Kursexperiment Genkartierung in Caenorhabditis elegans Peder Zipperlen-ThomasBerset
Zeitplan Freitag 13.00-13.15 Theorie C.elegans: -Was ist C.elegans? 13.15-14.30 Theorie SNP und FLP Kartierung: -Was sind SNPs und FLPs? -RFLP s -genetic cross-strategy for SNP/FLP-Kartierung -FLP Kartierung 15.00-15.30 Praktische Uebungen und Start des Experiment: -Bristol : Embryonen, Larven, Hermaphroditen -Mutante Phenotypen -C.elegans transferieren 15.30-17.00 Mutanten isolieren und DNA extrahieren Für Montag 12.1.04: Kursprotokoll lesen
Der Modellorgansimus C. elegans
Der Modelorganismus C. elegans Sydney Brenner in a letter to Max Perutz (1963) It is now widely realized that nearly all the classical problems of molecular biology have been solved or will be solved in the next decade. (...) Becaue of this, I have long felt that the future of molecular biology lies in the extension of research to other fields of biology, notably development and the nervous system. (1974)
2003 Synaptic transmission Cell and growth cone migrations Fertilization and Embryonic polarity Muscle: Structure, Function and Development Cell Death Environmental factors and gene activities that influence life span Evolution p. 1-1222 And many more topics...
For their discoveries concerning genetic regulation of organ development and programmed cell death C. elegans Mammals EGL-1 BH3 domain proteins CED-9 CED-4 CED-3 Bcl-2 family Apaf-1 Caspases
Ein adultes Tier in drei Tagen Die kurze Generationszeit von C.elegans
Ein Tier aus 959 Zellen Der fixierte Zellstammbaum pharynx pharynx nerves nerves skin skin nerves skin nerves skin Zygote 959 muscels pharynx gonade intestine muscels skin muscles germline cells Sulston et al. 1983
Der Fixierte Zellstammbaum. Pierre Gönzy, ISREC
Ein Tier aus 19 000 Genen Das vollständig sequenzierte Genom 6 Chromosomenpaare 19'000 Gene 1997 sequenziert >19'000 Proteine DNA Genome von C. elegans: 10 8 Basenpaare Protein Struktur eines Enzyms
Genetikkurs 2002/03!Welcome to the amazing world of worms! Genkartierung in C.elegans mit Hilfe als molekularen Markern (Polymorphismen) 1) Ziele: Praktischer Teil: Eine Mutation... einem der sechs Chromosomen zuordnen die chromosomale Subregion bestimmen Methoden: PCR, Sequenzierung mit Kapillargerät Theorie: C.elegans als Modellorganismus in der modernen Genetik Genetische Grundlagen eines Kartierungsexperiments verstehen Die Anwendung von verschiedenen Markern wie SNPs oder FLPs kennen Automatisierungstechniken in der modernen Genetik kennen
Zeitplan Montag 8.15: Theorie (Repetition, Fragen, Demonstrationen) 8.45-17.00 Molekularbiologie (mit Assistenten) und Fragesammlung bearbeiten (individuell, Zeitaufwand etwa 6 Std.) Gruppen A-D Kursraum um 14.00, Gruppen E-H um 15.00 Kursraum 8 Gruppen (zwei StudentInnen, ein Assistent) Laborjournal!Pause: Absprache mit den AssistentInnen!
Zeitplan Dienstag 8.15: Theorie (Auswertung Rohdaten I, Fragen) 9.15-11.00: Molekularbiologie (mit Assistenten)
Zeitplan Mittwoch 8.15-17.00: Fragensammlung
Zeitplan Donnerstag 8.15-12.00: Schlussbesprechung: Auswertung Rohdaten II, Fragensammlung
C.elegans Bristol C.elegans Hawaii Polymorphismen zwischen zwei verschiedenen C.elegans Stämmen
GAGTAATTTTTTGAAAGTTTTTTAAAAACATTTTTAAACAAAATATCTAT TTACATATGTTATGCAATATTCCTGAAAACGCAAAAAATTGGAAAAATAG TTTCCCTTTTTATAATAAGTGACAATTTTTCCCAGAAGTTCAGCTCAAAA ATTGGCAATTTTTTCACTTTTCGGTACTTCCAATTTTATGCTCAAACTTT CACATTTTTAGCCCCAAAAGCTCACCTATTCTTAATATGTCCACTGAGAA GTACTgtcattgtcagcaggtttcccACCACTGTGATCATGAACTGGATC GGGAAGATGTACTGAAACAAAAAACACCCTTGTTCCGCACACACCACTTG AACACTTTTTTCTTCCCCCAAAAATCGACCCCAATACATCTTAGAAGCTG TCTTCACGGATTTCCCCTCCCAAACGTCCGATTCATCTCTCAAAGTTTCC CCCAGGGGAGCCCAGTAAAAAACGAAAGGGAAAAAGTTTTGAGCAGGTCC SNP: (single nucleotide polymorphisme) Bristol CCGG (HpaII) Hawaii: CCTG (-) [G/T]GGGGGTGCAATCTGCTACGCAAGCAGGAAGACGACGCGGCAGGAA ATCGAGCAAGGTTCAAAGAGGAAAAAACATACTTTTTTGGTAGACTATGA TGACTAACTTGTGAAACCTTTTTTTGTGTGTTGTTGTTTTATTTGGGCCC TGGCAAATAAATGAGCAAATGAAATAATAGTAACGCACCAGAAAGcagaa gccatcaagactttgaaattgtaataaaaaaatctaatatcagactaaaa Detection by RFLP
Bristol CCGG (HpaII) Hawaii: CCTG (-)
Bristol PCR product 444 bp Hawaii PCR product 444 bp CCGG (HpaII) CCTG (-) HpaII-digestion: HpaII-digestion: 243 bp 201 bp 444 bp
444 bp 243 bp 201 bp H Gelelektrophorese in 2% Agarosegel
Eine C.elegans Datenbank für Polymorphismen http://www.genome.wustl.edu/projects/celegans/index.php?snp=1
FLP (Fragment lenght polymorphism) Bristol - Hawaii: TTTTTAAAA Nachweis mit Polyacrylamidgel oder Kapillarsequenziergerät
Bristol PCR product 550 bp Hawaii PCR product 559 bp (-) TTTTTAAA
Mapping of a recessive mutation using SNP s (SNP-mapping) Hawaii Bristol + SNP oder FLP m P0 wildtype Muv IV IV F1 wildtype m Self-fertilization: Distribution of und Hawaii chromosoms in mutant F2 animals? (C.elegans has 6 chromosoms)
I II III IV V m X m 50% 50% 50% 50% 50% The Hawaii-SNP that is linked with m can be found to << then 75%: Only in the case of a recombination between m and the Hawaii-SNP in the meiosis of the F1. 25% 25% 25% 25% 25% m m 25% 25% 25% m 25% 25% F1 Meiose F2 A Hawaii-SNP One can that find is mainly not linked the Bristol with m polymorphism! can be found in 75% of the mutants.
Define the chromosomal subregion m m 30 mutant F2 animals (IV) m >>> m Hawaii SNP m m >>> >>> SNP m SNP
m /H /H /H /H /H /H /H /H
Ziele für Freitag, 9.1.04 1) Bristol : Embryonen, Larven und adulte Hermaphroditen unterscheiden können. 2) Roller und Vulva Mutanten von wt Tieren unterscheiden können. 3) Tiere von einer Platte zur anderen transferieren (ohne die Tiere zu töten...). 4) Jede Gruppe stellt 12 DNA-Lysate mit je einem mutanten F2 Tier her.