs are produced from spliced introns and debranching. Because such small RNAs (called mirtrons) can derive from small introns that resemble pre-mirnas, they bypass the Drosha-processing step. Some introns have tails at either the 5 end or 3 end, and thus need to be trimmed before pre-mirna export (Figure 5C). Figure 5. mirna biogenesis pathway. The mammalian processing pathways are shown, with fly components in brackets (figure taken from Kim et al., 2009). 21

36 1. Introduction 1.5 Argonaute proteins Argonautes (together with GW182 proteins) are the most important and bestcharacterized components of the RISC (Hutvagner and Simard, 2008; Peters and Meister, 2007). There are five Argonaute proteins in D. melanogaster (Ago1-3, PIWI and Aubergine), which are described briefly in the following sections. The PIWI clade of the Argonaute family, which includes the PIWI, Aubergine (AUB) and Ago3 proteins, is involved in the pirna pathway, whose role is to silence transposons in the male and female germline (Brennecke et al., 2007). In contrast, the Drosophila Ago1 is implicated in mirna-mediated pathways, whereas Ago2 is involved in the cleaving activity of RISC (Okamura et al., 2004). Argonaute proteins are characterized by four domains: (i) the N-terminal domain; (ii) the PAZ domain, which binds the 3 end of mirnas/sirnas; (iii) the middomain, which provides a binding pocket for the 5 -phosphate of mirnas/sirnas; and (iv) the PIWI domain, which adopts an RNase H-like fold and has slicing activity in some, but not all Agos (Figure 6; for review see Jinek and Doudna, 2009). PIWI domains of D. melanogaster s Ago1 and Ago2 have a complete Asp-Asp-His motif, which coordinates the two divalent cations required for catalysis, and thus are both capable of slicing. However, Ago1 is a much less efficient enzyme than Ago2, because it releases products at a slower rate, resulting in a slower turnover (Forstemann et al., 2007). Figure 6. Domain organization of Drosophila melanogaster Ago1. N-terminal domain (fuchsia box); PAZ domain (blue box); Middomain (orange box) and PIWI domain (green box). Numbers underneath the protein schematic represent amino acid positions at fragment boundaries. Vertical lines above the protein schematic indicate the position of residues, which when mutated affect mirna binding (blue, R386, K387, Y388, T446, Y447, L448), GW182-binding (red, F777), or both mirna and GW182 binding (black) (see Eulalio et al. 2009a for additional information). Green lines below the protein schematic indicate the position of catalytic residues (figure taken from Eulalio et al., 2009d). 22

37 1. Introduction Earlier studies in D. melanogaster showed that the C-terminal PIWI domain of DmAgo1 was sufficient for the interaction with GW182 (Behm-Ansmant et al. 2006a) and a study by Till et al. (2007) provided a detailed analysis of this interaction. Surprisingly, Till et al. found that Ago2 residues that were predicted to bind the 5 end of mirnas are also required for TNRC6B (one of three GW182 paralogs in vertebrates) binding, suggesting that the Ago2 sites that interact with the 5 end of mirnas and TNRC6B partially overlap. Importantly, mirna and TNRC6B binding can occur simultaneously, and TNRC6B neither interferes nor enhances the Ago2 mirna interaction. In agreement with this, the interaction between DmAgo1 and mirnas remains unaffected in cells depleted of GW182 (Eulalio et al. 2009a). Also a study of Drosophila Ago1 showed that the binding sites for mirna 5 ends and GW182 proteins partially overlap, but can be uncoupled from one another by specific mutations (Figure 6; Eulalio et al. 2009a). Importantly, DmAgo1 mutants that lose the ability to interact either with both mirnas and DmGW182, or only with mirnas/dmgw182, do not rescue silencing as expected indicating that DmAgo1 does indeed require the interaction with DmGW182 to mediate repression. Importantly, not all Argonaute proteins interact with GW182 proteins. For example, DmGW182 interacts with DmAgo1, but not DmAgo2 (Behm-Ansmant et al. 2006a; Iwasaki et al. 2009; Miyoshi et al. 2009). Also, the PIWI-like proteins do not interact with GW182 (Miyoshi et al. 2009). Thus, it appears that the interaction with GW182 proteins is restricted to the Argonaute proteins involved in the mirna pathway, although other Argonaute proteins may interact with GW-repeats present in unrelated proteins, as is the case with A. thaliana Ago4 and S. pombe Ago GW182 proteins As mentioned before, silencing by mirnas is mediated by a protein complex consisting minimally of an Argonaute and a GW182 protein. Although depleting DmGW182 relieves silencing, it does not affect expression levels of mirnas or DmAgo1 (Eulalio et al., 2009b; Eulalio et al., 2008b). Furthermore, when GW182 is directly tethered to an mrna reporter, its expression is silenced independently of 23

38 1. Introduction Argonaute proteins, suggesting that GW182 plays a role in silencing at the effector step, downstream of Ago1 (Behm-Ansmant et al., 2006). The GW182 protein (also known as Gawky in Drosophila) was named after its molecular weight and the presence of glycine and tryptophan repeats (termed GWrepeats thereafter) (Eystathioy et al., 2002). Three GW182 paralogs exist in vertebrates (TNRC6A/GW182, TNRC6B, and TNRC6C), a single ortholog in insects (GW182), and no orthologs in fungi (Behm-Ansmant et al., 2006). The vertebrate and insect GW182 proteins share a common domain architecture (Figure 7), and the particular domains/motifs of these proteins will be summarized here one by one. In general, GW182 proteins are characterized by two annotated structural domains: (i) a central ubiquitin associated (UBA)-like domain and (ii) a C- terminal RNA recognition motif (RRM). These domains are embedded in regions predicted to be unstructured (Ding and Han, 2007; Behm-Ansmant et al., 2006), including: (iii) two or three distinctive blocks of glycine-tryptophan repeats (termed: the N-terminal, middle-, and C-terminal GW-repeat regions), and (iv) a glutamine-rich (Q-rich) region located between the UBA-like domain and the RRM (Figure 7; Eulalio et al., (2009a)). Figure 7. Domain organization of GW182 proteins. (Hs) Homo sapiens; (Dm) Drosophila melanogaster. (N-GW, M-GW, C-GW) N-terminal, middle, and C- terminal GW-repeat containing regions, respectively (the number of GW-repeats for each region is indicated in brackets). The white sectors within the N-terminal regions do not contain GW-repeats. UBA (gray box): ubiquitin associated-like domain; Q-rich (blue box): region rich in glutamine; RRM (red box): RNA recognition motif. Fuchsia boxes I and II: two conserved motifs within the N-terminal GW repeats. Violet box: Ago-hook motif. Orange box: conserved motif III (DUF). Numbers underneath the protein schematic represent amino acid positions at fragment boundaries for each protein (figure adapted from Eulalio et al., 2009d). 24

39 1. Introduction It was first demonstrated in D. melanogaster that the GW182 N-terminal GW-repeat region plays a role in mediating the interaction with Argonautes. The N-terminal region comprising residues was necessary and sufficient for DmGW182 to interact with DmAgo1 in coimmunoprecipitation assays (Behm-Ansmant et al., 2006). In a subsequent study, the N-terminal GW-repeats in human TNRC6B were shown to be crucial for its interaction with HsAgo2 (Till et al., 2007). A 22-amino acid long GW-repeat containing sequence lying downstream from motif II in the N- terminus of human TNRC6B (isoform 2) was identified by Till et al. as a minimal GW182-Ago2 interaction motif in vitro. The term coined for this minimal Ago interaction motif of GW182 is Ago-hook. Interestingly, Takimoto et al. (2009) demonstrated that, whereas Argonaute proteins have a single binding site for GW182 proteins, the latter can interact with multiple Agos simultaneously, which could suggest that GW182 proteins bridge the interaction between multiple silenced mrnps, which also explains the synergistic effects of mirna-binding sites in close proximity to each other (Grimson et al., 2007). The Q-rich region of the GW182 protein, together with the Ago-binding domain, is required for P-body accumulation but dispensable for silencing, as determined by complementation and tethering assays (Eulalio et al., 2009b; Lazzaretti et al., 2009; Zipprich et al., 2009). P-bodies are cytoplasmic foci containing mrnadegrading enzymes and implicated in the catabolism and/or storage of nontranslated mrnas (Ding et al., 2005; Liu et al., 2005b; Liu et al., 2005a; Pillai et al., 2005). Though P-body integrity (as judged by light microscopy) is not essential for mirna function (Eulalio et al., 2007a), many of the P-body components were shown to play an important role in mirna-mediated repression and mrna degradation (Eulalio et al., 2007b; Behm-Ansmant et al., 2006; Rehwinkel et al., 2006; Bagga et al., 2005; Liu et al., 2005b). Since the Q-rich region is responsible for P-body accumulation, a GW182 protein lacking this region disperses throughout the cytoplasm (Eulalio et al., 2009b). The role of the UBA-like domain of GW182 is not understood and the present studies failed to provide evidence for a contribution of this domain to repression 25

40 1. Introduction (Chekulaeva et al., 2009; Eulalio et al., 2009b; Lazzaretti et al., 2009; Zipprich et al., 2009). However, it is possible that this domain plays a role in the silencing of specific targets and/or during specific conditions such as stress. Another of GW182 s domains- RRM is highly conserved among this family of proteins, and its presence was interpreted as indicative of RNA-binding activity (Eystathioy et al., 2002). It is not known whether GW182 proteins bind RNA directly, but if they do so, it is probably not through the RRM, since the structure of the RRM domain of DmGW182 revealed that it lacks RNA-binding features (Eulalio et al., 2009d). Namely, GW182 adopts an RRM fold, with an additional C- terminal alpha-helix, which lies on the surface that is generally used by these domains to bind RNA. This, together with the absence of aromatic residues in the conserved motifs within RRM, and the lack of general affinity for RNA, suggests that the GW182 RRM does not bind RNA (Eulalio et al., 2009d). Despite conservation, the RRM domain is not required for GW182 proteins to localize to P-bodies or to interact with either Argonaute proteins or with mirnas (Chekulaeva et al., 2009; Eulalio et al., 2009b; Eulalio et al., 2009d; Lazzaretti et al., 2009; Zipprich et al., 2009). Furthermore, in complementation assays, a DmGW182 protein lacking the RRM was impaired in silencing, but only for a subset of mirna-target pairs (Eulalio et al. 2009b). Much is known about the role of GW182 s domains/regions. However, what defines the universal silencing domain of GW182 is still debated. Nevertheless, all reports recognize the importance of the GW182 C-terminus for repression. Since the RRM domain is not absolutely required for the silencing activity (Eulalio et al., 2009b; Zipprich et al., 2009), the middle and C-terminal regions of GW182 proteins seem to define a bi-partite, autonomous silencing domain. The features of this silencing domain are worth considering. The middle and C-terminal GW-repeatcontaining regions of GW182 proteins are not highly conserved, with the exception of a motif of about 40 residues (conserved motif III) within the middle region. This motif was termed DUF (domain of unknown function) (Zipprich et al. 2009), although secondary structure predictions suggest that this sequence is unstructured. The only common feature of GW182 regions that contribute to 26

41 1. Introduction silencing is the high content of serine residues, suggesting that the activity of GW182 proteins may be regulated by phosphorylation. Human TNRC6A is indeed phosphorylated (Eystathioy et al. 2002), but it remains to be tested whether phosphorylation plays a role in silencing. Moreover, it has been recently shown that, apart from Ago proteins, GW182 additionally interacts with the poly(a)-binding protein (PABP) and that this interaction is required for mirna-mediated deadenylation (Fabian et al., 2009). It was reported that the mammalian GW182 C-terminus directly binds PABP in an RNA-independent manner. It is possible that PABP binding to GW182 competes with eif4g binding, as adding an eif4g fragment that binds to the N-terminus of PABP blocks mirna-mediated deadenylation in vitro. However, the exact role of PABP- GW182 interaction in mirna-mediated repression awaits further dissection. 1.7 micrornas mode of action Binding of mirnas (and associated proteins) can trigger a wide range of effects on the targeted mrna. No consensus has emerged about the mechanism of (1.7.1) translation repression, but considerable agreement exists about (1.7.2) mirnas bringing about deadenylation and degradation of mrnas. On the other hand, mirnas have also been shown to (1.7.3) activate the expression of certain transcripts. Additionally, it is worth noting that under certain conditions, or in specific cells, mirna-mediated repression can be (1.7.4) reversed or prevented, which makes this regulation dynamic and diverse (Carthew and Sontheimer, 2009; Chekulaeva and Filipowicz, 2009; Eulalio et al., 2008a). Examples of these diverse mirna-mediated modes of action are described in the following paragraphs. 27

42 1. Introduction Translational repression Despite intensive research on this topic, the long-standing question of which step of translation is targeted by mirnas remains unresolved. Mechanistic studies of mirnas performed in different laboratories have produced discrepant results, with some investigators proposing the regulation of translation initiation and others favoring post-initiation events in translation as the targeted step of repression (Figure 8), (Carthew and Sontheimer, 2009; Chekulaeva and Filipowicz, 2009; Eulalio et al., 2008a). The issue of initiation versus post-initiation responsiveness to mirisc has been experimentally addressed in two ways. One criterion has been whether after density gradient centrifugation the repressed mrnas are located in the free mrnp pool (evidence for repressed initiation) or in large polysomes (evidence for repressed elongation or termination). A second criterion has been whether mrnas that contain an IRES or a non-functional A-cap are subject to repression. The controversy over the exact mechanism of mirna-mediated repression is demonstrated by multiple models of mirna action present in the literature. Below, current models of mir-mediated translational repression are described, including: (a) inhibition of translation elongation and (b) co-translational protein degradation (both are post-initiation models of repression), as well as (c) competition for the cap structure and (d) inhibition of ribosomal subunit joining (both are initiation models of repression), (Figure 8). 28

43 1. Introduction Figure 8. Possible mechanisms of mirna-mediated repression. (A-B) Post-initiation mechanisms. (A) mirnas repress translation of target mrnas by blocking translation elongation or by promoting premature dissociation of ribosomes (ribosome drop-off). (B) Co-translational protein degradation. This model proposes that translation is not inhibited, but rather the nascent polypeptide chain is degraded co-translationally. The putative protease is unknown. (C D) Initiation mechanisms. mirnas interfere with a very early step of translation, prior to elongation. (C) Argonaute proteins compete with eif4e for binding to the cap structure. (D) Argonaute proteins recruit eif6, which prevents the large ribosomal subunit from joining the small subunit. RISC is shown as a minimal complex including an Argonaute protein (magenta) and GW182 (red). The mrna is represented in a closed loop configuration achieved through interactions between the cytoplasmic poly(a) binding protein (PABP; bound to the 3 poly(a) tail) and eif4g (bound to the cytoplasmic cap-binding protein eif4e) Repression at a post-initiation step of translation Early studies in the worm C. elegans and recent studies in mammalian cell cultures presented evidence that mirnas repress protein synthesis after translation is initiated (Seggerson et al., 2002; Maroney et al., 2006; Nottrott et al., 2006; Petersen et al., 2006). Although these studies differed in technical details, their 29

44 1. Introduction conclusions stem from a common observation: in sucrose sedimentation gradients, mirnas and their targets are associated with polysomes. These polysomes were shown to be actively translating mrna targets because they were sensitive to a variety of conditions that inhibit translation. For example, they dissociate into monosomes or ribosomal subunits following brief incubation with translation inhibitors, such as hippuristanol, puromycin, or pactamycin (Maroney et al., 2006; Nottrott et al., 2006; Petersen et al., 2006). Inhibition of elongation or premature termination of translation Petersen et al. (2006) suggested a possible means by which mirisc represses elongation. A repressed mrna is associated with polysomes, and when translation initiation is blocked with hippuristanol (inhibitor of eif4a helicase), the ribosomes rapidly dissociate in a mirna-dependent manner. Their results suggest that mirisc promotes ribosome drop-off, premature ribosome dissociation from mrnas (Figure 8A). One concern about this model is that the repression was not accompanied by a shift of target mrna toward smaller polysomes, an expected result if indeed fewer ribosomes were associated with the mrna. Cotranslational protein degradation The paradoxical observation that the targets of mirnas appear to be actively translated while the protein product remains undetectable prompted another model of mirna-mediated repression. Nottrott et al. (2006) proposed that mirnas recruit proteases to translating polysomes and hence promote degradation of nascent polypeptides (Figure 8B), a possibility supported by negative, rather than direct positive results. Namely, the authors of this paper failed to immunoprecipitate the repressed mrna with antibodies against the growing polypeptide, the identity of the putative protease remains unknown and proteasome inhibitors did not restore protein expression from silenced reporters. Moreover, repression by mirnas is not prevented when reporter proteins are cotranslationally targeted into the endoplasmic reticulum (ER), which argues against the idea that nascent proteins are degraded in the cytosol (Pillai et al., 2005). 30

45 1. Introduction In sum, although the persistent association of repressed mrnas with polysomes (Maroney et al., 2006; Nottrott et al., 2006; Petersen et al., 2006; Seggerson et al., 2002; Olsen and Ambros, 1999) could be a strong argument in support of mirisc targeting post-initiation effects, all reports that propose such mechanism(s) are compromised by inconsistencies in the presented data Repression of translation initiation Data collected in the majority of laboratories favor inhibition of translation at initiation rather than post-initiation steps. In support of this step of mirnamediated regulation, the repressed mrnas were found to shift towards the top of the sedimentation gradient, indicating reduced ribosome loading on mrna (Bhattacharyya et al., 2006; Humphreys et al., 2005; Pillai et al., 2005). Observations that mrnas containing an IRES or a nonfunctional A-cap are not effectively repressed by mirnas also indicate that mirnas block an early step in translation initiation, possibly involving recognition of the m 7 GpppN cap (Thermann and Hentze, 2007; Humphreys et al., 2005; Pillai et al., 2005). Competition for cap binding There are two models in the literature favoring competition between the mirisc and eif4e protein for cap binding as a cause of translational repression (Figure 8C). Mathonnet et al., (2007) reasoned that if mirisc competes with eif4e for cap binding, then providing excess eif4f complex (containing eif4e) would alleviate repression. This indeed was observed when purified eif4f was added to an ascite cell-free system. However, the exact mechanism of repression was not dissected in this study. A possible means by which mirisc competes with eif4e for cap binding has been proposed by Kiriakidou et al. (2007). The investigators reported that the central domain of Argonaute proteins exhibits sequence similarities to eif4e, which binds to the m 7 G-cap structure of mrnas by stacking the methylated base of the cap between two tryptophans. At the equivalent position of the tryptophans in eif4e, Argonaute proteins have phenylalanines that could mediate a similar interaction. Consistent with this, Kiriakidou et al. (2007) showed that human Argonaute 2 31

46 1. Introduction (Ago2) binds to m 7 GTP on sepharose beads, and that a methylated cap analog m 7 GpppG, but not the unmethylated GpppG cap, compete for this binding. Next, the authors showed that substituting one or both Ago2 phenylalanines with valine residues abrogated the silencing activity. These results suggested that mirnas inhibit translation at the cap-recognition step by displacing eif4e from the cap structure. However, this model has been challenged by other studies in Drosophila. The Drosophila Ago1 Mid domain also contains the phenylalanines whose mutagenesis abolishes the ability of Ago1 to repress translation (Eulalio et al., 2008). However, this mutagenesis does not affect DmAgo1 binding to m 7 GTPcoupled beads in vitro, but instead the mutant Ago1 is impaired from binding to GW182. In addition, GW182 bound to mrnas is sufficient to repress their translation without Ago1, arguing against an obligatory Ago1-cap binding mechanism. Moreover, according to a recent bioinformatics study (Kinch and Grishin, 2009) two aromatic residues hypothesized to form base-stacking interactions with the m 7 GpppN cap (Kiriakidou et al., 2007) are located too far apart, and one of them contributes to the hydrophobic core of the domain, which is inconsistent with their involvement in cap binding. Inhibition of ribosomal subunit joining Another recent study proposed that the mirna-directed repression mechanism involves eif6 (Figure 8D), a protein preventing association of the ribosomal subunits (Chendrimada et al., 2007). In immunoprecipitation experiments, the authors found that the mirna repression complex associates with eif6 and proteins of the large ribosomal subunit, and that depletion of eif6 leads to the alleviation of let7- mediated silencing in human cells and lin4-mediated repression of lin14 and lin28 mrnas in C. elegans. In contrast to these observations, Eulalio et al. (2008b) knocked down eif6 without a significant effect on mirna-mediated repression in Drosophila S2 cells. Moreover, Gandin et al. (2008) did not detect differences in the expression of mirna targets in knockout mice with one eif6 allele deleted. In addition to its role in translation initiation (Gandin et al., 2008), eif6 is also involved in ribosome biogenesis in yeast and most likely in mammals (Basu et al., 2001; Sanvito et al., 1999). This fact further complicates the interpretation of eif6 32

47 1. Introduction depletion experiments, because of the secondary effects on translation caused by an eif6 knock-down. Interestingly, Wang et al. (2008) presented data indicating that mirnas in a reticulocyte lysate also inhibit translational initiation by preventing 60S subunit joining. The mrnas targeted for repression were enriched for 40S but not 60S ribosomal subunits after being added to mirna-programmed lysate. A toeprint of these mrnas shows relative protection over the initiating codon, consistent with 40S ribosomal subunits paused at the start codon. However, the mechanism of repression was not investigated in this study Data from cell-free systems recapitulating mirna repression Recent characterization of cell-free extracts that recapitulate mirna-mediated repression in vitro, as well as biochemical studies carried out in those systems have provided more details of possible scenarios for translational inhibition, while all of them point to translation initiation being the targeted step of mir-regulation. In four different cell-free extracts, originating from rabbit reticulocytes, Drosophila embryos, mouse Krebs-2 ascites, and human HEK293 cells, the mrnas containing an IRES or nonfunctional ApppN cap were not inhibited, indicating that the presence of the m 7 GpppN cap was required for the repression (Mathonnet et al., 2007; Thermann and Hentze, 2007; Wakiyama et al., 2007; Wang et al., 2006). Description of cell-free extracts certainly represents important progress in the studies of mirna function and makes early steps of the repression amenable to biochemical analysis. However, it should be noted that a few of the currently available in vitro systems depend either on overexpression of mirnp components (Wakiyama et al., 2007), or on preannealing of the synthetic mirna to the target mrna (Wang et al., 2006), making it difficult to know how far some of these systems recapitulate the physiological mirna response. For the reticulocyte system, it would be important to demonstrate the dependence of the repression on Argonautes, since it is not known how effectively preformed mirna mrna duplexes associate with these proteins. 33

48 1. Introduction mrna degradation Although early studies of animal mirnas indicated that translational repression is not accompanied by mrna destabilization, it is now well established that mirnas can also induce deadenylation and accelerate turnover of their targets. This effect was demonstrated in animal studies (Giraldez et al., 2006; Mishima et al., 2006; Bagga et al., 2005), in cells grown in culture (Eulalio et al., 2009c; Eulalio et al., 2007b; Behm-Ansmant et al., 2006; Rehwinkel et al., 2006; Wu et al., 2006; Lim et al., 2005) and in cell extracts (Wakiyama et al., 2007). Different degrees of destabilization appear to apply to the majority of mrna targets, as demonstrated by microarray analyses of transcript levels in cells and organs in which the mirna pathway was inhibited, or in which mirna levels were experimentally increased or decreased (Baek et al., 2008; Selbach et al., 2008; Karginov et al., 2007; Giraldez et al., 2006; Rehwinkel et al., 2006; Lim et al., 2005). These genomic-scale studies demonstrated that a single mirna species can downregulate hundreds of targets, though mostly only to a mild degree, providing fine-tuning of gene expression. The mechanism of mirna-mediated destabilization is best characterized in Drosophila, where it is known to involve Ago1, GW182, CCR4-CAF1-NOT deadenylase complex, the decapping enzyme DCP2, and several decapping activators including DCP1, Ge-1, EDC3 and Me31B/RCK (Eulalio et al., 2007b; Behm-Ansmant et al., 2006). In eukaryotic cells, the general mrna degradation pathway is initiated by pol(a) tail shortening. Next, the deadenylated mrna can undergo an irreversible decapping by the DCP2-DCP1 decapping complex, which exposes it to 5 to 3 exonucleolytic degradation, presumably by Xrn1. Alternatively, the unprotected 3 end of an mrna lacking the poly(a) tail can be cleaved by the exosome, a large complex of 3 to 5 exonucleases (Eulalio et al., 2008a; Garneau et al., 2007). Much effort was invested in resolving the question of whether degradation (and the mrna deadenylation preceding it) is a cause or a consequence of mirna-mediated translational repression. Today however, considerable evidence suggests that mrna translation and degradation are independent processes. It has been shown in Drosophila cells and human cell extracts that impairing (by introducing a nonphysiological A-cap structure instead of the m 7 G-cap) or even completely inhibiting 34

49 1. Introduction translation (by cycloheximide) does not prevent the mrna from deadenylation (Eulalio et al., 2007b; Wakiyama et al., 2007). Importantly, although deadenylation of target mrnas disrupts the cap/poly(a) interaction (the closed loop) and reduces the efficiency of translation, it is not the sole mechanism of translation control by mirnas. The observation that mrnas lacking a polya) tail, or containing a 3 histone stem-loop in place of the poly(a) tail also undergo mirna-mediated translational silencing suggests that a poly(a) per se is not absolutely required for repression (Wu et al., 2006; Humphreys et al., 2005; Pillai et al., 2005) microrna-mediated translational activation The phenomenon of posttranscriptional gene regulation by mirnas has to be considered in the context of the whole cell and the multitude of activities that affect it. One of these is the cell cycle, during which mirnas have been shown to not only repress but also activate translation of specific transcripts. The mirna let7 and an artificial mirna (CXCR4) repress translation in proliferating human cells, but change into translational activators when the cell cycle is arrested at the G1 checkpoint by serum starvation (Vasudevan et al., 2007). The mode of regulation (repression versus activation) is dependent on the stage of the cell cycle. Aphidicolin-induced arrest at G1 generates translational activation, whereas nocodazole-induced arrest at G2/M generates translational repression. This mode of regulation is not universal, since G1-arrested cells in the Drosophila eye use mirna-mediated repression (Li and Carthew, 2005). Nevertheless, it appears to have a physiological role in regulating expression of the cytokine TNFα. Lymphocyte growth arrest induces TNFα expression that is required for macrophage maturation; mir369-3p switches from a repressor to an activator of TNFα translation when cells in culture are growth arrested (Vasudevan et al., 2007). Another example of mirna-mediated activation highlights the possible importance of binding site position. Interaction of mir10a with the 5 UTR of certain ribosomal subunit mrnas leads to their activated translation, whereas interaction with the 3 UTR leads to repression (Orom et al., 2008). 35

50 1. Introduction Modulation of microrna function Several recent reports, reviewed by Chekulaeva and Filipowicz (2009), demonstrate that mirna repression can be reversed or modulated by RNA-binding proteins, including HuR, BDN and TRIM NHL, which all interact with the 3 UTRs of target mrna (Huang et al., 2007; Bhattacharyya et al., 2006; Mishima et al., 2006). As shown by Bhattacharyya et al., mir122-mediated repression of CAT-1 mrna is alleviated in human Huh7 hepatoma cells subjected to stress. The effect is mediated by the HuR protein, which translocates from the nucleus to the cytoplasm upon stress and binds to AU-rich sequences in the CAT-1 3 UTR. This is accompanied by the exit of CAT-1 mrna from P-bodies and its recruitment to polysomes. Reversible mirna regulation is also implicated in synaptic development and longlasting memory (Ashraf et al., 2006; Schratt et al., 2006). mir134-mediated translational inhibition of the Limk1 protein kinase is affected by exposure of neurons to extracellular stimuli such as brain-derived neurotrophic factor, which relieves inhibition of Limk1 translation and in this way may contribute to synaptic development, maturation and/or plasticity (Schratt et al., 2006). In Drosophila, Ashraf et al. demonstrated that the degradative control of the RISC pathway through the proteolysis of Armitage, a protein essential for small RNA silencing, underlies the pattern of synaptic protein synthesis associated with stable memory. In contrast to factors alleviating mirna function, the TRIM NHL family of proteins, TRIM32 in mammalian cells and NHL-2 in C. elegans, were recently reported to enhance the activity of selected mirnas, among them let7 mirna, by binding to core mirnp components (Hammell et al., 2009; Schwamborn et al., 2009). The function of NHL-2 is to promote repression of several targets of let7 family mirnas during larval development, including the lsy6 mirna target COG-1 in neural cell fate specification (Hammell et al., 2009). For TRIM32, the enhancement appears essential for let7a-mediated differentiation of neural progenitor cells into neurons in mouse neocortex (Schwamborn et al., 2009). In conclusion, the crosstalk of mirnps with RNA-binding proteins and other factors emerges as a major theme in the modulation of mirna function in a cell-specific manner, of which certainly many more examples will be identified in the future, 36

51 1. Introduction taking into consideration the number of RNA-binding proteins expressed in cells and their widespread ability to interact with 3 UTRs. 37

52 1. Introduction 1.8 Aim of the thesis: exploration of the role of the cap structure to investigate the mechanism of microrna-mediated repression Binding of the eif4f complex to the cap promotes recruitment of the small ribosomal subunit to mrnas (Pestova et al., 2001) and was implicated as a primary target of mirna regulation by early reports investigating mirna-mediated control (Humphreys et al., 2005; Pillai et al., 2005); subsequent work in cultured cells and in vitro systems further supported this notion (Kiriakidou et al., 2007; Mathonnet et al., 2007; Thermann and Hentze, 2007; Wakiyama et al., 2007). However, the strength of the conclusions from all of these studies has been questioned on the grounds that they rely on experimental approaches altering the mode (IRES-driven mrna reporters) and/or rate of non-regulated translation (Acapped mrna reporters). Kinetic modeling studies frame this concern in quantitative terms and actually favored a late step in translation initiation as the likely target for mirnas (Nissan and Parker, 2008). To overcome inherent limitations of tools previously used to investigate mirna mechanisms, the goal of this PhD project was to perform a screen of chemically modified cap structure analogs with the objective of identifying variants that would be neutral for general (non-regulated) cap-dependent translation, and potentially have interesting properties in mirna-mediated translational repression. Availability of such cap structure analogs could (1) circumvent the major caveats limiting other experimental approaches used to date and (2) allow for new insights into the mechanism(s) of mirna-mediated regulation. 38

53 2. Materials and Methods 39

54 2. Materials and Methods 40

55 2. Materials and Methods 2.1 Materials Chemicals and reagents All chemicals used in this study were purchased from Gibco BRL, Merck or Sigma- Aldrich with the following exceptions: Chemical 100bp DNA ladder 1kb DNA ladder α[32p]ctp, α[32p]utp >220 TBq/mmol, >6000 Ci/mmol Agar-agar Agarose Amino acid mixture, complete Ampicillin ApppG, m 7 GpppG, 3 -O-Me-m 7 GpppG cap analogs ATP, CTP, GTP, UTP Calf intestinal alkaline phosphatase (CIP) Complete TM EDTA-free Protease Inhibitor Cocktail Creatine phosphate Creatine phosphokinase Deoxynucleotides (dntps) DNA oligonucleotides Ethidium bromide Fetal bovine serum (FBS) Hippuristanol L-glutamine LNA-oligos Milk powder Ni-NTA agarose Penicillin/streptomycin Company New England Biolabs New England Biolabs Hartmann Analytic Serva Invitrogen Promega Ratiopharm New England Biolabs Roche New England Biolabs Roche Roche Roche Roche MWG Biotech MP Biomedicals Invitrogen gift from J. Pelletier Gibco Exiqon Frema Reform QIAgen Gibco 41

56 2. Materials and Methods Pfu polymerase Stratagene Phenol/chloroform/isoamylalcohol, 25:24:1 AppliChem PreScission protease GE Healthcare Random hexamer primers Invitrogen Restriction enzymes New England Biolabs RNase-free Turbo DNase Ambion RNaseH New England Biolabs RNAsin RNase inhibitor Promega Schneider s Medium Gibco Sucrose USB Corporation SuperScript II reverse transcriptase Invitrogen SYBR Green PCR master mix Applied Biosystems T3- and T7-RNA polymerase Stratagene T4-DNA ligase New England Biolabs Taq polymerase Invitrogen TRIzol Invitrogen Buffers, solutions and media used All solutions were prepared with double deionized water (ddh 2 O). Buffer 6x DNA loading buffer Composition 0.25% (w/v) Bromphenol blue 0.25% (w/v) Xylene cyanol FF 40% (w/v) Sucrose 10x TAE 400 mm Tris, ph mm EDTA acetic acid for ph titration 42

57 Buffer D 20 mm HEPES-KOH, ph % glycerol 1 mm DTT 0.1 M KCl 2. Materials and Methods EW buffer 0.7% (w/v) NaCl 0.04% (v/v) Triton X-100 His-tag lysis buffer 50 mm NaH 2 PO4, 500 mm NaCl 10 mm Imidazole complete EDTA-free protease inhibitor complex (Roche) LB-agar (autoclaved) 1.5% (w/v) Bacto agar in LB medium LB-medium (autoclaved) 1% (w/v) Bacto tryptone 0.5% (w/v) Bacto yeast extract 170 mm NaCl adjusted to ph 7.6 with NaOH Lysis buffer 100 mm potassium acetate 30 mm HEPES-KOH, ph mm magnesium acetate 5 mm DTT PBS (phosphate buffered saline) 130 mm NaCl 100 mm Na 2 HPO 4, ph 7.0 Sucrose gradient buffer 24 mm HEPES, ph mm potassium acetate 2 mm magnesium acetate 1 mm DTT 43

58 2. Materials and Methods Laboratory materials The following section lists laboratory materials used in this PhD project as well as their suppliers. Material Company 0.2 ml reaction tubes (Thermo Tube TM ) PEQlab 1.5 ml reaction tubes Eppendorf 24-well plates Nunc Bottle top filters, 0.22 μm pore size Millipore CHROMA SPIN TM 100 columns BD Biosciences Dual-Luciferase Assay System Promega Homogenizer 100 ml Kontes Glass, Co General glass ware Schott General plastic ware Nunc Gloves (Latex or Nitrile) Kimberley-Clark Megascipt t3 kit Ambion Neubauer chamber LO-Laboroptik Parafilm Pechiney Plastic Packaging Plastic cuvettes Nunc Polyprep columns Biorad QIAfilter Plasmid Maxi Kit QIAgen QIAprep Spin Miniprep Kit QIAgen QIAquick Gel Extraction Kit QIAgen QIAquick PCR Purification Kit QIAgen RNeasy Mini kit QIAgen Syringes Becton Dickinson TransMessenger Transfection Reagent QIAgen Ultracentrifuge tubes Beckman 44

59 2. Materials and Methods Instruments The following section lists laboratory instruments used in this PhD project as well as their suppliers. Instrument ABI PRISM 7500 instrument EmulsiFlex-C5 homogenizer Gradient Master Luminometer RC-5B/C Centrifuge and appropriate rotors RoboCycler Scintillation counter Spectrophotometer (Ultrospec 2100 pro) Ultracentrifuge L8-M Company Applied Biosystems Avestin BioComp Instruments Berthold Sorvall Stratagene PerkinElmer Amersham Biosciences Beckman Constructs The cloning of constructs used in this study was previously described by Thermann and Hentze (2007). Plasmid Insert Resistance pbluescript II SK Firefly-Luciferase-WT (FL-WT), Ampicillin Firefly-Luciferase-mut (FL-mut), S-ORF-WT, S-ORF-mut prl-null Renilla-Luciferase (RL) Ampicillin In brief, the plasmids FL-WT and FL-mut were obtained by insertion of a HindIII restriction site into the 3 UTR of the plasmid no IRES (Thoma et al., 2004) at position 3900 by oligonucleotide-directed mutagenesis using primers t3a-mut-sense and t3a-mut-asense, generating plasmid t3a-hindiii. The mir2 binding site of Drosophila melanogaster reaper mrna including 25-nt-long flanking sequence on either site (Figure 11) was obtained by PCR-amplification from a plasmid containing 45

60 2. Materials and Methods the reaper 3 UTR (Stark et al., 2003), using primers Reap-WT-sense and Reap-WTasense. This PCR-fragment was digested with SpeI-HindIII and subsequently cloned into the SpeI-HindIII sites of t3a-hindiii, generating FL-WT-1x. Repeated insertion of BamHI-HindIII digested PCR-fragments into BglII-HindIII digested FL-WT-1x generated the plasmid FL-WT after five rounds of cloning, with six mir2-binding sites in its 3 UTR. Plasmid FL-mut was generated by overlap-extension PCR using primers Reap-mut-sense and Reap-mut-asense resulting in a PCR fragment that contains a XhoI recognition sequence plus 25-nt-long reaper 3 UTR flanking sequence. This fragment was subcloned and multimerized into the SpeI-HindIII sites of t3a-hindiii as described for FL-WT. To generate plasmids short-orf (S-ORF)-WT and -mut, the firefly luciferase open reading frame (ORF) was replaced by a S-ORF of 180 nucleotides (Gebauer et al., 2003). The short reporter ORF encodes a polypeptide of 59 amino acids including a Flag-tag and five methionine codons for potential 35 S labeling. The cloning of these constructs was achieved by PCR amplification of the short ORF from the plasmid BmS(EF)m (Beckmann et al., 2005) using primers S-ORF-sense and S-ORF-asense. The Renilla luciferase control plasmid was cloned by digestion of prl-null (Promega) with XbaI-BamHI, and subsequent insertion of 880-bp-long XbaI-BamHIfragment containing a 98-nt-long poly(a) tail from pire.cat-a98 (Preiss et al., 1998). All plasmids were verified by DNA sequencing. Both expression plasmids used in this study were obtained from other laboratories: Plasmid Source Laboratory Reference GST-dPAIP2 Nahum Sonenberg (Svitkin and Sonenberg, 2004) McGill University, Canada His-d4E-BP Aurelio Teleman unpublished DKFZ, Germany 46

61 2. Materials and Methods PCR primers All primers used in this study were also described in Thermann and Hentze (2007) and Sanchez et al., (2009). t3a-mut-sense 5 CCACTAGTTCTAGAGCGGAAGCTTCCGCCACCGCGGTGG 3 t3a-mut-asense 5 CCACCGCGGTGGCGGAAGCTTCCGCTCTAGAACTAGTGG 3 Reap-WT-sense 5 TTTTACTAGTGCGGCCGCGGATCCACAACACCCACCCAATTTTAGTTTAC 3 Reap-WT-asense 5 TTTTAAGCTTGTCGACAGATCTCGCTTTTTTGTAGAAACAAAACCATTATC 3 Reap-mut-sense 5 TTTTACTAGTGCGGCCGCGGATCCACAACACCCACCCAATTTTAGTTTACTCGAGATGG TTTTGTTTC 3 Reap-mut-asense 5 TTTTAAGCTTGTCGACAGATCTCGCTTTTTTGTAGAAACAAAACCACTCGAGTAAACT AAAATTGGG 3 S-ORF-sense 5 TTTTGGTACCGACCATGGACTACAAAGACGATGACGAC 3 S-ORF-asense 5 TTTTACTAGTGGATTTACAATTTGGACTTTCCGCCCTTCTTGGCC 3 Firefly-sense 5 CCTCTGGATCTACTGGGTTACCTAAG 3 47

62 2. Materials and Methods Firefly-asense 5 GAATTTGCAGCATATCTTGAACCAT 3 Renilla-sense 5 GAATTTGCAGCATATCTTGAACCAT 3 Renilla-asense 5 GGATTTCACGAGGCCATGATAA Bacterial strains The E. coli strain XL1-Blue was used for the propagation of plasmid DNA, whereas the Rosetta (DE3) strain was used for the production of recombinant proteins. Name XL1-Blue Rosetta (DE3) Genotype reca1 enda1 gyra96 thi-1 hsdr17 supe44 rela1 lac [F proab laciqzδm15 Tn10 (Tetr)]; (Stratagene) F- ompt hsdsb (rb-mb-) gal dcm (DE3) prare2 (CamR); (Novagene) 2.2 Methods Molecular biology methods Polymerase Chain Reaction (PCR) The polymerase chain reaction (PCR) allows exponential amplification of single, distinct DNA sequences whose flanking sites are known (Erlich, 1989; Mullis and Faloona, 1987; Saiki et al., 1985). The following table lists a standard reaction (left column) and program (right column) setup. 48

63 2. Materials and Methods PCR setup PCR program (in steps) 1 μl template DNA (100 ng) C, 3 min 1 μl forward primer (10 pmol/μl) C, 1 min 1 μl reverse primer (10 pmol/μl) C, 1 min 1 μl dntp mix (10 Mm/dNTP) C, 5 min 5 μl Pfu-polymerase buffer (10x) 5. 25x step μl Pfu-polymerase (5 U/µl) C, 10 min H 2 O up to 50 µl total volume 7. 4 C hold After a short pre-run (step 1), the PCR reaction was heated (step 2) to allow the separation of the two strands of a DNA template (called DNA melting or denaturation). The connecting hydrogen bonds were broken by thermal force, allowing the primers to anneal to the complementary region of the DNA template (step 3). A temperature shift up to the optimum of the DNA-polymerase used (68 C) allowed the synthesis of the complementary sequence by the polymerization of dntps, which led to the elongation of primers (step 4: primer extension ). The Pfu polymerase (Stratagene) is a 3-5 proof-reading and thermostable enzyme, which allows the repeated performance of step 2-4 without its denaturation and with introducing fewer errors, compared to Taq polymerase. The PCR products obtained in this reaction were analyzed on an agarose gel and purified with the QIAquick PCR Purification Kit or Gel Extraction Kit (QIAgen) Agarose gel electrophoresis Agarose flat-bed gels in various concentrations (0.6 2 % agarose in 1x TAE buffer) and sizes were run to separate DNA fragments in an electrical field (10 20 V/cm) for analytical or preparative use. The desired amount of agarose was boiled in 1x TAE buffer until it was completely dissolved. After it cooled down to approximately 60 C, ethidium bromide (EtBr) solution (0.5 μg/ml final concentration) was added to the liquid agar, which was then poured in a flat-bed tray with combs. As soon as 49

64 2. Materials and Methods the agarose solidified, the DNA in the loading buffer was loaded into the wells and separated electrophoretically. Ethidium bromide intercalates with the DNA s GC base pairs resulting in DNA-EtBrcomplex that emits visible light. Therefore, the DNA fragments could be detected on a UV-light tray at 265 nm. For preparative gels, a weaker UV-light source was used (365 nm) to avoid irradiation damage of DNA Purification of DNA fragments DNA fragments generated by PCR or by restriction digest were purified using the QIAquick PCR Purification Kit or Gel Extraction Kit (both from QIAgen) according to the manufacturer s instructions. Restriction fragments were purified from an agarose gel. For this, slices containing the fragment of interest were excised from the gel, and the agarose slice was solubilised at 50 C in an appropriate amount of buffer QG. DNA fragments generated by PCR were purified directly from the reaction mixture, after the addition of 5 volumes of binding buffer PB. In either case, the solutions containing the solubilised gel slice or the PCR mixture were applied to the silica-based purification column. The DNA selectively adsorbs to the silica membrane in the presence of high-salt, while contaminants pass through the column during a centrifugation step. After washing the column with EtOH-containing buffer PE, the pure DNA was eluted with μl water Restriction digest of DNA Restriction enzymes (type II endonucleases) cut palindromic DNA site-specifically, leaving blunt or sticky ends. Restriction digests were performed for analysis as well as cloning. The enzymes were used in a concentration of 0.2-1U with the recommended buffer and BSA (where recommended) in a total volume of µl. The digests were incubated at the enzyme-specific temperature for 1-3h. The following table lists a standard reaction setup for preparative (left column) and analytical (right column) restriction digest. 50

65 2. Materials and Methods Preparative restriction mixture Analytical restriction mixture 10 µg vector DNA 1 µg vector DNA 4 µl 10x restriction buffer 1 µl 10x restriction buffer 2 µl restriction enzyme (10 U/µl) 0.5 µl restriction enzyme (10 U/µl) H 2 O up to 40 µl total volume H 2 O up to 10 µl total volume Dephosphorylation of plasmid DNA Removal of phosphate groups at the 5 end of a cut vector DNA is a procedure that hinders re-ligation of the vector. This reaction was performed using the calf intestinal alkaline phosphatase (CIP) (NEB). First, plasmid digested with restriction enzymes was incubated 20 min at 65 C to inactivate the enzymes (if possible). After the addition of 1 µl (1U) of CIP, the reaction mixture was incubated 30 min at 37 C. Finally, the phosphatase was heat-inactivated for 15 min at 65 C. The following table lists a standard setup for a dephosphorylation reaction. Dephosphorylation mixture: 10 µg cut DNA vector 5 µl 10x CIP-buffer 1 µl CIP (1U/µl) H 2 O up to 50 µl total volume DNA ligation The cloning of a DNA fragment into a compatible vector is catalyzed by T4 DNA ligase. This enzyme is capable of building phosphodiester bonds between free 5 phosphate and 3 -hydroxyl groups in an ATP-dependent manner. A 20 µl ligation mixture consisted of cut and dephosphorylated DNA vector and insert DNA in a molar ratio 1:3, respectively. 2 µl of 10x ligation buffer, 1 µl of T4 DNA ligase and ddh 2 O up to the volume of 20 µl were incubated for 3h at room 51

66 2. Materials and Methods temperature. Afterwards, the preparation could be used directly to transform competent E. coli cells Preparation of CaCl 2 competent E. coli cells Calcium chloride weakens the capsular structure of E. coli cells and allows the transfer of plasmids inside the cells by a short heat pulse (Dagert and Ehrlich, 1979). Competent cells, prepared as described below, were used directly or frozen at -80 C in 10% glycerol for further use. 50 ml LB medium containing relevant antibiotics was inoculated with an overnight bacterial culture at 0D 600 = When the bacterial growth reached the middle of the logarithmic phase, the culture was centrifuged (4.000 rpm, 10 min, 4 C). The resulting bacterial pellet was first washed in 20 ml 0.1 M MgCl 2, centrifuged (4.000 rpm, 10 min, 4 C) and resuspended in 20 ml 0.1 M CaCl 2. Following another centrifugation step (4.000 rpm, 10 min, 4 C), the pellet was resuspended in 2 ml 0.1 M CaCl 2 and incubated on ice for minimum 2h. Afterwards, sterile glycerol was added and the aliquoted competent cells were frozen in liquid nitrogen. All procedures of this preparation were performed on ice, using ice-cold solutions Transformation of competent E. coli cells For bacterial transformation 10 μl ligation mix or 1 ng plasmid DNA was combined with 100 µl of bacterial suspension, incubated on ice for 15 min and then heatshocked at 42 C for 90 sec. After 3 min incubation on ice, 200 μl LB-medium was added to each tube and cells were placed on a shaker (45 min, 37 C). Afterwards, transformed E. coli cells were spread on agar plates containing an antibiotic against which resistance was conferred by the vector used for transformation. Therefore, only bacteria carrying the incorporated plasmid were able to grow on the agar. 52

67 2. Materials and Methods Isolation of plasmid DNA from E. coli cells Two types of plasmid preparations from bacterial cells were used: mini- and maxipreparation. For evaluation of cloning results, a small-scale plasmid preparation ( miniprep ) was used. For this purpose, a few bacterial colonies were picked from an agar plate, and each was used to inoculate 5 ml of LB medium containing the appropriate selective antibiotic (e.g. 100 μg/ml ampicillin). After overnight incubation at 37 C, bacterial plasmids were purified using QIAprep Spin Miniprep Plasmid Purification Kit (QIAgen) according to the manufacturer s instructions. In brief, an overnight culture of E. coli was harvested by centrifugation (4.500 rpm, 10 min, 4 C) and the pellets were resuspended in 250 µl buffer P1 containing 100 μl/ml RNaseA. Then, an equal amount of the lysis buffer P2 was added and gently mixed by inverting the tube times. After maximum 5 min lysis at RT, 350 µl of neutralizing buffer P3 was mixed with the contents of the tube and the resulting cell debris, cellular proteins and chromosomal DNA were pelleted by centrifugation ( rpm, 10 min, RT). The supernatant containing the dissolved plasmid DNA was then transferred to a spin column, with which it equilibrated for 1 min, followed by centrifugation ( rpm, 1 min, RT). The flow-through was discarded and the column was washed with 750 µl wash buffer. After removal of the wash flow-through, the column was spun dry and placed on a fresh reaction tube. Then, µl ddh 2 O was applied to the middle of the column bed and the DNA was eluted by the last centrifugation step (1 min, rpm, RT). For a larger preparation of plasmid DNA (maxiprep), 200 ml of LB medium was inoculated with a bacterial culture and purified with the QIAfilter Plasmid Maxi Kit (QIAgen) according to the manufacturer s instructions. After extraction of plasmid DNA by mini- or maxipreparation, its absorbance at 260 nm (A 260 ) was measured. An A 260 value of 1 unit corresponds to a concentration of 50 μg/ml of double-stranded DNA. 53

68 2. Materials and Methods Specific techniques for studying microrna-mediated translational repression Drosophila embryo extract preparation Drosophila embryo cell-free translation extracts were prepared according to a published protocol (Thermann and Hentze, 2007). In brief, 0-16h old embryos from the Oregon R strain of Drosophila melanogaster were collected and washed with tap water. Next, the embryos were transferred to a glas cylinder containing freshly prepared, ice-cold EW buffer (0.7% NaCl, 0.04% Triton X-100), and sedimented by gravity. This procedure was repeated twice, using each time fresh, ice-cold EW buffer. Embryos were dechorionated by vigorous agitation for 3 min in 260 ml icecold EW buffer containing 3% sodium hypochlorite. After transfer to sieves, embryos were washed with ice-cold water for 5 10 min, transferred to a glas cylinder containing freshly prepared ice-cold lysis buffer (100 mm potassium acetate, 30 mm HEPES KOH ph 7.4, 2 mm magnesium acetate, 5 mm DTT) and settled by gravity. Floating (dead) embryos were discarded and the rest was washed twice with ice-cold lysis buffer. The embryos were then resuspended in an equal volume (with respect to the settled embryos) of ice-cold lysis buffer supplemented with protease inhibitor. The embryo-containing suspension was transferred to a chilled homogenizer and lysed at 4 C by strokes (1000 rpm). The lysate was centrifuged for 30 min at x g at 4 C, and the clear aqueous interphase was isolated and adjusted to a final concentration of 10% glycerol. Aliquots were flash frozen in liquid nitrogen and stored at 80 C Synthesis of chemically modified cap structure analogs The cap analogs m 7,3 OMe GpppG, m 7 GpppG and ApppG were purchased from New England Biolabs. The remaining caps were synthesized by Prof. Edward Darzynkiewicz and colleagues at Warsaw University in Poland. The syntheses of cap analogs with: (i) 2 -O-methyl or 3 -O-methyl modifications of m 7 G-tri-, tetra- and pentaphosphate ARCAs (cap 2-4, 9, 23) were described by 54

69 2. Materials and Methods Jemielity et al., (2003); (ii) benzyl substitutions and two-headed cap analog (cap 5-8) were described by Grudzien et al., (2004); (iii) boranophosphate dinucleoside analogs (cap 10, 14, 15 and 24-26) were described in published patent application US2006/ by Kowalska et al., (2009); (iv) methylene substitution within triphosphate bridge (cap 11) was described by Kalek et al., (2006); (v) methylene substitution within tetraphosphate bridge (cap 12) was described by Rydzik et al., (2009); (vi) imidodiphosphate modified cap analog (13) was described by Kulis et al., (2008); (vii) sulphur substitutions in the triphosphate bridge (cap and cap 22) were described by Kowalska et al., (2008); (viii) hexaphosphate cap analogs 21 and 27 were prepared similarly to the method described by Jemielity et al., (2003) and Zdanowicz et al., (2009) In vitro transcription For in vitro transcription, the plasmids FL-WT, FL-mut, S-ORF-WT and S-ORF-mut were linearized with Ecl136II and the RL control plasmid was linearized with BamHI restriction enzymes. Capped RNAs were transcribed from 1 μg of linearized plasmid DNA in a 25 μl reaction containing 1 mm ATP, CTP and UTP (Roche), 5U RNAsin (Promega), 7 mm cap structure analog, 10 mm DTT, 40U T3 or T7 RNA polymerase (Stratagene) and 1x transcription buffer (supplied with the RNA polymerase). For the preparation of radiolabeled RNAs, the CTP and UTP concentration was reduced to 0.33 mm and the reactions were supplemented with 5 μl of α[ 32 P]CTP and α[ 32 P]UTP >6000 Ci/mM (Hartmann Analytics). After 5 min incubation at 37 C, 1 mm GTP was added and the transcription continued for 1h. Next, 1U RNase-free Turbo DNase (Ambion) was added and the reactions were incubated for another 15 min at 37 C to digest the DNA template. For the transcription of RNAs with the chemically modified cap structure analogs, the Megascript t3 kit (Ambion) was used according to the manufacturer s instructions in order to increase the yield of the reaction. After the synthesis of radiolabeled transcripts, the RNAs were purified over CHROMA SPIN TM 100 columns (BD Biosciences) and the cold transcripts were 55

70 2. Materials and Methods purified with RNeasy Kit (QIAgen) according to the manufacturers instructions in order to remove unincorporated nucleotides and free cap analog. The mrna concentration and integrity was determined by UV-spectrometry and agarose gel electrophoresis, respectively Translation repression assays In vitro translation repression assays were performed as described by Thermann and Hentze (2007). In brief, 10 μl reactions were assembled on ice and contained 50% (v/v) embryo extract, 10% lysis buffer (v/v), 100 μm complete amino acid mixture, 10 μg/ml creatine phosphokinase, 0.5 mm ATP, 0.1 mm GTP, 0.01 U/μl RNasin and 10 mm creatine phosphate (where indicated). The final concentration of potassium acetate was adjusted to 100 mm. 6.7 fmol of either one of the firefly luciferase mrna reporters (FL-WT or FL-mut) was incubated together with 2 fmol of Renilla luciferase control mrna in a reaction lacking creatine phosphate for 1h at 25 C. Subsequently, the reaction containing the reporter mrnas was mixed with an equal volume of a fresh reaction lacking reporter mrnas and creatine phosphate, and half of the reaction was discarded. The remainder was again incubated for 1h at 25 C and this entire procedure was repeated once more. After a total preincubation time of 3h, the reaction was added to a fresh reaction mixture supplemented with creatine phosphate, half of the reaction was discarded, and the sample was incubated for 1h at 25 C. During this procedure, the mrnas underwent an eightfold dilution. The reaction was quenched with Passive Lysis Buffer (Promega), and luciferase activity was determined with the Dual-Luciferase Reporter (DLR TM ) Assay System (Promega). The DLR TM Assay System provides an efficient means of performing dual-reporter assays, where the activities of firefly (Photinus pyralis) and Renilla (Renilla reniformis, also known as sea pansy) luciferases are measured sequentially from a single sample. The firefly luciferase reporter is measured first by adding Luciferase Assay Reagent II (LAR II) to generate a stabilized luminescent signal (Figure 9). After quantifying the firefly luminescence, this reaction is quenched, and the Renilla luciferase reaction is simultaneously initiated by adding Stop & Glo Reagent to the 56

71 2. Materials and Methods same tube. The Stop & Glo Reagent also produces a stabilized signal from the Renilla luciferase (Figure 9), which decays slowly over the course of the measurement. Figure 9. Bioluminescent reactions catalyzed by firefly and Renilla luciferases (figure taken from the technical manual of Dual-Luciferase Reporter Assay System, Promega). Where indicated, (i) 400 fmol anti-mir LNA-oligos (mir2 and let7 mircury LNA microrna Knockdown Probes from Exiqon), (ii) 22-amino acid-long Ago hook peptide (Till et al., 2007) or (iii) a control, mutant Ago hook peptide (W>>F) was added to the repression assay at final concentration of 100 μm. Both the LNA-oligos and one of the Ago hook peptides were present in the reaction throughout the whole procedure and they were added to a reaction mixture with each hourly reaction refreshment Translation assays To test efficiency of translation mediated by the chemically modified cap structure analogs, the luciferase counts of the FL-mut mrnas were normalized to corresponding RL mrna counts after the 4h repression assay (see above). 57

72 2. Materials and Methods Purification of Drosophila proteins Drosophila 4E-BP in the vector petm11 (kind gift from A. Teleman, DKFZ, Germany) was expressed in 1 liter of culture by induction with IPTG (1 mm) at OD=0.45 and overnight growth at 20 C. Cells were lysed in his-tag lysis buffer (50 mm NaH2PO4, 500 mm NaCl, 10 mm Imidazole, complete EDTA-free protease inhibitor complex (Roche)) and purified in batch by binding to 2ml Ni-NTA agarose (QIAgen) by rotation at 4 C for 1h. Samples were transferred to polyprep columns (Biorad) and washed with 30 ml lysis buffer adjusted to 20 mm Imidazole. Proteins were eluted with lysis buffer adjusted to 250 mm Imidazole. Peak fractions were pooled, dialyzed into Buffer D and stored in aliquots at -80 C. GST-PAIP2 was purified essentially as described (Svitkin and Sonenberg, 2004). After purification, the GST tag was removed with PreScission protease followed by re-incubation with glutathione sepharose Titrations of compounds and proteins (free cap structure analog, Paip2, hippuristanol and 4E-BP) into translation reactions For the cap analog titrations, fmol of the FL-mut mrna reporters were capped with one of the four different cap analogs (m 7 G-ARCA, cap 16 or 21-ARCA). Each of these differentially capped mrnas was incubated together with 0.5 fmol Renilla luciferase control mrna in the presence of increasing concentrations (ranging from 25 µm to 1600 µm) of the free m 7 GpppG cap analog in a 1h in vitro translation reaction. The luciferase activity was determined using the Dual- Luciferase Assay System (Promega). The other titration experiments were performed in the analogous setup with the addition of: (i) ng purified recombinant Drosophila Paip2, (ii) μm hippuristanol, or (iii) ng purified recombinant Drosophila 4E-BP. 58

73 2. Materials and Methods Sucrose density gradient analysis 5-25% (for 48S gradients) or 15-45% (for 80S gradients) linear sucrose density gradients were prepared in Beckman polyallomer 13 x 51 mm ultracentrifugation tubes (final volume 4.5 ml) using the Gradient Master TM (BioComp) gradient maker with the following parameters: long caps; time- 41/52 sec; angle /86 ; speed- 25 rotation/min (for 48S and 80S gradients, respectively). 48S or 80S translation initiation intermediates were assembled on 32 P-labeled S-ORF mrnas in 50 µl in vitro translation reactions containing 1 mm cycloheximide and 5 mm GMP- PNP (for 48S gradients) or only 1 mm cycloheximide (for 80S gradients) (Thermann and Hentze, 2007; Ostareck et al., 2001). Samples containing 33,5 fmol mrna were pre-incubated without creatine phosphate for three hours as described above ( Translation repression assays) and finally incubated for 30 min in the presence of creatine phosphate. GMP-PNP and cycloheximide or only cycloheximide were present throughout the whole procedure. The samples were then diluted 1:1 with ice-cold sucrose gradient buffer and loaded on top of linear sucrose gradients. The gradients were centrifuged in a SW 55Ti rotor (Beckman) for 83 minutes at rpm (5-25% sucrose gradients) or for 136 minutes at rpm (15-45% sucrose gradients), fractionated from the bottom of the gradient and analyzed by scintillation counting. Where indicated, 670 fmol LNA-oligos (Exiqon) were present from throughout the reaction Propagation of D. melanogaster S2 cells All cell culture experiments in this study were performed in Drosophila melanogaster Schneider (S2) cells. This line was established in 1969 by I. Schneider from several hundred Oregon R embryos on the verge of hatching (20-24h) (Schneider, 1972). The cells are male, by the criterion of MSL (male specific lethal) complex assembly. This versatile cell line grows rapidly at room temperature and without CO 2. Schneider 2 cells were maintained at 25 C in Schneider Medium (Gibco) supplemented with L-glutamine, penicillin/streptomycin (both Gibco) and 10% fetal bovine serum (FBS, Invitrogen). The cells were propagated under sterile conditions 59

74 2. Materials and Methods as loose, semi-adherent monolayers in tissue culture flasks. For general maintenance, the cells were passed into fresh flasks when the cell density was between 2-7 x 10 6 cells/ml, and split at a 1:2 to 1:5 dilution RNA transfections into S2 cells RNA transfections were performed using the TransMessenger Transfection Reagent (QIAgen) according to the manufacturer s protocol. Exponentially growing Schneider cells were seeded at a density of 5 x 10 5 cells per well in 24-well plates 24 hours before transfection. Cells were transfected with 67 fmol of either one of the FL-reporter mrnas and 50 fmol of the Renilla luciferase control mrna. Cells were lysed after 24 hours in 1x Passive Lysis Buffer (Promega) and firefly and Renilla luciferase activity was determined using the Dual-Luciferase Assay System (Promega) Total RNA extraction from in vitro and in vivo reactions A 20 μl portion of in vitro reaction in Drosophila embryo extract saved at the beginning (t0) or at the end (t4) of the repression assay was supplemented with 20 μg Proteinase K and digested for 15 min at 55 C. The RNA was extracted with phenol/chloroform/isoamylalcohol (25:24:1). For this, typically 200 μl of the RNA containing mixture was taken (or the volume was adjusted to 200 μl with water), to which one volume of phenol/chloroform/isoamylalcohol mixture (25:24:1) was added. After vigorous shaking, the phases were separated by centrifugation (5 min, 4 C, max speed). The upper aqueous phase containing RNA was then transferred to a fresh tube and an equal volume of chloroform was added to remove the residual phenol. After another round of vortexing and centrifugation, the upper phase was transferred to a fresh tube and precipitated with 0.75 volumes iproh or 2.5 volumes of EtOH and 0.1 volume of 3 M NaOAc (ph 5.2). The resulting RNA pellet was washed with 75% EtOH, resuspended in ddh 2 O and incubated at 57 C for 5 min to increase solubility. 60

75 2. Materials and Methods Total RNA from transfected cells was isolated with TRIzol, according to manufacturer s instructions RT-qPCR After total RNA isolation, 2 μg (RNA transfection experiments) or 10 μg (in vitro translation reaction) of RNA was used for reverse transcription with random hexamer primers and Superscript II Reverse Transcriptase (both Invitrogen) according to manufacturer s protocol. After 4-fold dilution in water, 5 μl of these samples were used as a template for real time quantitative PCR (qpcr) with the following primers: Firefly-sense, Firefly-asense, Renilla-sense and Renilla-asense (Sanchez et al., 2007). The qpcr was performed using the SYBR Green PCR Master Mix Kit (Applera) in an ABI PRISM 7500 instrument (Applied Biosystems). An identical reaction without reverse transcriptase was performed to confirm RNA dependence of the synthesized cdnas. 61

76 2. Materials and Methods 62

77 3. Results 63

78 3. Results 64

79 3. Results 3.1 Screen of chemically modified cap structure analogs for variants that are neutral for cap-dependent translation Replacement of the physiological m 7 G-cap structure by an artificial A-cap causes loss of mir2-mediated translational repression (Thermann and Hentze, 2007). This result implicated the cap structure as a possible target of the mir-repressor complex, consistent with reports by others who used IRES-containing or A-capped mrnas to investigate this process (Wakiyama et al., 2007; Mishima et al., 2006; Humphreys et al., 2005; Pillai et al., 2005). However, such non-physiologically capped mrnas initiate translation by a different mechanism than m 7 G-capped reporters, independent of a subset of canonical initiation factors that control ratelimiting steps during translation. Since using reporters that initiate translation in a non-canonical way could hinder understanding of the actual mechanism of mirna (Nissan and Parker, 2008), the logical consequence is to dissect mirna-mediated translational repression without interfering with the physiological translation initiation. If both the translation apparatus (eif4f complex) and the mir-repressor complex compete for the cap structure, chemical biology may enable generation of cap analogs with near-physiological affinity for eif4f but altered affinities for the mir-repressor complex. Therefore, I screened a library of chemically modified cap structure analogs for variants that do not affect general translation compared to the physiological cap structure (m 7 G anti-reverse cap analog, ARCA (Peng et al., 2002)), but that specifically alter mirna-mediated translation repression. The tested cap library consists of variants with diverse chemical modifications introduced at the base, pentose and/or at the phosphate linker joining the two cap-forming nucleotides (Figure 10). Importantly, all the chemical modifications were designed so that the cap structure analogs could be: (i) incorporated into an mrna during in vitro transcription and (ii) recognized by eif4e during translation initiation, thus mediating canonical translation. 65

80 3. Results *D1 and D2 indicate two diastereomers differing in their absolute configurations at P-stereogenic centers; D1 always indicates the diastereomer that is eluted faster from the C-18 column during HPLC analysis. R P /S P absolute configurations (if determined) are also shown. Figure 10. Structures of chemically modified cap analogs used for screening. Twenty-six novel cap structure analogs (cap 2-27) were designed (i) to be included in an mrna by a bacteriophage polymerase during in vitro transcription and (ii) to mediate eif4e/ eif4f-dependent translation. Cap 1 (m 7 G-anti reverse cap analog= ARCA) was the control cap structure Test of the chemically modified cap structure analogs in translation Twenty-six cap variants (cap 2-27 according to Figure 10) were incorporated into the firefly FL-mut (no mirna binding sites) reporters during in vitro transcription and tested in the previously validated Drosophila cell-free system for mirna repression (Thermann and Hentze, 2007). In this system, the endogenous mir2 represses translation of the FL-WT reporter (six mir2 binding sites) with the 66

81 3. Results physiological cap approximately 3.5-fold compared to the non-regulated FL-mut mrna (Figure 11A and B). Moreover, this efficient repression of the WT reporter occurs without RNA degradation (Figure 11C, Thermann and Hentze, 2007). Figure 11. mirna-mediated translational repression is faithfully recapitulated in the Drosophila embryo cell-free system. (A) Schematic representation of the firefly luciferase wild type (FL-WT; nt) and firefly luciferase mutant (FL-mut; nt) mrna reporters. The FL-WT mir2-binding site is depicted in blue, and the FL-mut motif in red. Binding of mir2 to the target sequence is shown in blue, and the single letters marked in red and green are the nucleotides that differ between mir2a and mir2b (green, u to g) or mir2a and mir2c (red, u to a). (B) Reporter and control mrnas were translated in vitro. Firefly luciferase values were normalized to the ones of Renilla luciferase. Translational repression by mir2 was calculated by dividing the normalized FL-mut value by the normalized FL- WT value. The graph shows the mean and standard deviation from three independent experiments. (C) Stability of FL-WT and FL-mut mrnas. Total RNA (including the labeled mrnas) was isolated before (t0) and after (t4) translation and separated by gel electrophoresis. The signal from the firefly luciferase reporter mrnas was normalized by using the respective intensity from the Renilla luciferase (control) mrna. Below the gel, the normalized FL-WT/ FL-mut band intensity ratios are given, and are shown as mean +/- standard deviation (figure adapted from Thermann and Hentze, 2007). 67

82 3. Results As shown in Table 1 (right column), twelve out of the twenty-six cap analogs tested in the Drosophila cell-free system mediate cap-dependent translation with similar efficiency ( fold; marked in italics) to the reference (m 7 G-ARCA) cap structure. Three caps promote translation initiation less efficiently ( fold; normal font), while the remaining eleven caps mediate more efficient translation in vitro ( fold; marked in bold), compared to the m 7 G-ARCA. # Cap* Translatability relative to m 7 G-ARCA 1 m 7,3 OMe GpppG (m 7 G-ARCA) m 7,2 OMe GppppG 1.3 +/ m 7,3 OMe GppppG 1.1 +/ m 7,3 OMe GpppppG 1.3 +/ m 7 Gpppm 7 G 1.4 +/ m 2,7 2 GpppG 0.8 +/ benz 7 GpppG 2.0 +/ benz 7,3 OMe GpppG 2.5 +/ m 7,2 OMe GpppppG 3.5 +/ m 7,2 OMe Gpp BH3 pg (D2) 3.5 +/ m 7,2 OMe GppCH 2 pg 0.6 +/ m 7 GppCH 2 ppg 0.3 +/ m 7 GppNHpG 0.5 +/ m 7 Gpp BH3 pg (D1/D2 mix) 1.1 +/ m 7 Gpp BH3 pm 7 G 1.9 +/ m 7,2 OMe Gppp S G (D2) (R P ) 1.1 +/ m 7,2 OMe Gpp S pg (D1) 2.3 +/ m 7,2 OMe Gpp S pg (D2) 5.7 +/ m 7,2 OMe Gp S ppg (D1) (S P ) 2.0 +/ m 7,2 OMe Gp S ppg (D2) (R P ) 0.7 +/ m 7 GppppppG 1.0 +/ m 7,2 OMe Gppp S G (D1) (S P ) 2.4 +/ m 7,2 OMe GpppG 1.1 +/ m 7,2 OMe Gppp BH3 G (D1) (R P ) 2.5 +/ m 7,2 OMe Gppp BH3 G (D2) (S P ) 0.8 +/ m 7,2 OMe Gpp BH3 pg (D1) 0.9 +/ m 7,2 OMe GppppppG (cap 21-ARCA) 1.3 +/- 0.2 Table 1. Chemically modified cap structure analogs in translation. FL-mut mrnas with one of the cap analogs from the library were transcribed in vitro, purified and incubated in the Drosophila embryo cell-free system together with RL mrna for 3h and then translated for 1h (procedure as for the repression assay). FL-mut luminescence was normalized to RL counts. The values presented in the table are averages and standard deviations of at least three independent experiments performed in triplicate. 68

83 3. Results In summary, twelve cap variants from the tested library (cap 2-4, 6, 14, 16, 20, 21, 23 and 25-27) mediate cap-dependent translation with similar efficiency ( fold; marked in italics in Table 1) to the reference (m 7 G-ARCA) cap structure, suggesting that they are recognized by the translation apparatus (eif4f complex) as efficiently as the physiological cap. 3.2 Modifications of the cap triphosphate linker specifically augment microrna-mediated repression in vitro and in vivo Having quantified the translatability of the mrna reporters with the chemically modified cap analogs, the next step was to test the efficiency of repression mediated by these cap variants in the Drosophila cell-free system Test of the chemically modified cap structure analogs in mir2- mediated repression in vitro In order to assess mirna regulation of mrnas bearing the different cap structures, the degree to which the FL-WT reporter with mir2 binding sites is translationally repressed was quantified and compared to the FL-mut control. Twenty-one of the tested caps show no major (less than 2-fold; marked in italics) change in mirnamediated silencing and thus lead neither to increase nor to decrease in translational repression relative to physiologically capped mrna. Remarkably, five of the modified cap analogs show strongly augmented mirna-mediated repression (approximately 2-fold; marked in bold) (Table 2, right column). 69

84 3. Results # Cap* Translatability relative to m 7 G-ARCA Fold repression relative to m 7 G-ARCA 1 m 7,3 OMe GpppG (m 7 G-ARCA) m 7,2 OMe GppppG 1.3 +/ / m 7,3 OMe GppppG 1.1 +/ / m 7,3 OMe GpppppG 1.3 +/ / m 7 Gpppm 7 G 1.4 +/ / m 2,7 2 GpppG 0.8 +/ / benz 7 GpppG 2.0 +/ / benz 7,3 OMe GpppG 2.5 +/ / m 7,2 OMe GpppppG 3.5 +/ / m 7,2 OMe Gpp BH3 pg (D2) 3.5 +/ / m 7,2 OMe GppCH 2 pg 0.6 +/ / m 7 GppCH 2 ppg 0.3 +/ / m 7 GppNHpG 0.5 +/ / m 7 Gpp BH3 pg (D1/D2 mix) 1.1 +/ / m 7 Gpp BH3 pm 7 G 1.9 +/ / m 7,2 OMe Gppp S G (D2) (R P ) 1.1 +/ / m 7,2 OMe Gpp S pg (D1) 2.3 +/ / m 7,2 OMe Gpp S pg (D2) 5.7 +/ / m 7,2 OMe Gp S ppg (D1) (S P ) 2.0 +/ / m 7,2 OMe Gp S ppg (D2) (R P ) 0.7 +/ / m 7 GppppppG 1.0 +/ / m 7,2 OMe Gppp S G (D1) (S P ) 2.4 +/ / m 7,2 OMe GpppG 1.1 +/ / m 7,2 OMe Gppp BH3 G (D1) (R P ) 2.5 +/ / m 7,2 OMe Gppp BH3 G (D2) (S P ) 0.8 +/ / m 7,2 OMe Gpp BH3 pg (D1) 0.9 +/ / m 7,2 OMe GppppppG (cap 21-ARCA) 1.3 +/ /- 0.2 Table 2. Chemically modified cap structure analogs in repression. FL-WT or FL-mut mrna capped with either one of the cap analogs was subjected to a 4h repression assay together with RL mrna control. Luminescence counts of the FL reporters were normalized to corresponding RL counts. Fold repression was calculated by dividing the normalized FL-mut counts by the normalized FL-WT counts. The fold repression of the FL-WT reporters with the novel caps is displayed as a relative value of the fold repression measured for m 7 G-ARCA-capped FL-WT mrna (normalized to 1). The middle column was presented earlier (Table 1) and is shown here only to facilitate a comparison of translatability and fold-repression measured for particular cap structure analogs. The data presented in the table are mean values and standard deviations of at least three independent triplicate experiments. The most interesting group among the cap analogs that lead to a gain of repression is comprised of cap 16, 21 and 27, all of which carry chemical modifications of the triphosphate linker: (i) a sulfur substitution of a non-bridging oxygen atom on the α phosphate (furthest from the m 7 G-moiety) in cap 16, and (ii) the extension of the 70

85 3. Results tri- to hexaphosphate linker in cap 21 and 27 (Figure 12). Importantly, cap 27 is an ARCA version of cap 21. Due to its incorporation into a transcribed RNA exclusively in the correct orientation, cap 27 is an improved variant of cap 21. Since cap 27 (21-ARCA) was first synthesized later during this study, it was included only in a few final experiments, where it replaced cap 21. Figure 12. Structures of the cap analogs that augment mir2-mediated repression and are inert for general translation (cap # 16 and 21; cap # 1: m 7 G-ARCA). The compound abbreviations and their modified residues are listed in the table. Cap 16 and 21 appear to allow normal general translation, which implies that the translation initiation machinery recognizes them as efficiently as it recognizes the control m 7 G-ARCA. While being neutral for canonical translation, both cap 16 and 21 enhance translational repression approximately 2-fold (Figure 13). In a triplicate experiment, the FL-WT mrna reporter with cap 16 was repressed ~7.4-fold and the mrna with cap 21 was repressed ~8.2-fold, compared to ~3.6-fold repression shown for the control, m 7 G-ARCA-capped reporter mrna (Figure 13). 71

86 3. Results Figure 13. Identification of cap structure analogs that are neutral for cap-dependent translation but act as gain-of-function variants for mirna-mediated repression in vitro. (A) Translation mediated by the FL-mut reporters bearing cap 16 and 21 was measured after 4h assay in the Drosophila cell-free system, as described in the legend of Table 1. The normalized luciferase counts of m 7 G-ARCA-capped mrna were set to 100. (B) mir2-mediated repression of reporters with the control and gain-of-function caps was assayed as described in the legend of Figure 11. Both panels depict mean values and standard deviations of three independent experiments performed in duplicate or triplicate, thus reflecting six to nine independent repetitions Test of mir2 dependence in repression of mrnas with cap 16 and 21 Next, it was necessary to test whether the gain in repression seen for FL-WT reporters with cap 16 and 21 is mir2-specific and could therefore be abolished by sequestration of this microrna. For this purpose, translation repression assays were performed in the presence of anti-mirs (also called antagomirs or locked nucleic acids, LNAs). Anti-miR is a nucleic acid analog that, owing to introduced methylene bridges, is locked in a favorable N-conformation and can antagonize effects of a complementary microrna by binding it with a higher affinity than an unmodified nucleic acid. Translation assays performed in the presence of specific (anti-mir2) or non-specific (anti-let7e) antagomirs revealed that the augmented repression seen for FL-WT reporters with cap 16 and 21 is indeed mir2-dependent, as only the specific antagomir was able to derepress the translation of the FL-WT reporters to the level of their FL-mut counterparts (Figure 14). 72

87 3. Results 8 - fold repression (mut / WT) no antimir antimir2 antilet7e no antimir antimir2 antilet7e no antimir antimir2 antilet7e m7g-arca cap 16 cap 21 mrna Figure 14. Translational repression via cap 16 and 21 is mir2-dependent. Translation assays were performed in the presence of specific (anti-mir2) or non-specific (antilet7e) LNA anti-mirs. Either one of the LNAs was present in the assay during the entire 4h experiment and re-supplied with each hourly reaction refreshment (see Materials and Methods). This graph represents mean values and standard deviations of three independent experiments performed in duplicate, i.e. six independent experimental repetitions Investigating the cause of augmented repression of mrnas with cap 16 and 21 As described in the Introduction, mirnas often promote 5 to 3 degradation of the targeted mrna, which is triggered by decapping. In our previous studies, m 7 G- ARCA-capped FL-WT mrna was shown to be regulated by mir2 only at the level of translation, with negligible mrna degradation (Thermann and Hentze, 2007 and Figure 11). Considering this, the augmentation of mir2-mediated repression seen for mrnas with cap 16 and 21 could be caused by: (i) increase in translational repression alone, or (ii) an additional degradation of the mir2-targeted FL-WT reporters. To discriminate between these two scenarios, I performed a quantitative RT-qPCR reaction, to measure the amount of WT and mut reporters (bearing either one of the cap analogs) at the end of the repression assay. This analysis revealed no major alteration in the stability of capped FL-WT reporters during repression, irrespective of the cap type (Figure 15). These data imply that the increase in 73

88 3. Results repression seen for the mrnas with cap 16 and 21 is not caused by increased decapping and faster degradation of the targeted mrnas, but rather results from enhanced translational repression. Figure 15. mrna reporters with cap 16 or 21 are not degraded during mir2-mediated repression. Total RNA was isolated from the reactions at the end (t4) of the repression assay, reversetranscribed and subjected to RT-qPCR quantification. The amount of FL-mut mrna at t4 was normalized to 100% for each cap type. This figure depicts mean values and standard deviations of three independent experiments performed in triplicate, thus reflecting nine independent repetitions Test of the chemically modified cap structure analogs in mir2- mediated repression in vivo The next important question was whether the properties of cap 16 and 21 identified in the in vitro assays can be recapitulated in vivo. For this purpose, I performed RNA transfections of the reporters with the novel cap analogs into Drosophila S2 cells. Remarkably, the reporters bearing cap 16 and 21 also display no significant difference in translatability in vivo, compared to the physiologically capped FL-mut mrna (Figure 16A). However, the FL-WT mrnas with the chemically modified cap analogs showed strong augmentation of mirna-mediated translational repression (m 7 G-ARCA: ~3.7-fold repression, cap 16: ~5.7-fold repression, cap 21: ~8.1-fold repression; Figure 16B). In addition, quantification of the mrna reporters at the time of luciferase measurement (24h after transfection) revealed no 74

89 3. Results significant differences in mrna stability in vivo (Figure 16C), corroborating the in vitro results. Figure 16. Cap 16 and 21 also augment mir2-mediated repression in vivo. S2 cells were seeded in 24-well plates and 24h later transfected with either one (WT or mut) of the differentially capped FL mrnas and the RL control mrna. Luciferase measurements were performed 24h post-transfection, after lysing the cells with the Passive Lysis Buffer (Promega). (A) Luciferase counts of FL-mut mrnas were expressed as relative to m 7 G-ARCA-capped reporter (normalized to 100%). (B) Fold repression was calculated as described in the legend of Figure 11. (C) Reporter mrnas were RT-qPCR-quantified in parallel to luciferase measurements, 24h after transfection. The amount of FL-mut RNA at t24 was normalized to 100% for each cap variant. All panels depict results and standard deviation of three independent experiments performed in triplicate, i.e nine independent experimental repetitions Validation of mir2-mediated repression of mrnas with cap 16 and 21 Subsequently, a series of control experiments were performed to verify that caps 16 and 21-ARCA augment repression by reinforcing the previously described mir2 repression mechanism. For this purpose, I first took advantage of the Ago hook, a 75

90 3. Results short peptide homologous to a GW182 motif that interacts with DmAgo1 but not with DmAgo2 (please see Introduction for details) and, when added to the translation reaction, significantly derepresses (~70 %) the FL-WT reporter (Till et al., 2007). Interestingly, I observed that FL-WT mrnas bearing cap 16 and cap 21- ARCA were also derepressed by the Ago hook peptide, but not by its mutant version, indicating that the Ago hook peptide specifically counteracts DmGW182 function, irrespective of the cap type used (Figure 17). Taken together, these data suggest that cap16- and cap21-arca-mrnas are indeed repressed by a DmAgo1/DmGW182-dependent mechanism, as previously shown for the physiologically capped FL-WT mrna (Till et al., 2007). 6 - fold repression (mut / WT) m7g- ARCA cap 16 cap 21- ARCA m7g- ARCA cap 16 cap 21- ARCA m7g- ARCA cap 16 cap 21- ARCA no peptide Ago hook WT Ago hook mut mrna Figure 17. The mir2-mediated repression of mrnas with cap 16 and cap 21-ARCA involves the interaction between DmAgo1 and DmGW182. The translation assays were performed in the presence of 100 um WT or mut Ago hook peptide (Till et al. 2007), present in the repression assay during the whole reaction and re-added with each hourly reaction refreshment. This graph represents mean values and standard deviations of two experiments performed in duplicates, i.e. four independent experimental repetitions. Another defining feature of mir2 regulation is the repression of early steps of translation initiation, as demonstrated by reduction in the formation of a stable 48S intermediate (Thermann and Hentze, 2007). To determine the step of translation at which mir2 targets mrna reporters with cap 16 and 21, I performed sucrose gradient centrifugation and fractionation of reactions carried out in the presence of GMP-PNP, which blocks ribosome subunit joining, and with 76

91 3. Results cycloheximide, which blocks translation elongation. Interestingly, these experiments revealed that the approximate 2-fold increase in repression of the reporters bearing cap 16 and 21, shown in the previous figures, is accompanied by an approximately 2-fold decrease in 48S pre-initiation complex formation, compared to the control m 7 G-ARCA-capped mrna (Figure 18G). These experiments reproduce earlier findings about the mechanism of mir-repression for physiologically capped mrna (Thermann and Hentze, 2007). Moreover, they reveal that mrna reporters with cap 16 and 21 are also repressed at a step preceding 48S pre-initiation complex formation; in addition, these mrnas are subject to more efficient mir2-mediated repression of this step, compared to their physiologically capped counterpart (Figure 18). 77

92 3. Results Figure 18. mirnas block stable small ribosomal subunit binding to reporters with cap 16 and 21. (A-F) Repression assays were performed with 32 P-radiolabeled S-ORF reporters, described in the Materials and Methods section, for better resolution in the gradients. The reactions were incubated in the presence of cycloheximide, GMP-PNP and an LNA (where indicated), which were present during the whole procedure and re-added with each reaction refreshment. After 3.5h incubation, the reactions were centrifuged through 5-25% linear sucrose gradients and then fractionated, starting from the bottom of the tube. The radioactive counts were then quantified in the scintillation counter. Panels A to F represent mean values and standard deviations of three independent experiments. (G) Quantification of the difference between integrals of 48S peaks formed on S-ORF-WT mrna incubated with: anti-mir2, anti-let7e or no anti-mir. The values in the table of panel G were calculated on the basis of three independent gradient experiments presented in panels A - F. 78

93 3. Results Finally, I assayed the efficiency of pseudo-polysome formation on reporters with cap 16 and 21. Pseudo-polysomes are dense particles that sediment like polysomes, but form under conditions effectively inhibiting bona fide polysome formation (Thermann and Hentze, 2007). Since mir2-mediated repression has been thus far inseparable from pseudo-polysome formation in the Drosophila cell-free system used in this study, these dense particles are likely to represent aggregated, repressed mrnps. To test whether the reporters capped with cap 16 and 21 allow for even more efficient formation of pseudo-polysomes, I resolved those mrnas on 15-45% sucrose gradients. Notably, regardless of the cap structure, no difference in the efficiency of pseudo-polysome formation on the WT mrnas was observed, showing that the formation of these heavy particles is not quantitatively linked to the formation of repressed mrnps (Figure 19). 79

94 3. Results Figure 19. Pseudo-polysomes form on WT reporters with similar efficiency, irrespective of the cap analog type. (A-C) Repression assays were performed with 32 P-radiolabeled S-ORF mrna reporters, described in the Materials and Methods section, for better resolution in the gradients. The reactions were incubated in the presence of cycloheximide that was present during the whole procedure and readded with each reaction refreshment. After 3.5h incubation, the reactions were centrifuged through 15-45% linear sucrose gradients and then fractionated, starting from the bottom of the tube. The radioactive counts were then quantified in the scintillation counter. All gradients (A-C) represent one experiment. In summary, the data presented in this section show that cap 16 and 21, with modifications to the triphosphate linker, specifically augment mir2-mediated repression by enhancing the previously described mechanism of action (Thermann and Hentze, 2007), namely interference with the recruitment of the small ribosomal subunit to the messenger RNA. 3.3 Using modified caps as a tool to dissect the repression mechanism Having verified that cap 16 and 21 augment the previously described mir2 mechanism of action, it was important to understand how these cap structure analogs bring about the enhancement of repression. Two possible scenarios of how cap 16 and 21 can boost mirna-mediated repression without influencing general cap-dependent translation could be anticipated: (i) the mir2-repressor complex might directly bind to the cap structure by its component(s) and this binding could be reinforced by the modifications of the phosphate chain present in cap 16 and 21 or (ii) the modifications of the cap analogs might sensitize cap-dependent translation in a way that is neutral for overall translation, but affects the response to the inhibitors of cap-dependent translation. The first mode of action would be specific only for the mir2-repressor complex. In contrast, the latter scenario could theoretically be revealed by the cap 16- and 21-mRNAs responding with different sensitivity to the known inhibitors of translation initiation. Such differential responses of translation mediated by the chemically modified cap structure analogs could also offer further dissection of the mechanism of mir2-mediated repression. 80

95 3. Results Challenging translation mediated by cap 16 and 21 with inhibitors of cap-dependent translation In order to discriminate between the two aforementioned scenarios, I challenged translation mediated by a reference m 7 G-ARCA, cap 16 or 21-ARCA with four validated inhibitors of translation that target different steps of translation initiation (Figure 20). Figure 20. Validated inhibitors of translation initiation and their mode of action. Paip2 decreases PABP affinity towards the poly(a) tail; hippuristanol inhibits ATPase and helicase activity of eif4a; free m 7 GpppG cap analog sequesters eif4e into inactive complexes; 4E-BP interferes with eif4e-eif4g interaction (more details in the text). First, we compared the responsiveness of FL-mut reporters bearing cap 16, 21- ARCA or m 7 G-ARCA to Paip2, a validated inhibitor of PABP function (Khaleghpour et al., 2001). Paip2 is known to decrease PABP s affinity for polyadenylated RNA and to compete with Paip1 (translation activator) for PABP binding. Adding increasing concentrations of Paip2 into translation reactions revealed that translation mediated by mrnas with either one of the cap analogs is equally sensitive to Paip2 inhibition (Figure 21A). This result implies that PABP has similar affinity to poly(a) tails of all mrna reporters tested, irrespective of their cap type. 81

96 3. Results Hippuristanol, the second of the tested inhibitors, selectively targets eif4a (Bordeleau et al., 2005). It was reported that hippuristanol inhibits RNA-binding and the RNA-dependent ATPase and RNA helicase activities of both free and eif4gbound forms of eif4a (Bordeleau et al., 2005). Also upon the addition of increasing concentrations of hippuristanol to translation reactions, the FL-mut reporter mrnas with cap m 7 G-ARCA, cap 16 or 21-ARCA displayed almost superimposable inhibition curves (Figure 21B). This result demonstrates that neither cap 16 nor cap 21-ARCA affect eif4a activity during translation initiation. Next, I added increasing concentrations of free m 7 GpppG cap competitor to translation reactions of the FL-mut mrnas capped with either one of the cap analogs. As predicted, mrnas bearing the normal cap structure, cap 16 or 21-ARCA, consistent with their equivalent translatability, displayed essentially identical inhibition curves, which most probably results from sequestration of eif4e into inactive complexes (Figure 21C). Subsequently, I compared the responsiveness of FL-mut reporter mrnas to 4E-BP, a validated inhibitor of eif4e-eif4g interaction (Haghighat et al., 1995). In contrast to previously tested translation initiation inhibitors: Paip2, hippuristanol or cap analog, mrnas bearing cap 16 and 21-ARCA showed enhanced responsiveness to 4E- BP (Figure 21D). Statistical analysis by pairwise t-test demonstrates that the difference in responsiveness to 4E-BP for each concentration tested is highly significant (p < 0.02 for cap 16 and p < 0.01 for cap 21-ARCA), which implies that the eif4e-eif4g interaction is significantly attenuated in the context of cap 16 and 21-ARCA, compared to the physiological cap. 82

97 3. Results Figure 21. Cap 16 and 21-ARCA specifically augment inhibition by 4E-BP. 1h translation reactions of FL-mut mrna with either the standard m 7 G-ARCA, cap 16 or cap 21-ARCA were performed in the presence of: (A) purified recombinant Drosophila Paip2, (B) natural product hippuristanol, (C) free m 7 GpppG cap analog or (D) purified recombinant Drosophila 4E-BP. Results depict three (panel A-C) or six to eight (panel D) independent experiments. Error bars display SEM. Statistical analysis by pairwise t-test demonstrates that the difference in responsiveness to 4E-BP for each concentration tested is highly significant p < 0.02 for cap 16 and p < 0.01 for cap 21-ARCA. Experiments for panel A and B were performed by Rolf Thermann. Finally, I compared the impact of repression mediated by all of the tested inhibitors of translation. For this, I used values corresponding to the highest observed fold repression mediated by a particular inhibitor on the reporters capped with the chemically modified caps, relative to m 7 G-ARCA. This analysis revealed that only two of the tested inhibitors, mir2-repressor complex and 4E-BP, specifically augment translation repression (Figure 22). 83

98 3. Results Figure 22. Cap 16 and 21-ARCA specifically augment inhibition by 4E-BP and the mir2-repressor complex. This figure presents: (i) gain of mir2-mediated repression for cap 16- and 21-ARCA-capped FL-WT mrnas, relative to their m 7 G-ARCA-capped counterpart (green bars; values were taken from Table 2), (ii) gain of repression for cap 16- and 21-ARCA-capped FL-mut mrnas, relative to their m 7 G- ARCA-capped counterpart caused by the most effective concentration (given in brackets next to the name of the inhibitor) of a translation initiation inhibitor (yellow, pink, violet and blue bars; values were taken from Figure 21). In summary, the presented results indicate that the modifications of cap 16 and 21 selectively sensitize cap-dependent translation initiation toward a specific inhibitor of eif4e-eif4g interaction, namely 4E-BP. Moreover, cap 16 and 21 selective sensitization to both 4E-BP and mir2-repressor complex further supports that mir2 targets cap-dependent translation and also suggests that both repressors could have a related mode of action. 84

99 4. Discussion and Outlook 85

100 4. Discussion and Outlook 86

101 4. Discussion and Outlook 4.1 Chemically modified cap structure analogs bring new insight into the mechanism of microrna-mediated translation repression Despite intensive research on microrna-mediated regulation of gene expression, numerous mechanistic questions remain unresolved, such as the importance of the m 7 GpppN cap structure in mir-mediated repression. Thus far, the involvement of the physiological cap structure in translational inhibition was inferred from experiments with ApppN-capped (Mathonnet et al., 2007; Thermann and Hentze, 2007; Wakiyama et al., 2007) and IRES-bearing mrna reporters (Mathonnet et al., 2007; Humphreys et al., 2005; Pillai et al., 2005), both of which were resistant to mir-mediated translational repression in the majority of reported studies. In addition, a potential role of the physiological cap structure in the mir-repression mechanism was concluded by Mathonnet et al. who showed that the addition of the cap-binding eif4f complex to a mammalian cell-free system relieves the silencing, suggesting a competition between the mirna repression machinery and translation initiation factors for binding to the cap structure. The most direct model thus far for the involvement of the 5 cap structure in mir silencing suggested that Argonaute proteins compete with eif4e for binding to the cap (Kiriakidou et al., 2007). This binding was proposed to be mediated by conserved phenylalanines in the human Ago2, which stack the methylated guanosine of the cap. Conversely, those conserved phenylalanines in the Drosophila Ago1 protein, which is required for mir-mediated repression in D. melanogaster, were shown to be mainly involved in the interaction of Ago1 with GW182 and mirnas, rather than direct cap binding (Eulalio et al., 2008b). Furthermore, a recent bioinformatics study of Kinch and Grishin (2009) has shown that the two aromatic residues hypothesized to form base-stacking interactions with the m 7 GpppN cap are located too far apart, and one of them contributes to the hydrophobic core of the domain, which is inconsistent with their involvement in cap binding. 87

102 4. Discussion and Outlook In contrast to the data implying the importance of the cap structure for repression, there are reports arguing that mirnas can work independently of the cap structure because they affect post-initiation steps of translation. In these controversial reports translation of A-cap containing mrnas or IRES-driven reporters was repressed, for both transfected and endogenously transcribed mrnas (Lytle et al., 2007; Petersen et al., 2006). These apparently divergent results on the step of translation that is inhibited by mirnas can be interpreted in two ways that are not mutually exclusive. First, it could be that mirnas act by multiple mechanisms and the different biological or technical contexts (such as species, cell type or in vitro system, mirna-mrna pair, etc.) reveal the diversity of mirna mode of action. Alternatively, the apparently conflicting results might be caused by limitations of A-capped and IRES-driven reporter mrnas as tools to assay translational repression. A-cap-mediated translation is very inefficient, independent of the cap-eif4e interaction, whereas IRES-driven initiation involves a non-canonical set of translation initiation factors and/or IRES trans-activating factors. Consequently, both types of reporters are subject to different rate-limiting steps during translation initiation, which they mediate with different kinetics than m 7 GpppN-capped reporters (Nissan and Parker, 2008). Having recognized the limitations of tools available for testing the role of the cap and mirna-mediated repression in general, I set out to search for a better tool that could give us insight into the mechanism of translational inhibition by mirna. With this aim, I screened almost thirty chemically modified cap analogs, which, in contrast to alternative initiation mechanisms used in earlier studies, mediate capdependent translation and mir-repression dependent on Ago1-GW182 interaction (the latter was verified for cap 16, 18, 21 and 27). Among those cap analogs, I identified two: cap 16 and 21, with modifications of the triphosphate linker, which specifically enhance mirna-mediated repression (approximately 2-fold) without influencing overall translation. To my knowledge, this discovery presents the most direct evidence to date that cap-structure mediated translation initiation constitutes the primary target for the mir-repressor complex. Interestingly, the chemical modifications of cap 16 and 21 selectively sensitize translation mediated 88

103 4. Discussion and Outlook by these caps to the inhibitor of cap-dependent translation 4E-BP, known to interfere with eif4e-eif4g interaction (Haghighat et al., 1995). How do these results relate to the role of the cap structure during repression by mirna? First, structural data of eif4e binding to the m7gpppn cap structure (Marcotrigiano et al., 1997) clearly explain why the modifications to the identified caps do not interfere with the overall translation: they affect the 3 terminus of the triphosphate linker outside the core m7g nucleotide recognition region that features critical contacts for high-affinity cap binding (Figure 23). According to the eif4e-m7gdp binding data, the eif4e protein resembles a cupped hand. The concave basal surface of eif4e contains a narrow cap-binding slot, where the side chains of two conserved tryptophans (W56 and W102 in Figure 23) support recognition of 7-methyl-moiety. Guanine recognition is mediated by three hydrogen bonds, involving a backbone amino group as well as the side chain of a conserved glutamate, and a van der Waals contact with another conserved tryptophan. Therefore the triphosphate linker lying outside the narrow cap-binding slot can be subject to various chemical modifications, without interfering with cap recognition by eif4e. Figure 23. Structure of the murine eif4e-7-methyl-gdp complex. (A) RIBBONS stereodrawing showing the concave cap-binding surface of eif4e. 7-methyl-GDP, included as an atomic stick figure, is located in the cap-binding slot. The 5 UTR region of the mrna would presumably project downwards and left to the entrance of the cap-binding slot. (B) Capbinding surface of eif4e showing 7-methyl-GDP in the cap-binding slot. The surface is color-coded for electrostatic potential and labeled with the locations of selected residues involved in cap analog recognition (Trp-56, Trp-102, and Glu-103). The putative path of an mrna ligand is indicated with a yellow arrow, which is shown passing between Ser-209 and Lys-159 (figure modified from Marcotrigiano et al., 1997). 89

104 4. Discussion and Outlook The observation that the modifications to cap 16 and 21 result in enhanced sensitivity to both mir2-repressor and 4E-BP suggests that changes to the triphosphate linker could subtly affect the way eif4f interacts with the cap and possibly with the downstream portion of the 5 UTR via eif4g (Yanagiya et al., 2009). Since the effects of modifications to cap 16 and 21 are not seen at the level of general translation, but are only revealed upon treatment with two translational inhibitors, the introduced chemical modifications can be regarded as an Achilles heel, a weak point of the mrna message which only becomes noticeable in limiting conditions brought upon by specific inhibitors. Since enhanced sensitivity of translation is only observed upon challenging translation with mir2 and 4E-BP, but not with trans-acting m 7 GpppG-cap analog (eif4e inhibitor), Paip2 (PABP inhibitor) or hippuristanol (eif4a inhibitor), it appears that mir2-repressor complex uses a mechanism similar to 4E-BP to mediate inhibition of translation. Because 4E- BP is known to target eif4e-eif4g interaction (Haghighat et al., 1995), these results point to physical interaction of these two components of the eif4f complex as a potential target of the mir2 repressor complex. Interestingly, it was also reported by Iwasaki et al. (2009) that a mir-repressor complex can block eif4e-eif4g interaction in Drosophila. However, in this case it was only the Ago2-RISC complex, but not the Ago1-RISC, which appeared to employ such a mechanism of action. In contrast, the GW182-dependent Ago1-RISC was claimed to target a step after cap recognition and to promote deadenylation of the targeted messenger RNA. These data are not consistent with our results and the observed differences could be caused by dissimilar experimental conditions and/or by the previously described limitations of reporters used in the study of Iwasaki et al. In conclusion, I have characterized here a new library of cap structure analogs with unique properties in translation and mirna-mediated translational repression. Using these novel caps to dissect the mechanism of mir2-mediated silencing led to a discovery, which is summarized here in an attractive model (Figure 24) where (1) 4E-BP mode of action could be resembled by (2) the mir2 repressor complex which inhibits loading of the 43S pre-initiation complex onto the mrna by interfering with the eif4e-eif4g interaction. 90

105 4. Discussion and Outlook Figure 24. Model summarizing a mode of action of the mir2-repressor complex. (1) 4E-BP blocks recruitment of a small ribosomal subunit (and associated factors) to the mrna by interfering with the eif4e-eif4g interaction and (2) the mir2-repressor complex may adopt a similar mechanism to repress translation initiation. 4.2 Future avenues of this project Exploring the scope of the mir2 mode of action According to the obtained data, the eif4e-eif4g interaction is a highly plausible target of the mir2 repressor complex. Taking into account the multiple models of mirna action reported in the literature, it would be interesting to test if the same step of translation is targeted during repression mediated by: (i) mir2 on a different, physiological 3 UTR which usually contains only one mir2-binding site, (ii) a different mirna (e.g. mir1) and/or on a different target 3 UTR, (iii) mir2 whose binding sites are located in the 5 UTR or within the open reading frame of an mrna, (iv) micrornas in different species Investigation of microrna-mediated regulation of TOP mrnas Several proteins of the translation apparatus (e.g. ribosomal proteins and elongation factors) are themselves subject to regulation at the level of translation (Meyuhas, 2000). The mrnas encoding these proteins contain a unique sequence motif at their 5 ends, termed the 5 Terminal OligoPyrimidine tract, or TOP-motif. 91