More space,more products

Transkript

1 E N Z Y M E S F O R M O L E C U L A R B I O L O G Y

2 More space,more products Nun ist es vollbracht. GeneCraft firmiert unter einer neuen Adresse. Das großräumige Gebäude in Lüdinghausen eröffnet unzählige Möglichkeiten die umfangreiche Produktpalette den Anforderungen unserer Kunden anzupassen. Stellen Sie uns auf die Probe. Sollten Sie Fragen zu unseren Produkten oder Anregungen zur Erweiterung unseres Kataloges haben, so stehen wir ihnen gerne zur Verfügung. GENECRAFT GmbH Raiffeisenstr Lüdinghausen

3 TABLE OF CONTENTS 3 Summary of our thermostable polymerases 4 BioTherm DNA polymerase 5 First description of Taq polymerase 7 BioThermMix 8 NeoTherm DNA polymerase 10 SupraTherm DNA polymerase 11 CoverIt overlay for PCR 12 PCR-Grade H 2 O 12 Crystal violet buffer 13 BioThermRed DNA polymerase 14 BioThermT DNA polymerase 15 BioThermBio DNA polymerase 17 BioThermStar DNA polymerase 18 BioThermStarMix DNA polymerase 20 BioThermAB DNA polymerase 22 Hot Start Taq monoclonal antibody 23 Hot Start PCR compound 24 KlenTherm DNA polymerase 25 KlenThermN DNA polymerase 28 KlenThermPlatinum DNA polymerase 29 KlenThermase DNA polymerase 31 KlenThermaseN DNA polymerase 32 DNA cycle sequencing kit 32 Tth inorganic pyrophosphatase 34 Sequencing and pyrophosphatase 35 AccuTherm DNA polymerase 36 Comparison of some thermostable polymerases 37 Synergy DNA polymerase 38 SynergyN DNA polymerase 39 SynergyT DNA polymerase 40 SynergyPlus DNA polymerase 41 TthPlus DNA polymerase 42 Comparison of TthPlus and GeneScript RT 44 GeneScript reverse transcriptase 48 RT-PCR using GeneScript reverse transcriptase 48 RNase-Inhibitor 49 Klenow fragment 50 T4 polynucleotide kinase 51 T4 DNA ligase 52 Tth DNA ligase 53 SP6 RNA polymerase 54 T7 RNA polymerase 54 Restriction enzymes 55 Random prime labeling kit 58 dntp set 59 DNA polymerization mix 20 & dntps 60 dntp custom service 61 Biotin-4-dUTP 61 Biotin-11-dUTP 61 Uracil-DNA glycosylase 62 λ DNA 62 T-Vector System 63 pbs-ks-ecorv 66 BstE II-λ-DNA marker 66 Hpa II-pBS-DNA marker 67 EcoRI-λ-DNA marker 68 HindIII-λ-DNA marker 69 EcoRI+HindIII-λ-DNA marker bp ladder 71 1 kb ladder 72 MegaPure DNA purification kit 73 Treponema pallidum recombinant antigen- pa 74 Monoclonal IgG to Thermus aquaticus DNA-polymerase 74 IPTG (Isopropyl-ß-D-thiogalactoside) 75 Acrylamid solutions 76 Laemmli puffer 78 TBE buffer 78 TEMED 79 Amoniumpersulfate 79 Agarose LSL Agarose S Agarose S-IM Bounded ethidium bromide agarose 83 Magnetic particles 84 MagicTubes for perfect PCR 85 Laboratory consumables 88 Index 89 Order-form 90 That s new 91

4 SUMMARY OF OUR THERMOSTABLE POLYMERASES 4 CAT. NO. NAME ORGANISM APPLICATION REACTION BUFFERS GC-004 AccuTherm P. furiosis DNA polymerase with high fidelity PCR DNA polymerase proof-reading activity GC-002 BioTherm * T. aquaticus DNA polymerase for PCR DNA polymerase robust amplifications GC-008 BioThermAB T. aquaticus mixture of BioTherm and Hot-Start PCR DNA polymerase Hot-Start Antibody PCR with high specificity GC-047 BioThermMix T. aquaticus ready-mix for High through-put PCR amplifications routine diagnostic PCR GC-041 BioThermStarMix T. aquaticus Hot-Start ready-mix for Hot-Start high amplifications through-put PCR GC-021 BioThermRed T. aquaticus red-dyed BioTherm PCR DNA polymerase GC-045 BioThermStar T. aquaticus chemically modified form Hot-Start PCR DNA polymerase of BioTherm GC-001 KlenTherm T. aquaticus Klenow fragment Specific PCR DNA polymerase of BioTherm GC-018 KlenThermase T. aquaticus modified KlenTherm DNA dideoxysequencing DNA polymerase GC-023 KlenThermN T. aquaticus modified KlenTherm PCR of long and DNA polymerase GC-rich fragments GC-043 KlenThermaseN T. aquaticus modified KlenThermase Sequencing of long DNA polymerase and GC-rich fragments GC-046 KlenThermPlatinum T. aquaticus modified KlenTherm PCR with excellent DNA polymerase specificity GC-031 NeoTherm * T. aquaticus DNA polymerase for PCR DNA polymerase robust amplifications GC-022 SupraTherm * T. aquaticus DNA polymerase for PCR DNA polymerase standard amplifications GC-005 Synergy Mixture mixture of KlenTherm Long and accurate DNA polymerase and AccuTherm PCR GC-028 SynergyN Mixture mixture of KlenThermN Long and accurate DNA polymerase and AccuTherm fragments PCR of GC-rich GC-048 SynergyPlus Mixture Taq- and pyrophospha- Very long-range PCR DNA polymerase tase based mixture GC-049 SynergyT Mixture mixture of Synergy Low-specificity PCR for DNA polymerase with TthPlus degenerated primer GC-003 TthPlus T.thermophilus Tth DNA polymerase with RT-PCR DNA polymerase reverse transcriptase activity 5x improved buffer: 350 Tris-HCl ph 8,8 83 mm (NH) 4 SO 4, 100 mm KCl 22 mm MgCl 2 0,75% Triton X100, 10x buffer: 200 Tris-HCl ph 8,5 100 mm (NH) 4 SO 4 20mM MgCl 2 1% Triton X100,10 x buffer can be modified by adding KCl and MgCl 2 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 8,8 0,1%Tween 20, 15 mm MgCl 2 10x reaction buffer without MgCl 2 is available 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 8,8 0,1%Tween20, 15 mm MgCl 2,10x reaction buffer without MgCl 2 is available upon request BioThermMix contains already 2,5x reaction buffer, dntps and BioTherm DNA polymerase ready for PCR BioThermStarMix contains already 2.5x reaction buffer, dntps and BioThermStar DNA polymerase ready for Hot-Start PCR 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 8,3 0,1%Tween20, 15 mm MgCl 2 10x reaction buffer without MgCl 2 is available upon request 10x buffer: 500 mm KCl, 100 mm Tris-HCl ph 9 1% Triton X100 add MgCl 2 to a final concentration of 3,5 mm 10x buffer: 500 mm KCl, 100 mm Tris-HCl ph 9 1% Triton X100 add MgCl 2 to a final concentration of 3,5 mm 10x buffer: 500 mm KCl, 100 mm Tris-HCl ph 9 1% Triton X100 add MgCl 2 to a final concentration of 3,5 mm 10x buffer: 500 mm KCl, 100 mm Tris-HCl ph 9 1% Triton X100 add MgCl 2 to a final concentration of 3,5 mm 10x buffer: 500 mm KCl, 100 mm Tris-HCl ph 9 1% Triton X100 add MgCl 2 to a final concentration of 3,5 mm 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 8,8 0,1%Tween20, 15 mm MgCl 2 10x reaction buffer without MgCl 2 is available upon request 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 8,8 0,1%Tween20, 15 mm MgCl 2 10x reaction buffer without MgCl 2 is available upon request 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 9,1 8% glycerol, 2% DMSO, 35 mm MgCl 2 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 9,1 8% glycerol, 2% DMSO, 35 mm MgCl 2 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 9,1 8% glycerol, 2% DMSO, 35mM MgCl 2 10x buffer: 160 mm (NH) 4 SO mm Tris-HCl ph 9,1 8% glycerol, 2% DMSO, 35 mm MgCl 2 10x one-tube buffer: 500 mm bicine-koh ph 8,3 1 M KOAc ph7,5 30% glycerol (v/v); extra solution: 50 mm Mn(OAc) 2, 10x RT buffer: 166 mm (NH) 4 SO mm Tris-HCl ph 8,8 0,1%Tween20; extra solution: 25 mm MnCl 2 5x PCR buffer: 83 mm (NH) 4 SO mm Tris-HCl ph 8,8 0,1%Tween20, 3,75 mm EGTA, 25% glycerol (v/v); extra solution: 50 mm MgCl 2 *BioTherm, NeoTherm and SupraTherm are comparable TaqDNA polymerases isolated by slightly different procedures

5 BioTherm DNA POLYMERASE BioTherm DNA polymerase is a thermostable DNA - polymerase purified from the Thermus aquaticus strain in accordance with the procedures developed by Kaledin (1,2,3) for the isolation of thermostable enzymes processing DNA polymerase activity from thermophilic bacteria. Amplification of DNA fragments (100 bp to 10kb) can be achieved with this enzyme. The enzyme has both 5'-3' polymerase- and 5'-3' exonuclease activities. BioTherm can add a single template-directed deoxyadenosin (A) residue to the 3 end of duplex PCR products. This property allows easy and efficient ligation of PCR products in TA cloning vectors. BioTherm DNA-Polymerase ist eine hitzestabile DNA- Polymerase, welche nach dem Protokoll von Kaledin (1,2,3) zur Reinigung von hitzestabilen Enzymen mit Polymerase-Aktivität aus thermophilen Bakterien aus Thermus aquaticus isoliert wurde. Diese Polymerase ist in der Lage DNA-Fragmente mit einer Länge von 100 bp bis 10 kb zu amplifizieren. BioTherm DNA-Polymerase besitzt sowohl eine 5-3 Polymerase- als auch eine 5-3 Exonuklease-Aktivität. Das Enzym kann einen einzelnen, Template-abhängigen Deoxyadenosin (A) Rest an das 3 -Ende doppelsträngiger PCR-Produkte anhängen. Diese Eigenschaft erlaubt die einfache und effiziente Ligation von PCR-Produkten in TA- Klonierungs-Vektoren. 5 APPLICATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acidinsoluble form in 30 minutes at 72ºC under the assay conditions (25 mm TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonic acid, sodium salt) ph 9.3 (at 25ºC); 50 mm KCl; 2 mm MgCl 2 ; 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20, 50% glycerol (v/v) STORAGE TEMPERATURE Store BioTherm DNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. STORAGE TEMPERATURE 160 mm (NH 4 ) 2 SO 4, 670 mm Tris-HCl ph 8.8 (at 25ºC), 15 mm MgCl 2, 0.1% Tween 20 The 10x reaction buffer (on request with or without MgCl 2 ) is delivered free of charge. 10X REACTION BUFFER 1.5 ml 10x reaction buffer (contains 15 mm MgCl 2 ) Cat. No. GC ml 10x reaction buffer without MgCl 2 plus 50 mm MgCl 2 separately Cat. No. GC ASSOCIATED ACTIVITIES Endonuclease- and exonuclease activities were not detectable after 2 and 1 hours incubation, respectively, of 1 µg lambda DNA and 0.22 µg of EcoRI digested lambda DNA, respectively, at 72ºC in the presence of units of BioTherm DNA polymerase. COMPANION PRODUCTS BioThermRed DNA polymerase, SupraTherm DNA polymerase, dntps, T-Vector GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

6 AMPLIFICATION CONDITIONS 10x reaction buffer 3 µl dntps (200 µm each) 5 µl human genomic DNA ( ng) 1 µl forward primer (25 pm) 2 µl reverse primer (25 pm) 2 µl BioTherm (0.2-1 units/µl) 1 µl H 2 O 16 µl 58ºC 0.5 min 72ºC 4 min 93ºC 20 sec 30 cycles total 30 µl 6 REFERENCES 1 Kaledin, A.S., et al. (1980) Biokhimiya 45, Kaledin, A.S., et al. (1981) Biokhimiya 46, Kaledin, A.S., et al. (1982) Biokhimiya 47, 1785 COMPARISON OF DIFFERENT TAQ DNA POLYMERASES MIXTURE Template 1 µl (IN4/TNOMF5-product) Buffer 4 µl dntps 8 µl => 200 µm MgCl µl (lanes 3-6) => 1.5 mm IN4 2 µl TNOMF5 2 µl (lanes 1,3,5,7) TNOMF6 2 µl (lanes 2,4,6,8) Polymerase 2 µl H 2 O added to 30 µl Program 1 94 C 2 min 2 94 C 30 sec 65 C 30 sec 30 cycles 72 C 30 sec (75 C by Eurogentec HA DNA polymerase) 3 72 C 7 min 4 4 C POLYMERASES Lane Marker 9 Marker GEL 1.5% Agarose-TAE-Gel, 85V 10 µl of each mixture per lane 1+2 Sigma, 1 u 3+4 Promega, 1 u 5+6 Eurogentec HA, 0.3 u 7+8 BioTherm, 1 u bp 240 bp

7 THE FIRST OF TAQ POLYMERASE by the Russian scientist Kaledin 7 Kaledin, A.S, at al. (1980) Biokhimia 45, 494

8 8 BioThermMix BioTherm Mix is a 2.5x concentrated reagent mix for PCR comprising BioTherm DNA polymerase (0.06 u/µl), 2.5x PCR-Buffer with 3.75 mm MgCl 2, 500 µm of each dntp and stabilizers. The 2.5x concentration of the Mix provides high versatility for settting-up PCR reactions. Up to 60% of the final reaction volume can be used for the addition of primer and template DNA solutions, co-solvents or other additives, if necessary. BioThermMix ist ein 2.5x konzentrierter Reagenzien-Mix für PCR-Reaktionen. Der Mix enthält Bio- Therm DNA-Polymerase (0.06 u/µl), 2.5x PCR- Puffer mit 3.75 mm MgCl 2, 500 µm von jedem dntp und stabilisierende Substanzen. Die 2.5x Konzentration des BioThermMix ermöglicht einen flexiblen Einsatz in den PCR-Reaktionen.Auf diese Weise kann bis zu 60 % des endgültigen Reaktion-Volumens für die Zugabe von Primern, Template-DNA, sowie anderen Reaktionssubstanzen genutzt werden. APPLICATION BioTherm Mix is suitable and tested for amplification of genomic targets ranging from l00 bp to 4 kb and of episomal targets (lambda phage; plasmids) up to 10 kb under various reaction conditions. high through-put PCR routine diagnostic PCR requiring high reproducibility DNA sequencing template preparation STORAGE CONDITIONS BioTherm Mix can be stored at either -20 C in a freezer or at 2-8 C in a usual refrigerator. Shipment at ambient temperature is possible without reduction of PCR performance and activity. Storage at 2-8 C is convenient for easy and time-saving assembling of the PCR assays. Storage of BioTherm Mix at -20 C is recommended for long-term storage after the mix has been used once under non-sterile conditions. Multiple freezing and thawing do not affect the performance or activity of the Mix. At 2-8 C the BioTherm Mix is at least stable for 12 months, in frozen state for 2 years. NOTE Do not contaminate the BioTherm Mix with primers and template DNA used in individual reactions. Thaw and mix all components thoroughly, spin down shortly and chill on ice. It is very important to mix the BioTherm Mix before use to avoid localized concentration! PROTOCOL 1 Place the PCR tubes on ice. 2 Prepare first a template/primer mix according to the volumes given in the table below for different reaction volumes. Mix the template/primer mix and chill on ice. 3 Dispense now the corresponding volume of Bio- Therm Mix (20 µl for a 50 µl reaction) followed by the template/primer mix into each reaction tube. Close tubes and mix well. Spin down shortly, if necessary, and chill the tubes on ice. 4 Start the program on the thermal cycler. Transfer the tubes directly from ice into the thermal cycler when the temperature of the block has reached 90 C. IMPORTANT NOTE The stabilizers in the BioTherm Mix are potential growth substrates for bacterial contaminations! If the Mix has been opened and used under non-sterile conditions, the residual moiety should be used during the next 2 weeks with intermediate storage at 2-8 C or should be frozen at -20 C for longer storage!

9 BioThermMix PCR Sterile redi- Sense Antisense Template 2.5x PCR Volume stilled H 2 O Primer Primer DNA Mix 100 µl up to 60 µl x µl y µl z µl 40 µl 50 µl up to 30 µl x µl y µl z µl 20 µl 25 µl up to 15 µl x µl y µl z µl 10 µl 20 µl up to 12 µl x µl y µl z µl 8 µl Final concentrations: 200 nm 200 nm ng 1x 9 Other variable reaction conditions (temperatures, cycling times, concentrations of template, primers, magnesium and polymerase) have to be optimized empirically for each template/primers combination. Most PCR applications work at the standard concentration of 1,5 mm Mg 2+ provided with 1x diluted PCR Mix. Optimal Mg 2+ concentration higher than 1,5 mm can be adjusted using a separate magnesium solution or by increasing stepwise (5 µl increments) the amount of BioThermMix added to the reaction assay. This approach can also be used to improve the product yield in amplification of difficult targets on complex template DNA (see table below). Optimization by adding variable amounts of concentrated BioThermMix to a 50 µl-assay: Volume of Volume of Final Mg 2+ Final dntp- Taq units Final 2,5x PCR template/ Concen- Concen- per concen- Mix primer mix tration tration reaction trations 20 µl 30 µl 1.5 mm 200 µm 1.25 u 1x 25 µl 25 µl 2.0 mm 250 µm 1.6 u 1.25x 30 µl 20 µl 2.25 mm 300 µm 1.9 u 1.5x GC ml

10 10 NeoTherm DNA POLYMERASE NeoTherm is a thermostable DNA polymerase purified from the Thermus aquaticus strain in accordance with the procedures developed by Kaledin for the isolation from thermophilic bacteria of thermostable enzymes processing DNA polymerase activity. It is a highly processive 5'-3' DNA polymerase lacking 3'-5'-exonuclease activity. The enzyme is highly purified and is free of nonspecific endo- or exonucleases. This polymerase has a template-dependent activity which adds a single deoxyadenosine (A) to the 3' ends of PCR products (3'-A-overhangs). This property allows easy and efficient ligation of PCR products in TA cloning vectors. NeoTherm DNA-Polymerase ist eine hitzestabile DNA-Polymerase, welche nach dem Protokoll von Kaledin (1,2,3) zur Reinigung von hitzestabilen Enzymen mit Polymerase-Aktivität aus thermophilen Bakterien aus Thermus aquaticus isoliert wurde. Dies ist eine äußerst aktive 5-3 DNA-Polymerase ohne 3-5 Exonuklease-Aktivität. Das Enzym weist einen sehr hohen Reinheitsgrad auf und enthält daher keinerlei unspezifische Endo- oder Exonukleasen. Die Polymerase besitzt eine Template-abhängige Aktivität, welche einen einzelnen Deoxyadenosin (A) -Rest an das 3 -Ende von PCR-Produkten anhängt (3 -A- Überhänge). Diese Eigenschaft erlaubt die einfache und effiziente Ligation von PCR-Produkten in TA-Klonierungs- Vektoren. APPLICATION PCR DNA labelling CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 min at 72 C. STORAGE BUFFER 20 mm Tris-HCl ph 8.0, 100 mm KCl, 0.1 mm EDTA, 5 mm DTT, 50% glycerol, 1% Triton X-100 STORAGE TEMPERATURE -20 C 10X REACTION BUFFER 160 mm (NH 4 ) 2 SO 4, 670 mm Tris-HCl ph 8.8 (at 25ºC), 15 mm MgCl 2, 0.1% Tween 20 The 10x reaction buffer (on request with or without MgCl 2 ) is delivered free of charge. QUALITY CONTROL Activity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases The enzyme is also tested to verify that less than 10 copies of bacterial 16S ribosomal RNA gene sequences are present in a standard 2.5 unit aliquot. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

11 SupraTherm DNA POLYMERASE SupraTherm DNA polymerase is a thermostable DNA polymerase purified from the Thermus aquaticus strain by several rounds of liquid chromatography. The purity of SupraTherm DNA polymerase is more than 90% of the total protein in the preparation. Amplification of DNA fragments (100 bp to 5 kb) can be achieved with it. The enzyme has both, 5'-3' polymeraseand 5'-3'exonuclease activities. SupraTherm can add a single template-directed deoxyadenosin (A) residue to the 3 end of duplex PCR products. This property allows easy and efficient ligation of PCR products in TA cloning vectors. 11 SupraTherm DNA-Polymerase ist eine hitzestabile DNA-Polymerase, die in mehreren Durchläufen mittels Flüssigkeits-Chromatographie aus Thermus aquaticus isoliert wurde. Der Reinheitsgrad der SupraTherm DNA-Polymerase beträgt mehr als 90 % bezogen auf den Gesamt-Proteingehalt. Das Enzym ist in der Lage DNA-Fragmente mit einer Länge von 100 bp bis 5 kb zu amplifizieren. SupraTherm DNA-Polymerase besitzt sowohl eine 5-3 Polymerase- als auch eine 5-3 Exonuklease-Aktivität. Das Enzym kann einen einzelnen, Template-abhängigen Deoxyadenosin (A) Rest an das 3 -Ende doppelsträngiger PCR-Produkte anhängen. APPLICATION The enzyme may be used for PCR, thermosequencing and for other research and diagnostic applications. SupraTherm DNA polymerase is the best enzyme for everyday routine applications. The enzyme has limited application for PCR with low-abundance template (less then 100 DNA molecules of template). Please use for PCR of low-abundance templates and for other more sophisticated techniques BioTherm DNA polymerase. CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72ºC under the assay conditions (25 mm TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonic acid, sodium salt) ph 9.3 (at 25ºC), 50 mm KCl, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store SupraTherm DNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 10X REACTION BUFFER 160 mm (NH 4 ) 2 SO 4, 670 mm Tris-HCl ph 8.8 (at 25ºC), 15 mm MgCl 2, 0.1% Tween 20 The 10x reaction buffer(on request with or without MgCl 2 ) is delivered free of charge. 1.5 ml 10x reaction buffer (contains 15 mm MgCl 2 ) Cat. No. GC ml 10x reaction buffer without MgCl 2 plus 50 mm MgCl 2 separately Cat. No. GC QUALITY CONTROL SupraTherm DNA polymerase was tested for the absence of unspecific endo- and exonucieases activities. COMPANION PRODUCTS BioThermRed DNA polymerase, BioTherm DNA polymerase, dntps, T-Vector GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

12 CoverIT OVERLAY FOR PCR REACTIONS 12 CoverIt can be used as a sample overlay in PCR reaction tubes. The use of CoverIt prevents evaporation and subsequent condensation of the reaction mixture in the reaction tube. Upon cooling to +4 o C CoverIt becomes solid allowing convenient recovering of the reaction mix by sticking through it with a pipet tip. STORAGE TEMPERATURE store at room temperature CoverIt kann als Proben-Überschichtung in PCR Reaktions-Gefäßen verwendet werden. Die Verwendung von CoverIt verhindert die Verdunstung und anschließende Kondensation des Reaktionsansatzes im Reaktionsgefäß. Nach Kühlung auf +4 C wird CoverIt fest, so dass man mit einer Pipettenspitze durchstechen kann, um den Reaktionsansatz heraus zu pipettieren. PROTOCOL For µl PCR mix use 60 µl (two drops) CoverIt. GC ml PCR-GRADE H 2 O GC-058 1,5 ml

13 CRYSTAL VIOLET BUFFER By including crystal violet in the gel and loading bufffer it is possible to visualize DNA bands as they separate during agarose gel electrophoresis. This is particularly useful for isolating DNA fragments for cloning work. The advantage of this method is that the DNA is not exposed to the damaging effects of ultraviolet (UV) light, as occurs when ethidium bromide is used for staining. The improvement in cloning efficiency observed when crystal violet is used is threefold when compared with ethidium bromide and a transilluminator with max. 320 nm and tenfold in comparison with a shorter wavelength (302 nm). APPLICATION Cloning of DNA fragments (PCR products and DNA molecules digested by restriction enzymes) STORAGE TEMPERATURE +4 C to -20 C REFERENCES Rand, K. N. (1996) Crystal violet can be used to visualize DNA bands during gel electrophoresis and to improve cloning efficiency. Elsevier Trends Journals Technical Tips Online, T Mit Hilfe des Crystal Violet in Gel und Puffer ist es möglich die DNA-Banden sichtbar zu machen, während sie sich in einer Agarose-Gel-Elektrophorese trennen. Dies ist besonders nützlich bei DNA-Fragmenten, die für Klonierungen isoliert werden. Der Vorteil dieser Methode ist, dass die DNA nicht den schädigenden Einflüssen ultravioletten (UV) Lichts ausgesetzt werden muss, was nötig ist, wenn Ethidiumbromid für die Färbung verwendet wird. Der Erfolg einer Klonierung ist nach Verwendung von Crystal Violet dreimal höher als bei Verwendung von Ethidiumbromid oder einem Transilluminator mit max. 320 nm, sowie zehnmal höher bei einer kürzeren Wellenlänge (302 nm). PROTOCOL Crystal violet has a lower sensitivity than ethidium bromide. Load as much as 1 to 3 µg DNA in a slot. If less than 100 ng of the required fragment is loaded onto the gel it may be necessary to make a control with ethidium bromide by running a second minigel at the same time. Agarose should be prepared by adding 100 µl Crystal violet gel buffer to 100 ml gel. Add 3-5 µl Crystal Violet loading buffer to 30 µl digest or PCR aliquot and load that into the slot. For maximum sensitivity the running buffer should only just cover the gel. After electrophoresis, place the gel on a light box to visualize separated fragments. Crystal violet is runnning in opposite direction as DNA, so do not run the gel for a too long time. 13 GC µl loading buffer,10 ml gel buffer (100 rxns).

14 14 BioThermRed DNA POLYMERASE BioThermRed DNA polymerase is a mixture of Bio- Therm DNA polymerase and red pigment that works like BioTherm. After addition of BioTherm- Red a thin red layer on the bottom of the tube appears. So you have a visible pipetting control. Furthermore you can see, if your reaction is already mixed, when the color of your reaction becomes uniform. BioThermRed ist eine neue, mit rotem Farbstoff versehene Variante der BioTherm DNA Polymerase. Sie funktioniert genauso wie BioTherm DNA Polymerase. Nach Zugabe von BioThermRed erscheint eine dünne rote Schicht am Boden des Reaktionsgefäßes. Dadurch haben Sie eine deutlich sichere Pipettierkontrolle. Weiterhin können Sie anhand der roten Farbe erkennen, ob ihr Ansatz gut durchmischt ist. Gleichmäßige Farbverteilung deutet auf eine vollkommene Durchmischung der Probe hin. CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acidinsoluble form in 30 minutes at 72ºC under the assay conditions (25 mm TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonic acid, sodium salt) ph 9.3 (at 25ºC), 50 mm KCl, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20,0.2% indicator red dye, 50% glycerol (v/v) The 10x reaction buffer (on request with or without MgCl 2 ) is delivered free of charge. STORAGE TEMPERATURE Store BioThermRed DNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 10X REACTION BUFFER 160 mm (NH 4 ) 2 SO 4, 670 mm Tris-HCl ph 8.8 (at 25ºC), 15 mm MgCl 2, 0.1% Tween ml 10x reaction buffer (contains 15 mm MgCl 2 ) Cat. No. GC ml 10x reaction buffer without MgCl 2 plus 50 mm MgCl 2 separately Cat. No. GC ASSOCIATED ACTIVITIES Endonuclease- and exonuclease activities were not detectable after 2 and 1 hours incubation, respectively, of 1 µg lambda DNA and 0.22 µg of EcoRI digested lambda DNA, respectively, at 72ºC in the presence of units of BioThermRed DNA polymerase. COMPANION PRODUCTS BioTherm DNA polymerase, SupraTherm DNA polymerase, dntps GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

15 BioThermT DNA POLYMERASE BioThermT is a modified BioTherm DNA polymerase to facilitate incorporation of Biotin-dUTP and Digoxigenin-dUTP in DNA. BioThermT ist eine modifizierte BioTherm DNA- Polymerase, die es ermöglicht Biotin-dUTP und Digoxigenin-dUTP in DNA einzubringen. 15 CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acidinsoluble form in 30 minutes at 72ºC under the assay conditions (25 mm TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonic acid, sodium salt) ph 9.3 (at 25ºC), 50 mm KCl, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20,0.2% indicator red dye, 50% glycerol (v/v) The 10x reaction buffer (on request with or without MgCl 2 ) is delivered free of charge. STORAGE TEMPERATURE Store BioThermT DNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 10X REACTION BUFFER 160 mm (NH 4 ) 2 SO 4, 670 mm Tris-HCl ph 8.8 (at 25ºC), 15 mm MgCl 2, 0.1% Tween ml 10x reaction buffer (contains 15 mm MgCl 2 ) Cat. No. GC ml 10x reaction buffer without MgCl 2 plus 50 mm MgCl 2 separately Cat. No. GC ASSOCIATED ACTIVITIES Endonuclease- and exonuclease activities were not detectable after 2 and 1 hours incubation, respectively, of 1 µg lambda DNA and 0.22 µg of EcoRI digested lambda DNA, respectively, at 72ºC in the presence of units of BioThermT DNA polymerase. COMPANION PRODUCTS BioTherm, BioThermBio A 700 bp DNA fragment of a single copy gene was amplified without (lane 1) and with the addition of biotin-11-dutp using different concentrations (lanes 2-4, MW = molecular weight standard). PCR reactions were run for 40 cycles, 10 sec at 92 C,15 sec at 65 C, and 2 min at 72 C in a volume of 25 µl, including 10 x amplification buffer (Genecraft), 2 mm MgCl 2,5 pmol of each forward and reverse primers, 1 ng of DNA, 1 unit of BioTherm T Taq polymerase (Genecraft) and 0.1 mm of each dntps, whereas dttp was proportionally substituted with increasing concentrations of biotin-11-dutp: 20% (lane 2), 50% (lane 3), and 70% (lane 4). The incorporation of biotin-11-dutp correlates with a size shifting of the amplified product. Note, the decrease of PCR efficiency at a proportion of 70% biotin -11-dUTP (lane 4) compared to the lower concentrations. MW MW

16 BioThermT DNA POLYMERASE pg 50pg 5pg 20% bio-dutp 50% bio-dutp 70% bio-dutp A 700 bp DNA fragment was internally labeled by PCR mediated incorporation of biotin-11-dutp (biotin-11- dutp/dttp = 1/4, 1/1, and 2.3, respectively; see figure 1). The PCR products were diluted to 500 pg, 50 pg, and 5 pg and dot blotted onto nylon membrane. The DNA was cross linked to the membrane by UV radiation and visualized by colorimetric detection by means of Streptavidin/alkaline phosphatase conjugate incubation in the presence of BCIP and XPhosphat for 3 hours at 37 C. Signal intensity was strongest at 1/1 concentration (50%) of biotin-11-dutp. The efficiency of PCR mediated incorporation of biotin- 11-dUTP into a DNA fragment of 900 bp was assesed quantitatively and by comparing different Taq polymerases using a ratio of biotin-11-dutp/dttp of 1/1 (amplification conditions as described in figure 1). Lane 1 shows the unincorporated PCR product, lanes 2-4 show the biotinylated products using 0.1, 1, and 10 ng of starting DNA template and BioTherm T polymerase (Gencraft), lane 5 and 6 depicts biotinylated products using regular BioTherm polymerase (Genecraft) and an enzyme from a competitor, respectively. Note, the template dependent increase of PCR product yield, and the high efficiency of both BioTherm polymerases compared to a competitor s polymerase. MW MW GC GC GC GC u 250 u 500 u 1000 u

17 BioThermBio DNA POLYMERASE BioThermBio is a novel thermostable DNA polymerase that dramatically improves incorporation of Biotin- and Digoxigenin-dUTPs as compared to Taq DNA polymerase. BioThermBio ist eine neue hitzestabile DNA-Polymerase, welche das Einbringen von Biotin- und Digoxigenin-dUTPs in DNA grundlegend verbessert. 17 Biotine-11-dUTP labelling of PCR DNA fragment (650 bp) by thermophilic DNA polymerases. Lane 1 Amplification by Taq polymerase, dntps 200mM each, no Biotine-11-dUTP Lane 2 Amplification by Taq polymerase, datp, dgtp, dctp 200 mm each, dttp 130 mm, Biotin-11-dUTP 70 mm. Lane 3 Amplification by NEW polymerase BioTherm- Bio, datp, dgtp, dctp 200 mm each, dttp 130 mm, Biotin-11-dUTP 70 mm. Analysis with streptavidin/- alcalic phosphatase conjugates shows that specific incorporation of Biotin-11-dUTP was 20 times higher with NEW polymerase. 900 dp 800 dp 700 dp 600 dp M GC GC GC GC u 250 u 500 u 1000 u

18 18 BioThermStar DNA POLYMERASE BioThermStar is a thermostable DNA polymerase purified from the Thermus aquaticus strain in accordance with the procedures developed by Kaledin for the isolation of thermostable enzymes processing DNA polymerase activity from thermophilic bacteria. Bio- ThermStar is a modified form of the enzyme designed for Hot-Start-PCR. It is a highly processive 5'-3' DNA polymerase lacking 3'-5'-exonuclease activity. The enzyme is highly purified and is free of nonspecific endo- or exonucleases. BioThermStar ist eine hitzestabile DNA-Polymerase, welche nach dem Protokoll von Kaledin (1,2,3) - zur Reinigung von hitzestabilen Enzymen mit Polymerase- Aktivität aus thermophilen Bakterien - aus Thermus aquaticus isoliert wurde. Diese 5-3 DNA-Polymerase ist eine modifizierte Form des Enzyms und für Hot- Start-PCR-Reaktionen entwickelt worden. Sie besitzt keine 3-5 Exonuklease-Aktivität. Das Enzym weist einen sehr hohen Reinheitsgrad auf und enthält daher keinerlei unspezifische Endo- oder Exonukleasen. Comparison of BioThermStar (GeneCraft) with AmpliTaqGold (PE) BioThermStar units pre-heating-time UNIT DEFINITION One unit of activity is the amount of enzyme required to incorporate 10 nmoles of dntp into acid-insoluble material in 30 min at 72 C. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20, 50% glycerol (v/v) BUFFER PH We strongly recommmend to use buffers with ph 8.3! AmpliTaqGold ACTIVATION This polymerase is inactive until incubated 7-10 min at 95 C! These activation conditions are extremely important! The activation completely prevents nonspecific primer annealing and the formation of primer-dimers during setup. REACTION TEMPERATURE It is also very important to pay great attention to the actual temperature (95 C) inside the tube! APPLICATION Hot-Start-PCR PCR with high specificity CONCENTRATION 5 units/µl STORAGE TEMPERATURE -20 C 10X REACTION BUFFER 160 mm (NH 4 ) 2 SO 4, 670 mm Tris-HCl ph 8.3 (at 25 C), 15 mm MgCl 2, 0.1% Tween 20 The 10x reaction buffer (on request with or without MgCl 2 ) is delivered free of charge. Please note the difference between BioTherm and BioThermStar buffers! QUALITY CONTROL Activity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases. COMPANION PRODUCTS BioThermAB, MagicTubes

19 BioThermStar DNA POLYMERASE BioThermStar IN A TAQMAN ASSAY 200 nm dntp s 500 nm Primer 1.25 u BioTherm Star/0.25 µl 3 mm MgCl2 300 nm passive reference dye (Rox) 100 nm TaqMan-probe 19 GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

20 20 BioThermStarMix BioThermStarMix is a 2.5x concentrated reagent mix for Hot Start PCR comprising BioThermStar DNA polymerase (0.06 u/µl), 2.5x PCR-Buffer with 3.75 mm MgCl 2, 500 µm of each dntp and stabilizers. The 2.5x concentration of the Mix provides high versatility for setting-up Hot Start PCR reactions. Up to 60% of the final reaction volume can be used for the addition of primer and template DNA solutions, co-solvents or other additives, if necessary. BioThermStarMix ist ein 2.5x konzentrierter Reagenzien-Mix für Hot Start PCR-Reaktionen. Der Mix enthält BioThermStar DNA-Polymerase (0.06 u/µl), 2.5x PCR-Puffer mit 3.75 mm MgCl 2, 500 µm von jedem dntp und stabilisierende Substanzen. Die 2.5x Konzentration des BioThermStarMix ermöglicht einen flexiblen Einsatz in den Hot Start PCR-Reaktionen. Auf diese Weise kann bis zu 60 % des endgültigen Reaktion-Volumens für die Zugabe von Primern, Template-DNA, sowie anderen Reaktionssubstanzen genutzt werden. APPLICATION BioThermStarMix is suitable and tested for amplification of genomic targets ranging from l00 bp to 4 kb and of episomal targets (lambda phage; plasmids) up to 10 kb under various reaction conditions. high through-put Hot Start PCR routine diagnostic Hot Start PCR requiring high reproducibility DNA sequencing template preparation STORAGE CONDITIONS BioThermStarMix can be stored at either -20 C in a freezer or at 2-8 C in a usual refrigerator. Shipment at ambient temperature is possible without reduction of Hot Start PCR performance and activity. Storage at 2-8 C is convenient for easy and time-saving assembling of the Hot Start PCR assays. Storage of BioThermStar- Mix at -20 C is recommended for long-term storage after the mix has been used once under nonsterile conditions. Multiple freezing and thawing do not affect the performance or activity of the Mix. At 2-8 C the BioThermStarMix is at least stable for 12 months, in frozen state for 2 years. NOTE Do not contaminate the BioThermStarMix with primers and template DNA used in individual reactions. Thaw and mix all components thoroughly, spin down shortly and chill on ice. It is very important to mix the BioThermStarMix before use to avoid localized concentration! PROTOCOL 1 Place the Hot Start PCR tubes on ice. 2 Prepare first a template/primer mix according to the volumes given in the table below for different reaction volumes. Mix the template/primer mix and chill on ice. 3 Dispense now the corresponding volume of BioThermStarMix (20 µl for a 50 µl reaction) folllowed by the template/primer mix into each reaction tube. Close tubes and mix well. Spin down shortly, if necessary, and chill the tubes on ice. 4 Start the Hot Start program. Transfer the tubes directly from ice into the thermal cycler when the temperature of the block has reached 95 C. Incubate ca. 7 min. at 95 C before cycling. IMPORTANT NOTE The stabilizers in the BioThermStarMix are potential growth substrates for bacterial contaminations! If the Mix has been opened and used under non-sterile conditions, the residual moiety should be used during the next 2 weeks with intermediate storage at 2-8 C or should be frozen at -20 C for longer storage!

21 BioThermStarMix PCR Sterile redi- Sense Antisense Template 2.5x PCR Volume stilled H 2 O Primer Primer DNA Mix 100 µl up to 60 µl x µl y µl z µl 40 µl 50 µl up to 30 µl x µl y µl z µl 20 µl 25 µl up to 15 µl x µl y µl z µl 10 µl 20 µl up to 12 µl x µl y µl z µl 8 µl Final concentrations: 200 nm 200 nm ng 1x 21 Other variable reaction conditions (temperatures, cycling times, concentrations of template, primers, magnesium and polymerase) have to be optimized empirically for each template/primers combination. Most PCR applications work at the standard concentration of 1,5 mm Mg 2+ provided with 1x diluted PCR Mix. Optimal Mg 2+ concentration higher than 1,5 mm can be adjusted using a separate magnesium solution or by increasing stepwise (5 µl increments) the amount of BioThermStarMix added to the reaction assay. This approach can also be used to improve the product yield in amplification of difficult targets on complex template DNA (see table below). Optimization by adding variable amounts of concentrated BioThermStarMix to a 50 µl-assay: Volume of Volume of Final Mg 2+ Final dntp- Taq units Final 2,5x PCR template/ Concen- Concen- per concen- Mix primer mix tration tration reaction trations 20 µl 30 µl 1.5 mm 200 µm 1.25 u 1x 25 µl 25 µl 2.0 mm 250 µm 1.6 u 1.25x 30 µl 20 µl 2.25 mm 300 µm 1.9 u 1.5x GC ml

22 22 BioThermAB DNA POLYMERASE BioThermAB polymerase offers all the benefits of BioTherm DNA polymerase plus an antibody-based, built-in hot start. The BioThermAB polymerase mix contains Hot Start Taq Monoclonal Antibody, which blocks polymerase activity prior to the onset of thermal cycling. This prevents primer-dimers and other artifacts resulting from low-level synthesis from nonspecifically primed sites. The antibodies are quickly inactivated by the increased temperature of thermal cycling. BioThermAB polymerase requires no prolonged heating or denaturing step as do other hot-start methods, making BioThermAB polymerase more convenient and easy to use. BioThermAB weist neben allen Vorteilen einer Bio- Therm DNA-Polymerase die Möglichkeit auf, diese in Hot-Start-PCR-Reaktionen einzusetzen. Zusätzlich enthält dieser BioThermAB Polymerase-Mix Hot- Start-Taq monoklonale Antikörper, welche die Polymerase-Aktivität vor dem Beginn der PCR-Zyklen blokkiert. Dies soll Primer-Dimere und andere Artefakte aufgrund unspezifischer low-level Synthesen verhindern. Die Antikörper werden dann durch die steigende Temperatur der PCR-Zyklen rasch inaktiviert. BioThermAB Polymerase benötigt keine anhaltenden Heiz- oder Denaturierungsphasen wie in anderen Hot-Start Protokollen, was diese Polymerase komfortabler und leichter zu Handhaben macht. APPLICATION Hot-Start-PCR PCR with high specificity CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 min at 72 C. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE -20 C 10X REACTION BUFFER 160 mm (NH 4 ) 2 SO 4, 670 mm Tris-HCl ph 8.8 (at 25 C), 15 mm MgCl 2, 0.1% Tween 20 The 10x reaction buffer (on request with or without MgCl 2 ) is delivered free of charge. QUALITY CONTROL Activity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases COMPANION PRODUCTS BioThermStar, MagicTubes GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

23 HOT START TAQ MONOCLONAL ANTIBODY CLONE 8C1 23 The Hot Start Taq Monoclonal Antibodies were derived from a hybridoma (fusion of mouse myeloma cell and the cells after mouse immunization with Taq DNA Polymerase). Hot Start Taq Monoclonal Antibody is mouse IgG 2b isotype. Hot Start Taq Monoclonal Antibody inhibits polymerase activity before the onset of thermal cycling, preventing nonspecific amplification and primer-dimer formation. When the temperature is raised, the antibody is quickly inactivated and PCR proceeds. Hot Start Taq Monoclonal Antibody is effective with a variety of commercially available Taq DNA polymerases (native or recombinant). The use of Hot Start Taq Monoclonal Antibody significantly improves the specificity of PCR amplification what is especially important for PCR-based diagnostics. Die Hot Start Taq Monoklonalen Antikörper erhält man aus einer murinen, hybriden Zelle (Fusion einer murinen Myelom-Zelle und murinen Zelllen nach Immunisierung der Maus mit Taq DNA-Polymerase). Die Antikörper haben den Isotyp IgG 2b. Hot Start Taq Monoklonale Antikörper blockieren die Polymerase-Aktivität vor dem Beginn der PCR-Zyklen, was Primer-Dimere und andere Artefakte aufgrund unspezifischer Amplifikationen verhindert. Die Antikörper werden dann durch die steigende Temperatur der PCR-Zyklen rasch inaktiviert. Die Hot Start Taq Monoklonalen Antikörper funktionieren mit einer Reihe von kommerziell erhältlichen Taq-DNA-Polymerasen (nativ oder rekombinant). Die Verwendung dieser Antikörper verbessert signifikant die Spezifität der DNA-Amplifikation, was speziell in der Diagnostik mit PCR sehr wichtig ist. APPLICATION Hot Start PCR PCR diagnostics CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of Hot Start Taq Monoclonal Antibody required to block 50% of activity of 1 µg of Taq DNA Polymerase at 37 C. STORAGE BUFFER 10 mm Tris-HCl (ph 7.0 at 22 C), 50 mm KCl, 0.1 mm EDTA, 50% glycerol STORAGE TEMPERATURE -20 C REACTION BUFFER The Hot Start Taq Monoclonal Antibody reaction buffer is the same buffer used for the thermostable DNA polymerase. PURITY More than 90% in SDS electrophoresis in 15% PAAG. ASSOCIATE ACTIVITIES No conversion to the covalently closed circular DNA to the nicked or linear form was observed after incubation of 1 µg of puc19 with antibodies in final concentration of 6 u/µl in 20 µl of reaction mixture containing 25 mm Tris-HCl (ph 7.9), 100 mm NaCl, 10 mm MgCl 2 after 16 hours at 37 C. PROTOCOL Add 5 u (1µl) Hot Start Taq Monoclonal Antibody to 100 u enzyme. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

24 HOT START PCR COMPOUND 24 TYPE HSplus Hot Start (HS) PCR is commonly used to enhance the specificity and sensitivity of PCR amplification. In many cases, HS-PCR has yielded single products in a greater yield than it has been possible with conventional PCR. Usually HS-PCR is inconvenient, time-consuming and incurs a risk of cross contamination. This inconveniences are overcome by HSplus compound. HSplus is used to block Taq polymerase activity during set-up of the PCR reaction at ambient temperatures (20-25 C). The inhibition of Taq polymerase is completely reversed when the temperature is raised above 48 C. HSplus is effective with a variety of commercially available Taq DNA polymerases (native or recombinant). The use of HSplus significantly improves the specificity of PCR amplification what is especially important for PCR-based diagnostics. Hot Start (HS) PCR wird üblicherweise verwendet, um die Spezifität und Sensitivität der PCR-Amplifikation zu steigern. In vielen Fällen erhält man mit der HS-PCR die einzelnen Produkte in einer größeren Ausbeute als es mit einer herkömmlichen PCR möglich ist. Normalerweise ist eine HS-PCR relativ unbequem, zeitintensiv und beinhaltet das Risiko von Kreuz-Kontaminationen. Diese Nachteile kann man bei Verwendung von Hsplus Compound umgehen. HSplus wird verwendet, um die Taq-Polymerase-Aktivität während des Ansetzens der Reaktion bei Umgebungstemperaturen von C zu blockieren. Wenn die Temperatur dann über 48 C steigt, stellt sich die volle Aktivität der Polymerase wieder ein. HSplus funktionieren mit einer Reihe von kommerziell erhältlichen Taq-DNA-Polymerasen (nativ oder rekombinant). Die Verwendung von HSplus verbessert signifikant die Spezifität der DNA-Amplifikation, was speziell in der Diagnostik mit PCR sehr wichtig ist. APPLICATION Hot Start PCR PCR diagnostics CONCENTRATION 1 unit/µl UNIT DEFINITION One unit of activity is the amount of HSplus required for 2 units Taq polymerase per reaction. STORAGE BUFFER 20mM Tris-HCl; ph 8,0; 0,1 mm EDTA STORAGE TEMPERATURE -20 C REACTION BUFFER The HSplus reaction buffer is the same buffer used for the thermostable DNA polymerase. QUALITY CONTROL Activity, PAGE purity, absence of any enzyme contamination. IMPOTRANT NOTE Do not use HSplus when the PCR annealing cycle temperature is below 48 C. PROTOCOL Mix 1 unit of HSplus with 2 units of Taq polymerase in the PCR reaction buffer in presence of all components with the exception of the DNA template investigated. Incubate 10 min at room temperature, then add DNA and start PCR. Add in the same manner HSplus in the positive control reaction. The concentration of HSplus can be 2-10 times decreased in case of absence of its positive action. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

25 KlenTherm DNA POLYMERASE KlenTherm DNA polymerase is thermostable polymerase corresponding to the KlenTaq polymerase described by W. M. Barnes. It is a N-terminally truncated Taq DNA polymerase. As expressed from a gene construct in E.coli, translation initiates at Met 236, bypasssing the 5'-3' exonuclease domain of the DNA polymerase-encoding gene. This deletion leaves a highly active and even more heat-stable DNA polymerase activity. Repeated exposure to 98ºC, in the recommended reaction buffer, does not seem to diminish the enzyme activity. Significant activity remains even after exposure to 99ºC. The full length enzyme does not tolerate these treatments. Therefore KlenTherm DNA polymerase is an excelllent alternative to modified T7 RNA polymerase in thermal sequencing methods. Even problematic DNA templates with secondary structures and GC-rich regions can be sequenced at 70 C. You can use KlenTherm DNA polymerase also for Long-PCR up to 35 kb in combination with thermostable proof-reading polymerases (e.g. Accu- Therm ). GeneCraft offers several mixtures of Klen- Therm DNA polymerase called Synergy. In special applications KlenTherm DNA polymerase has proven better specificity than regular Taq polymerase. This results in minimising of unspecific DNA amplification products. KlenTherm DNA polymerase is similar to, yet disitinct from, USB Taq and Cetus Stoffel fragment. You will need more KlenTherm than Taq protein if the nucleic acid incorporation is more than 500 bp. Klen- Therm DNA polymerase is shipped at higher (10 u/µl) concentration, so that it can easily incorporate 2 kb, if the same quantity is used as for full-length Taq. The use of KlenTherm is espacially recomended for amplifications of small fragments from genomic DNA. The 10x reaction buffer (on request with or without MgCl 2 ) is delivered free of charge. KlenTherm has a very low 3 -A-Overhang-adding activity. KlenTherm DNA polymerase ist eine thermostabile Polymerase, welche der von W. M. Barnes beschriebenen KlenTaq Polymerase entspricht. Bei der Expression des Genkonstrukts in E.coli beginnt die Translation erst bei Met 236, wodurch die 5-3 Exonucleasedomäne am N-Terminus wegfällt. Diese Deletion führt zu erhöhter Genauigkeit und Aktivität. Ausserdem macht sie die Polymerase hitzestabiler. Wiederholtes Erhitzen auf 98 C im entsprechenden Reaktionspuffer beeinträchtigt nicht die Aktivität! Selbst nach Erhitzung auf 99 C behält KlenTherm ihre Aktivität! Solch eine Hitzebeständigkeit besitzt normale Taq Polymerase nicht. Dadurch ist sie auch für die thermale DNA Sequenzierung eine hervorragende Alternative zu modifizierten T7 DNA Polymerasen. Besonders problematische DNA Templates mit Sekundärstrukturen und hohen GC- Gehalten können mit KlenTherm DNA Polymerase bei 70 C optimal sequenziert werden. Weiterhin ist die KlenTherm DNA Polymerase in Kombination mit einer thermostabilen proofreading -DNA Polymerase (AccuTherm ) für die Amplifikation von besonders langen DNA Fragmenten bis 35 kb geeignet. GeneCraft bietet solche Mischungen unter dem Namen Synergy an. In bestimmten Applikationen kann KlenTherm DNA Polymerase eine optimalere Spezifität als herkömmliche Taq Polymerasen aufweisen, was zur Minimierung von unspezifischen DNA-Amplifikationsprodukten beitragen kann. Gerade bei kurzen Fragmenten genomischer DNA ist KlenTherm DNA Polymerase sehr zu empfehlen. KlenTherm DNA polymerase ist vergleichbar mit Taq (USB) und Stoffel fragment (Cetus). Wir empfehlen, bei Fragmenten über 500 bp mehr Units von KlenTherm DNA Polymerase einzusetzen als bei gewöhnlicher Taq Polymerase. Aus diesem Grund liefern wir Ihnen KlenTherm DNA polymerase in einer Konzentration von 10 u/µl. KlenTherm DNA Polymerase wird mit einem 10x Reaktionspuffer (auf Wunsch auch mit MgCl 2 als separater Lösung) ohne Aufpreis geliefert. KlenTherm zeigt eine sehr niedrige Aktivität 3 -A-Überhänge anzuhängen. 25

26 KlenTherm DNA POLYMERASE 26 APPLICATIONS Fidelity The relative mutation rate during polymerization is twofold lower for KlenTherm as compared to the fulllength Taq DNA polymerase. Cycle sequencing The absence of the 5'-3' exonuclease activity makes KlenTerm especially suitable for cycle sequencing. It gives higher sequence intensity and very low backgrounds. Long PCR KlenTherm in combination with a Pfu DNA polymerase (AccuTherm ) exhibiting a proof-reading activity can amplify up to 35 kb DNA fragments. Mutation analysis KlenTherm has a reduced tendency to extend a mismatched 3'-oligonucleotide end making it suitable for mutation analysis with mutationspecific oligos (ARMS analysis). CONCENTRATION 10 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acidinsoluble form in 30 min at 72ºC under the assay conditions 25 mm TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonic acid, sodium salt) ph 9.3 (at 25ºC), 50 mm KCl, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7,0; 100 mm NaCl; 0,5 mm EDTA; 1 mm DTT; 0,01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store KlenTherm DNA polymerase below 0 C, preferably at -20 C, in a constant temperature freezer. 10X REACTION BUFFER 500 mm KCl, 100 mm Tris-HCl (ph 9 at 25 C), 1% Triton X100, 35 mm MgCl ml 10x reaction buffer Cat. No GC Please note the difference between KlenTherm and BioTherm reaction buffers! COMPANION PRODUCTS KlenThermN DNA polymerase, KlenThermase, KlenThermaseN, Synergy DNA polymerase, SynergyN DNA polymerase, SynergyT DNA polymerase, dntps AMPLIFICATION CONDITIONS 10x reaction buffer 3 µl 50 mm MgCl µl dntp Mix10 (end concentration 200 µm) 0.6 µl human genomic DNA ( ng) 1 µl forward primer (25 pm) 2 µl reverse primer (25 pm) 2 µl KlenTherm (10 units/µl) 0.5 µl H 2 O 18.8 µl 58ºC 0.5 min 72ºC 4 min 93ºC 20 sec 30 cycles total 30 µl Fragment is about 1,5 kb GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

27 KlenTherm DNA POLYMERASE REFERENCES 1 Barnes W.M The fidelity of Taq polymerase catalyzing PCR is improved by an N-terminal deletion. Gene 112: PCR conditions efficient enough to allow the amplification of a 5-kb fragment result in less than half as many mutations, when KlenTaq is the DNA polymerase, compared to AmpliTaq. 2 Barnes W.M PCR amplification of up to 35-kb DNA with high fidelity and high yield from bacteriophage templates. Proc. Natl. Acad. Sci. USA 91: A target length limitation to PCR amplification of DNA has been idientified and addressed. Concomitantly, the base-pair fidelity, the ability to use PCR products as primers and the maximum yield of target fragment were increased. These improvements were achieved by the combination of a high level of an exonuclease-free, N-terminal deletion mutant of Taq DNA polymerase, Klentaq1, with a very low level of a thermostable DNA polymerase exhibiting a 3'- exonuclease activity (Pfu, Vent, or Deep Vent). At least 35 kb can be amplified to high yields from 1 ng of DNA template. Amplification of DNA spans by the polymerase chain reaction (PCR) has become an important and widespread tool of genetic analysis since the introduction of thermostabile Taq (Thermus aquaticus) DNA polymerase for its catalysis. Two limitations to the method are the fidelity of the final product and the size of the product span, that can be amplified. The fidelity problem has been partially addressed by the replacement of Taq DNA polymerase by Pfu (Pyrococcus furiosus) DNA polymerase, which exhibits an integral 3'-(editing)-exonuclease, that apparently reduces the mutations per base per cycle from about 10-4 to about It was found, that this enzyme is unable to amplify certain DNA sequences in the size range of kb, that Klentaq1 (N-terminal deletion mutant of Taq DNA polymerase analogous to the Klenow fragment of Escherichia coli DNA polymerase I) or AmpliTaq (fullength Taq DNA polymerase) can amplify handily, and Pfu is no more able (i.e., is not able) to amplify DNA product spans in excess of 5-7 kb than is any form of Taq DNA polymerase. For full-length Taq DNA Polymerase and its N-terminally truncated variants Klentaq1, Klentaq5 and Stoffel fragment, PCR amplification rapidly becomes inefficient or nonexistent as the length of the target span exceeds 5-6 kb. This is true even if 30 min (10 times longer than seemingly necessary) is used during the extension step of each cycle. Although there are several reports of inefficient but detectable amplification at 9- to 10-kb target length and one at 15 kb, most general applications are limited to 5 kb. Apparently something has been blokking extension to longer lengths. 3 Newton C.R. et al Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucl. Acids. Res. 17: The basis of the invention is that unexpectedly, oligonucleotides with a mismatched 3'-residue will not function as primers in the PCR under appropriate conditions. 27 PURITY OF THE KlenTherm FRAGMENT AND FULL-LENGTH BioTherm KlenTherm 3.75U 7.5U 15U 30U marker 3.75U 7.5U 15U 30U BioTherm Indicated dilutions of the KlenTherm and BioTherm preparation have been analyzed via 10% SDS-PAGE running gel and stained with Coomassie Brilliant Blue.

28 28 KlenThermN DNA POLYMERASE Substitution of Asn for the conserved Ser 543 in the thumb subdomain of the Taq DNA polymerase large fragment (KlenTherm DNA polymerase) prevents pausing during DNA synthesis and allows the enzyme to overcome template regions with a complex secondary structure. The mutant enzyme, KlenThermN DNA polymerase (patent pending), provides specific PCR amplification and sequencing of difficult templates, e.g. those with a high GC content or complex secondary structure. Furthermore this substitution increases several times the efficiency of synthesis of long (over 2 kb) DNA molecules. The difference in the DNA synthesis efficiencies by the mutant and native enzymes increases with the increase in the DNA fragment length. Der Austausch von Asn gegen die konservierte Ser 543 in der Daumen -Untereinheit des großen Fragmentes (KlenTherm DNA Polymerase) der Taq-DNA-Polymerase verhindert ein Pausieren während der DNA-Synthese und erlaubt es dem Enzym Template-Regionen mit einer komplexen Sekundärstruktur zu bewältigen. Das modifizierte Enzym, KlenThermN DNA Polymerase, zeigt eine spezifische DNA-Amplifikation und sequenziert auch schwierige Templates, besonders solche mit einem hohen GC-Gehalt oder komplexen Sekundärstrukturen. Außerdem erhöht der Austausch von Asn gegen Ser 543 die Syntheseeffizienz langer DNA-Moleküle (über 2 kb). Je länger das DNA-Fragment, desto stärker zeigt sich der Unterschied in der Effizienz der Synthese zwischen dem modifizierten und dem nativen Enzym. CONCENTRATION 10 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 min at 73ºC under the assay conditions 25 mm TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonic acid, sodium salt) ph 9.3 (at 25ºC), 50 mm KCl, 3.5 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated salmon sperm DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store KlenThermN DNA polymerase, preferably at -20 C, in a constant temperature freezer. 10X REACTION BUFFER 500 mm KCl, 100 mm Tris-HCl (ph 9 at 25 C), 1% Triton X100 Please note the difference between KlenTherm and BioTherm reaction buffers! Extra solution: 50 mm MgCl2, add MgCl 2 to a final concentration of 3.5 mm 1.5 ml 10x reaction buffer Cat. No GC COMPANION PRODUCTS KlenTherm DNA polymerase, Synergy DNA polymerase, SynergyN DNA polymerase, dntps REFERENCES Ignatov, K.B., Miroshnikov, A.I., Kramarov, V.M. (1998) FEBS Lett. 425, Substitution of Asn for Ser543 in the large fragment of Taq DNA polymerase increases the efficiency of synthesis of long DNA molecules. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

29 KlenThermPlatinum DNA POLYMERASE KlenThermPlatinum DNA polymerase is a modified form of KlenTherm DNA polymerase, that offers excellent specificity. It is designed for PCR with difficult templates such as GC-rich fragments and microsatelllites. KlenThermPlatinum is particularly well suited to primer extension of Single Nucleotide Polymorphism (SNP) markers. KlenThermPlatinum maintains excellent specificity and minimal background even in conditions designed for high yield (high Mg 2+ /primer concentrations). In fact, even on genomic templates, the enzyme can be used with MgCl 2+ concentrations as high as 10 mm. KlenThermPlatinum has an extrem low signal/noise ratio. In addition, it has an extremely high recognition of base mis-matches which results in a very low rate of mis-match extension. KlenThermPlatinum is capable of extending through difficult regions, e.g. regions, which include inverted tandem repeats and those with high amounts of secondary structure. KlenThermPlatinum works in a totally unique way, involving improved nucleotide selection at the active site, and a much lower rate of mis-match extension, meaning that only perfectly aligned primers will be extended. As a result, the enzyme can give even higher specificity than hot-start (manual or automatic) techniques without the need for inconvenient preincubation steps. KlenThermPlatinum has a very weak terminal transferase activity, and products can be assumed to be blunt-ended. However, this is sequence dependent, and some sequences may be tailed with a single nucleotide. KlenThermPlatinum DNA Polymerase ist eine modifizierte Form der KlenTherm DNA Polymerase, welche eine exzellente Spezifität zeigt. Diese DNA-Polymerase ist für PCR-Reaktionen mit einem komplizierten Template, wie z.b. GC-reiche Fragmente und Microsatelliten-DNA, entwickelt worden. KlenThermPlatinum ist besonders gut für die Primer-Verlängerung von Single- Nucleotide-Polymorphism (SNP) Markern geeignet. KlenThermPlatinum ermöglicht eine exzellente Speifität und einen minimalen Hintergrund, sogar bei Reaktionsbedingungen für eine möglichst große Ausbeute (hohe Mg 2+ /Primer Konzentrationen). Tatsächlich kann das Enzym, sogar bei genomischen Templates, bei MgCl 2+ -Konzentrationen von 10 mm verwendet werden. KlenThermPlatinum zeigt ein extrem niedriges Signal/Hintergrund-Verhältnis. Zudem besitzt das Enzym eine extrem hohe Erkennungsrate für mis-matches, woraus eine sehr niedrige Rate für mis-match -Verlängerungen resultiert. KlenThermPlatinum ist auch für komplizierte Regionen geeignet, wie z.b. seitenverkehrte Tandem-Wiederholungen oder Regionen mit einem hohen Anteil an Sekundärstrukturen. KlenThermPlatinum arbeitet auf eine einzigartige Weise, einschließlich einer verbesserten Nukleotid-Auswahl im aktiven Zentrum, und zeigt eine deutlich niedrigere Rate von mis-match -Verlängerungen, d.h. nur perfekt gebundene Primer werden auch verlängert. Daraus resultiert eine sogar noch höhere Spezifität als bei einer Hot-Start-PCR (manuell oder automatisch) abzüglich des Bedarfes für lästige Vor-Inkubationen. KlenThermPlatinum zeigt eine sehr schwache terminale Transferase-Aktivität, sodass die Produkte vermutlich blunt-ended sind. Dies ist jedoch von der Sequenz abhängig, und einige können auch mit einem einzelnen Nukleotid enden. 29

30 KlenThermPlatinum DNA POLYMERASE 30 APPLICATIONS PCR requiring high specificity PCR with GC-rich regions or repeats (e.g. microsatellites) CONCENTRATION 10 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme, that incorporates 10 nmoles of dntp into acid-insoluble form in 30 min at 73 C under the assay conditions (25 mm TAPS ph 9.3 at 25 C, 50 mm KCl, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE -20 C 10X REACTION BUFFER 500 mm KCl, 100 mm Tris-HCl (ph 9 at 25 C), 1% Triton X100 Please note the difference between KlenTherm and BioTherm reaction buffers! 1.5 ml 10x reaction buffer Cat. No GC QUALITY CONTROL Activity, non-specific endonucleases/nickases and exonucleases. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

31 KlenThermase DNA POLYMERASE KlenThermase DNA polymerase is an optimised version of KlenTherm DNA polymerase designed for cycle sequencing with dideoxynucleotides. This enzyme is recommended both for manual DNA sequencing with 35 S label and for automated fluorescent DNA sequencing. Mutations have been introduced into the KlenTherm DNA polymerase that confer on this enzyme enhanced properties for cycle sequencing of double-stranded PCR products. KlenThermase is similar to, yet distinct from, USB ThermoSequenase. We recommend to use KlenThermase with our thermostable Tth inorganic pyrophosphatase (1 unit of Tth inorganic pyrophosphatase added to 10 units of Klen- Thermase ) for further improvement of uniformity of band intensities. APPLICATIONS Fidelity The relative mutation rate during polymerisation is twofold lower for KlenThermase as compared to the full-length Taq DNA polymerase. Cycle sequencing The absence of the 5'-3' exonuclease activity makes KlenThermase especially suitable for cycle sequencing. It gives higher sequence intensity and very low backgrounds. The mutational optimization improves the uniformity of band intensities. Combination of KlenThermase with Tth inorganic pyrophospatase generates uniform bands that improve sequencing accuracy and give long read lengths. CONCENTRATION 25 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72 C under the assay conditions (25 mm TAPS (tris-(hydroxymethyl)-methyl-aminopropanesulfonic acid, sodium salt) ph 9.3 (at 25 C), KlenThermase DNA Polymerase ist eine optimierte Version der KlenTherm DNA Polymerase und ist für die zyklische Sequenzierung mit Dideoxynukleotiden entwickelt worden. Dieses Enzym ist sowohl für manuelle DNA-Sequenzierungen mit 35 S als auch für automatisierte, fluoreszenzmarkierte DNA-Sequenzierungen zu empfehlen. In die KlenTherm DNA-Polymerase sind Mutationen eingeführt worden, welche dem Enzym eine verstärkte Wirksamkeit für die zyklische Sequenzierung von doppelsträngigen PCR-Produkten verleihen. KlenThermase ist ähnlich der USB ThermoSequenase, aber dennoch deutlich anders. Wir empfehlen KlenThermase mit unserer hitzestabilen Tth inorganic Pyrophosphatase zu verwenden ( 1 Unit der Tth inorganic Pyrophosphatase zu 10 Unit Klen- Thermase geben), um eine noch gleichmäßigere Bandenintensität zu gewährleisten. 50 mm KCI, 2 mm MgCl 2, 1 mm ß-mercaptoethanol and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCI, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store KlenThermase DNA polymerase below 0 C, preferably at -20 C, in a constant temperature freezer. 10X REACTION BUFFER 260 mm Tris-HCl (ph 9.5), 65 mm MgCl 2 COMPANION PRODUCTS KlenThermaseN, KlenTherm DNA polymerase, KlenThermNT DNA polymerase, Tth pyrophosphatase REFERENCES Tabor, S. and Richardson, C.C. I995. A single residue in DNA polymerase of the Escherichia coli DNA polymerase 1 family is critical for distinguishing between deoxy- and dideoxyribonucleotides. Proc. Natl. Acad. Scf. USA 92: GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

32 KlenThermaseN DNA POLYMERASE KlenThermaseN DNA polymerase is an optimized version of KlenThermase for long-range DNA sequencing. This polymerase comprises mutations and benefits of both KlenThermase and KlenThermN in one enzyme. KlenThermaseN DNA Polymerase ist für lange DNA- Sequenzierungen entwickelt worden und eine optimierte Version der KlenThermase. Diese Polymerase beinhaltet alle Mutationen und Vorteile von KlenThermase und KlenThermN in einem Enzym. 32 CONCENTRATION 25 units/µl GC GC GC GC GC u 250 u 500 u 1000 u 5000 u DNA CYCLE SEQUENCING KIT The kit contains all necessary components except labeled dntps for 100 dideoxy chain terminator-sequencing reactions on double stranded DNA template. Application of KlenThermase for effective DNA elongation provides the possibility to work with the minute amount of template DNA. The suggested sequencing technique combines amplification DNA with chain-terminator sequencing reaction. The sequencing reaction should be performed in thermocycling device routinely used for PCR. The kit does not contain radioactive dntps. Any type of 32,33 P or 35 S- dntp ( Ci/mmol) may be used for radioactive labeling. CONTENTS KlenThermase 5x annealing buffer (260 mm Tris-HCl, ph 9.5) Labeling Nucleotide Mixture (for use with radiolabeled datp) 1.5 µm dgtp, 1.5 µm dctp, 1.5 µm dttp (Note: To use labeled dctp this mixture should contain 1.5 µm each of datp, dgtp, dttp) Termination Nucleotide Mix (one for each dideoxynucleotide). Each mixture contains 15 µm datp, 15 µm dgtp, 15 µm dctp,15 µm dttp. In addition the A mixture contains 0.2 µm ddatp; the G mix 0.4 µm ddgtp; the C mix 0.2 µm ddctp and the T mix 0.4 µm ddttp Dieses Kit enthält, ausgenommen markierter dntps, alle notwendigen Komponenten für 100 Sequenzier-Reaktionen mit einem doppelsträngigen DNA-Template. Die Anwendung der KlenThermase für effektive DNA- Verlängerung gibt die Möglichkeit mit der absolut exakten Menge an Template-DNA zu arbeiten. Die vorgeschlagene Sequenzier-Technik kombiniert die Amplifikation der DNA mit einer Kettenabschluss-Sequenzier- Reaktion. Die Reaktion sollte in einem handelsüblichen Thermocycler für PCR durchgeführt werden. Das Kit enthält keine radioaktiv-markierten dntps. Alle Arten von 32 P, 33 P oder 35 S-dNTPs ( Ci/mmol) können für radioaktive Markierungen verwendet werden. NOTE For better reading sequence close to primer ( nt), use higher dideoxy nucleotides concentrations: the A - 1 µm ddatp, the G - 2 µm ddgtp, the C - 1 µm ddctp and the T - 1 µm ddttp. Stop solution 95% formamide; 20 mm EDTA; 0.05% bromphenol blue; 0.05% xylene cyanol FF protocol COMPANION PRODUCT KlenThermase, KlenThermaseN, Tth pyrophosphatase, Acrylamid 4K -Fertiglösungen für denaturierende DNA GC reactions

33 SEQUENCING REACTION PROTOCOL ANNEALING TEMPLATE AND PRIMER The template (3-5 µg of a plasmid), mixed with the primer (10 pmol), is denatured in 0.2 M NaOH, 0.2 mm EDTA (30 min at 37 C). Mixture is neutralized by adding 0.1 volumes of 3 M sodium acetate (ph ) and the DNA is precipitated with 2-4 volumes of ethanol (-70 C, 15 min). After washing the pelleted DNA with 70% ethanol, it is redissolved in 12 µl of ditilled water and 2 µl of 5x Annealing buffer. LABELING REACTION To the annealed template-primer (14 µl) add the folllowing: Labeling Nucleotide Mix 2µl [α- 35 S], [α- 33 P] or [α- 32 P] 5µCi (typically 0.5µl) KlenThermase 1 µl (25 units) Mix thoroughly and incubate for 5 min at 45 C. TERMINATION REFERENCES 1 Label 4 tubes G, A, T and C. Fill each with 4 µl of the appropriate dideoxy termination mixture. Keep on ice until ready for use. 2 When the labeling reaction is complete, transfer 4 µl of it to the tube labeled G. Similarly transfer 4 µl of the labeling reaction to each of the other three tubes ( A, T and C ). Place the tubes in a 70 C bath. 3 After 5-10 min incubation at 70 C, cool to room temperature and add 4 µl of Stop Solution to each termination reaction, mix and store on ice. 4 To load the gel, heat the samples to 70 C for 5 min (or more) and load 2-3 µl in each lane. 33

34 Tth INORGANIC PYROPHOSPHATASE (thermostable) 34 Native, thermostable Tth inorganic pyrophosphatase (pyrophosphate phosphohydrolase: E.C ) is purified from Thermus thermophilus and is a hydrolase. Tth inorganic pyrophosphatase catalyses the conversion of inorganic pyrophosphate to orthophosphate in reactions, where pyrophosphate is accumulated, like DNA synthesis and amplification.tth inorganic pyrophosphatase provides enhanced polymerisation by removing inhibitive pyrophosphates in reactions. Tth anorganische Pyrophosphatase (pyrophosphate phosphohydrolase: E.C ) ist aus Thermus thermophilus isoliert worden und eine native, hitzestabile Hydrolase. Das Enzym katalysiert die Umwandlung von anorganischem Pyrophosphat in Orthophosphat. Dies empfiehlt sich in Reaktionen, in denen sich Pyrophosphat ansammelt, wie z.b. DNA-Synthesen und Amplifikationen. Durch Zusatz Tth anorganischer Pyrophosphatase erhält man aufgrund der Entfernung des inhibierenden Pyrophosphates aus den Reaktionen eine verstärkte Polymerisation. APPLICATIONS Enhanced DNA amplification The addition of Tth inorganic pyrophosphatase greatly enhances amplification reactions and provides superior results. The PCR is inhibited by the presence of pyrophosphate even at very low concentrations.this inhibition may be prevented by introducing Tth pyrophosphatase, capable of removing contaminating pyrophosphate, to the reaction mixture. The addition of 1 unit Tth inorganic pyrophosphatase to 10 units of thermostable DNA polymerase (BioTherm, SubTherm or KlenTherm ) may double the level of PCR amplification. Long fragments Tth inorganic pyrophosphatase enables longer DNA fragments to be processed successfully. DNA Sequencing Tth inorganic pyrophosphatase is recommended for high-temperature cycle sequencing with thermostable DNA polymerases (BioTherm or KlenTherm ). In vitro mutagenesis Tth inorganic pyrophosphatase provides increased fidelity. CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme which is required to convert 1 µmole of pyrophosphate into 2 µmoles of orthophosphate in one minute at 75ºC under the following conditions: 1 mm K 4 P 2 O 7,2 mm MgCl 2, 50 mm Tris-HCl ph 9.0 (at 75ºC). STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store at -20 C in a constant temperature freezer. QUALITY CONTROL TEST ATP-ase and P-Klen are not detectable. COMPANION PRODUCTS KlenThermase, KlenThermaseN GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

35 SEQUENCING AND PYROPHOSPHATASE SEQUENCE-SPECIFIC PYROPHOSPHOROLYSIS CAN RESULT IN SEQUENCING ARTIFACTS. PYRO- PHOSPHATASE CAN PREVENT THIS. 35 In dideoxy-sequencing DNA synthesis is initiated at a unique priming site and terminated by the incorporation of dideoxynucleoside monophosphates. Tabor and Richardson noted that, under certain conditions, the intensities of some of the bands on resulting sequencing gels can be weak. This phenomenon is particularly apparent when the reactions are run for 30 minutes or longer and when ditp is used in place of dgtp. These weak bands are the result of pyrophosphoroly- sis. This is the reversal of the polymerisation reaction catalysed by the DNA polymerase wherein DNA and pyrophosphate (PPi) react to form a deoxynucleosidetriphosphate, leaving the DNA chain one base shorter. Pyrophosphorolysis can be prevented using inorganic pyrophosphatase to hydrolyse the pyrophosphate. The pyrophosphorolysis of terminated chains during DNA sequencing can be summarized as follows: Pyrophosphatase 2Pi PPi ddntp 5 ddn 5 dn terminated chain extendible chain All known DNA polymerases catalyse the templatedependent incorporation of a deoxynucleotide onto the 3' hydroxyl terminus of a primer, with the release of inorganic pyrophosphate. Catalysis requires the presence of a bivalent cation, either Mg 2+ or Mn 2+. Under the conditions normally used for DNA synthesis (i.e. high dntp concentrations and low pyrophosphate concentration), the forward reaction (polymerization) is greatly favoured over the reverse reaction (pyrophosphorolysis). Many DNA polymerases also catalyse the hydrolysis of nucleotides from the 3' terminus of DNA through a seperate exonuclease activity. This reaction is unlike pyrophosphorolysis because the substrate is H 2 O and the product is a nucleoside monophosphate. REFERENCES 1 Tabor S. and Richardson C DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84: Tabor S. and Richardson C DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Effect of pyrophosphorolysis and metal ions. J. Biol. Chem.265:

36 36 AccuTherm DNA POLYMERASE AccuTherm is a thermostable enzyme possessing 5'-3' DNA polymerase and 3'-5' proof reading exonuclease activities. It is isolated from the hyperthermophilic marine archae Pyrococcus furiosis (Pfu). Accu- Therm provides extremely high fidelity. Whereas the enzyme is not able to amplify long fragments as efficiently as BioTherm or KlenTherm because of its very high exonuclease activity, a mixture of either KlenTherm or BioTherm with AccuTherm provides more robust synthesis of longer amplification products (Barnes, Proc. Natl. Acad. Sci. USA 91: ). AccuTherm ist ein hitzestabiles Enzym, das eine 5-3 -DNA-Polymerase- und eine 3-5 -proof-reading-exonuklease-aktivität besitzt. Diese Polymerase ist aus dem hyperthermophilen, marinen Archaebakterium Pyrococcus furiosis (Pfu) isoliert worden. AccuTherm zeigt eine extrem hohe Genauigkeit. Man muß jedoch sagen, dass AccuTherm aufgrund seiner sehr hohen Exonuklease-Aktivität lange DNA-Fragmente nicht so effizient amplifiziert wie BioTherm oder Klen- Therm. Die Mischung von entweder BioTherm oder KlenTherm mit AccuTherm zeigt jedoch wieder eine sehr stabile Synthese auch längerer DNA- Fragmente (Barnes, 1994; Proc.Natl.Acad.Sci. USA 91: ). CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72 C under the assay conditions (25 mm TAPS (tris-(hydroxymethyl)methyl-amino-propanesulphonic acid, sodium salt) ph 9.3 (at 25 C), 50 mm KCI, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCI, 0.5 mm EDTA; 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store AccuTherm polymerase below 0 C, preferably at -20 C, in a constant temperature freezer. 5X REACTION BUFFER 350 Tris-HCl ph 8,8; 83 mm (NH) 4 SO 4, 100 mm KCl 22 mm MgCl 2 0,75% Triton X100 COMPANION PRODUCTS Synergy DNA polymerase, SynergyN DNA polymerase GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

37 Comparison of some thermostable DNA polymerases ACCURACY OF THERMOSTABLE DNA POLYMERASES Accuracy (Nucleotides) BioTherm NeoTherm SupraTherm Synergy SynergyN SynergyT AccuTherm PROCESSIVITY OF THERMOSTABLE DNA POLYMERASES ON GENOMIC- AND λ-dna SynergyPlus SynergyN Synergy BioTherm NeoTherm SupraTherm AccuTherm genomic DNA λ DNA Processivity (kb)

38 38 Synergy DNA POLYMERASE Synergy is a mix of thermostable components possesssing 5'-3' DNA polymerase activivity (KlenTherm ) and 3'-5' proof-reading activity (AccuTherm ). These components are optimized to achieve amplification of 35 kb or 10 kb products from lambda templates or genomic DNA, respectively. A mixture of KlenTherm with AccuTherm provides more robust synthesis of longer amplification products (Barnes, Proc. Natl. Acad. Sci. USA 91: ). Synergy ist ein Mix hitzestabiler Komponenten, welcher eine 5-3 -DNA-Polymerase-Aktivität (KlenTherm ) und eine 3-5 -proof-reading-aktivität (AccuTherm ) beinhaltet. Diese Komponenten sind für die Synthese von 35 kb oder 10 kb großen Produkten anhand von Lambda-Templates bzw. genomischer DNA optimiert worden. Diese Mischung zeigt eine besonders stabile Synthese längerer Amplifikations-Produkte (Barnes, 1994; Proc.Natl.Acad.Sci. USA 91: ). CONCENTRATION 10 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72 C under the assay conditions (25 mm TAPS (tris-(hydroxymethyl)-methyl-aminopropanesulfonic acid, sodium salt) ph 9.3 (at 25 C), 50 mm KCI, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7,0; 100 mm NaCI; 0,5 mm EDTA; 1 mm DTT; 0,01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store Synergy DNA polymerase below 0 C, preferably at -20 C, in a constant temperature freezer. 10X REACTION BUFFER 160 mm (NH) 4 SO 4, 670 mm Tris-HCl ph 9,1; 8 % Glycerol, 2 % DMSO, 35 mm MgCl 2 Please note the difference between Synergy and BioTherm reaction buffers. COMPANION PRODUCTS SynergyN DNA polymerase, AccuTherm DNA polymerase. TYPICAL REACTION CONDITIONS 10x Synergy reaction buffer 3 µl 10 mm dntp mix 2 µl DNA template 2 µl primer mix 1 µl Synergy DNA polymerase 0.5 µl H 2 O 21,5µl 58 C 30 sec 72 C 15 min 93 C 30 sec 30 cycles Total 30 µl GC GC GC GC GC u 250 u 500 u u u

39 SynergyN DNA POLYMERASE SynergyN is a mix of thermostable polymerases possessing 5'-3' DNA polymerase activity that is optimized to amplify longer GC-rich fragments (Klen- ThermN ) and 3'-5' proof-reading activity (Accu- Therm ). These components are optimized to achieve amplification of 15 kb products from genomic DNA. A mixture of KlenThermN with AccuTherm provides more robust synthesis of longer GC-rich amplification products. SynergyN ist eine Mischung hitzestabiler DNA-Polymerasen, welche zum einen eine 5-3 -DNA-Polymerase-Aktivität beinhaltet (KlenThermN ), die optimiert wurde, um lange, GC-reiche Fragmente zu amplifizieren. Zum anderen zeigt SynergyN eine 3-5 -proofreading-aktivität (AccuTherm ). Diese Komponenten sind optimal um 15 kb große Fragmente anhand genomischer DNA zu erhalten. Eine Mischung von Klen- ThermN mit AccuTherm zeigt außerdem eine stabilere Synthese längerer, GC-reicher Fragmente. 39 CONCENTRATION 10 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72 C under the assay conditions (25 mm TAPS (tris-(hydroxymethyl)-methyl-aminopropanesulfonic acid, sodium salt) ph 9.3 (at 25 C), 50 mm KCI, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCI, 0.5 mm EDTA; 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store SynergyN DNA polymerase below 0 C, preferably at -20 C, in a constant temperature freezer. 10X REACTION BUFFER 160 mm (NH) 4 SO 4, 670 mm Tris-HCl ph 9,1; 8 % Glycerol, 2 % DMSO, 35 mm MgCl 2 Please note the difference between SynergyN and BioTherm reaction buffers. COMPANION PRODUCTS Synergy DNA polymerase, dntps GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

40 40 SynergyT DNA POLYMERASE Synergy mixture with addition of TthPlus DNA polymerase especially suited for low specificity PCR with degenerated primers. APPLICATIONS Low specificity PCR for degenerated primers CONCENTRATION 10 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72 C under the assay conditions (25 mm TAPS (tris-(hydroxymethyl)methyl-aminopropanesulphonic acid, sodium salt) ph 9.3 (at 25 C), 50 mm KCI, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) Dieses Produkt entspricht Synergy mit dem Zusatz einer TthPlus DNA-Polymerase, welche sich besonders für PCR-Reaktionen mit niedriger Spezifität und fehlerhaften Primern eignet. STORAGE TEMPERATURE Store SynergyT DNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 10X REACTION BUFFER 160 mm (NH) 4 SO 4, 670 mm Tris-HCl ph 9,1; 8 % Glycerol, 2 % DMSO, 35 mm MgCl 2 Please note the difference between SynergyT and BioTherm reaction buffers. QUALITY CONTROL Activity, SDS-PAGE purity, absence of endonucleases/ nickases and exonucleases. REFERENCE Barnes W.M PCR amplification of up to 35-kb DNA with high fidelity and high yield from bacteriophage templates. Proc. Natl. Acad. Sci. USA 91: COMPARISON OF Synergy AND SynergyT UNDER Elektrophorese in 1,5% agarose gel of PCR products obtained by detection of LTR in human locus 7p22.3 and higher primates. The presence of LTR in this locus was detected by a PCR product of 1831 bp using either Synergy or SynergyT. As templates were used DNA from human(1), chimpanzee(2), gorilla(3), orang-utan(4) and gibbon(5). SPECIAL REACTION CONDITIONS Synergy SynergyT 1831 bp M M GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

41 SynergyPlus DNA POLYMERASE Taq-based mixture with addition of pyrophosphatase for the amplification of long fragments. SynergyPlus DNA polymerase can amplify up to 20 kb from genomic DNA. Dies ist eine Mischung von Taq-Polymerasen mit dem Zusatz einer Pyrophosphatase zur Amplifikation langer Fragmente. SynergyPlus DNA-Polymerase amplifiziert bis zu 20 kb lange Fragmente anhand genomischer DNA. 41 APPLICATIONS Very Long and accurate PCR CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72 C under the assay conditions (25 mm TAPS (tris-(hydroxymethyl)methyl-aminopropanesulphonic acid, sodium salt) ph 9.3 (at 25 C), 50 mm KCI, 2 mm MgCl 2, 1 mm ß-mercaptoethanol) and activated calf thymus DNA as substrate. 10 mm K-phosphate buffer ph 7.0, 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store SynergyPlus DNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 10X REACTION BUFFER 160 mm (NH) 4 SO 4, 670 mm Tris-HCl ph 9,1; 8 % Glycerol, 2 % DMSO, 35 mm MgCl 2 Please note the difference between SynergyPlus and BioTherm reaction buffers. QUALITY CONTROL Activity, SDS-PAGE purity, absence of endonucleases/ nickases and exonucleases. REFERENCE Barnes W.M PCR amplification of up to 35-kb DNA with high fidelity and high yield from bacteriophage templates. Proc. Natl. Acad. Sci. USA 91: GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

42 42 TthPlus DNA POLYMERASE TthPlus DNA polymerase is isolated from the Thermus thermophilus strain. TthPlus DNA polymerase is a single 92 kda polypeptide showing a 5'-3' exonuclease activity but lacking 3'-5' exonuclease activity. It catalyzes the polymerization of nucleotides into double-stranded DNA in the presence of MgCl 2. Its efficiancy has been shown more particularly on large DNA fragments up to 12 kb (using lambda phage DNA as a template). TthPlus DNA polymerase is also capable of catalyzing the polymerization of DNA using a RNA template in the presence of MnCl 2. The ability of TthPlus DNA polymerase to reverse transcribe at elevated temperatures (70 C) minimizes the problems encountered with strong secondary structures in RNA since they are unstable at higher reaction temperatures. Higher temperatures also result in increased specificy of primer hybridization and extension. In coupled RT/PCR assays, TthPlus is about times more efficient than Taq DNA polymerase. TthPlus DNA polymerase is delivered with 10x RTbuffer, 5x amplification-buffer and separate MnCl 2 (25 mm) and MgCl 2 (50 mm) solutions. The 5x amplification-buffer contains EGTA, which binds/neutalizes Mn 2+ from the RT-reaction. Therefore after RT it is not necessary to change the buffers. For subsequent amplification we recommend to use BioTherm or KlenTherm DNA polymerase. FEATURES thermostable DNA polymerase activity in the presence of MgCl 2 reverse transcriptase activity in the presence of MnCl 2 reverse transcription at elevated temperature minimising secondary structure problems CONCENTRATION 5 units/µl STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0 (25 C), 100 mm NaCl, 0.5 mm EDTA, 1 mm DTT, 50% glycerol (v/v), 0,1 mg/ml BSA TthPlus DNA-Polymerase ist aus dem Stamm Thermus thermophilus isoliert worden. TthPlus ist ein einzelnes 92 kda großes Polypeptid mit einer 5-3 -Exonuklease-Aktivität, jedoch ohne eine 3-5 -Exonuklease- Aktivität. Das Enzym katalysiert die Polymerisation von Nukleotiden in doppelsträngige DNA in Anwesenheit von MgCl 2. Die Effizienz dieser Polymerase zeigt sich insbesondere bei langen DNA-Fragmenten bis zu 12 kb (unter Verwendung einer Lambda-Phagen-DNA als Template). TthPlus DNA-Polymerase ist ebenso dazu geeignet die Polymerisation von DNA mit Hilfe eines RNA-Templates in Anwesenheit von MnCl 2 zu katalysieren. Die Fähigkeit der TthPlus auch bei höheren Temperaturen (70 C) ihre Reverse Transkriptase-Aktivität zu behalten, minimiert die Probleme mit ausgeprägten Sekundärstrukturen in RNA-Molekülen, da diese bei diesen hohen Temperaturen nicht stabil sind. Höhere Temperaturen erhöhen außerdem noch die Spezifität der Primerbindung und -verlängerung. In gekoppelten RT-PCR-Reaktionen ist die TthPlusT zudem ungefähr mal effizienter als eine Taq-Polymerase. TthPlus DNA-Polymerase wird mit 10x RT-Puffer, 5x Amplifikations-Puffer und separatem MnCl 2 (25 mm) und MgCl 2 (50 mm) geliefert. Der 5x Amplifikations- Puffer enthält EGTA, welches Mn 2+ aus der RT-Reaktion bindet und damit neutralisiert. Daher ist es nach der RT- Reaktion nicht nötig den Puffer zu wechseln. Für nachfolgende Amplifikationen empfehlen wir BioTherm oder KlenTherm DNA-Polymerase. UNIT DEFINITION One unit is defined as the amount of enzyme that incorporates 10 nmoles of dntps into acid-insoluble form in 30 minutes at 72 C under the following reaction conditions: 25 mm TAPS buffer (Tris-(hydroxymethyl)-methyl-amino-propanesulfonic acid, sodium salt) ph 9.3 (25 C), 50 mm KCl, 2 mm MgCl 2, 1 mm ß-mercaptoethanol, 200 µm dntps and 10 µg of calf thymus DNA in a final reaction volume of 50 µl. STORAGE TEMPERATURE Store TthPlus TM DNA polymerase, preferably at -20 C, in a constant temperature freezer.

43 TthPlus DNA POLYMERASE 10x RT BUFFER 670 mm Tris-HCl ph 8.8 (25 C), 166 mm (NH 4 ) 2 SO 4, 0.1% Tween 20 VARIOUS CONDITIONS FOR RT-PCR Two different buffer systems can be used for RT-PCR with TthPlus DNA polymerase. The first system for Tth DNA polymerase consists of 4 buffers: 1. reverse transcription (RT) buffer, 2. PCR (amplification buffer), 3. MnCl 2, (supplement for RT buffer) 4. MgCl 2 (supplement for PCR buffer). The reaction has to be carried out in two steps: RT and PCR in two different vials. The second buffer system is a so-called one-tube buffer (10x) for one-step RT-PCR. Both reactions (RT and PCR) are carried out in the same buffer and the same vial. The one tube buffer does not contain Mn(OAc). Mn(OAc) is provided extra and have to be added to the one-tube buffer before the experiment. The protocol to use our TthPlus DNA polymerase is described in one-tube buffer below (buffer and polymerase concentrations and cycle conditiones). It was worked out for real-time RT-PCR by our customer Roboscreen GmbH. 5x AMPLIFICATION BUFFER 335 mm Tris-HCl ph 8.8 (25 C), 83 mm (NH 4 ) 2 SO 4, 3.75 mm EGTA, 25% glycerol (v/v), 0.1% Tween 20 EXTRA SOLUTIONS 25 mm MnCl 2 50 mm MgCl 2 The optimal experimental conditions depend on the system used and they should be individually determined. The Mg 2+ or Mn 2+ concentrations and the enzyme amount are the limiting factors for an accurate result. Traditionally 5 units of enzyme and a MnCl 2 concentration of 1 mm are used for the reverse transcription in a final 50 µl reaction volume. For the amplification MgCl 2 concentration of 1.5 mm are used for a final reaction volume of 50 µl. 10X ONE-TUBE BUFFER 500 mm bicine-koh ph 8,3; 1 M KOAc ph 7,5 30% glycerol (v/v); EXTRA SOLUTION 50 mm Mn(OAc) 2 COMPANION PRODUCTS GeneScript reverse transcriptase, BioTherm DNA polymerase, KlenTherm DNA Polymerase, dntps REFERENCES 1 Ruttiman C. Cotara S.M., Zaldivar J. and Vicuna R. (1985) DNA polymerase from the extremly thermophylic bacterium Thermus thermophilus HB- 8. Eur. J. Biochemistry, 149, Myers T.W. and Gelfand D.H. (1991)Reverse transcription and DNA amplification by a Thermus thermo-philus DNA polymerase. Biochemistry, 30, GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

44 Comparison of sensitivity of RT-PCR with TthPlus DNA polymerase and MMLV-RT 44 MW WB A A) MMLV-RT 100 u/µl, Taq-pol. 5 u/µl B B) TthPlus 5 u/µl MW - molecular weight markers (530 bp) 1 - RNA 1 µg 6 - RNA 10-5 µg 2 - RNA 10-1 µg 7 - RNA 10-6 µg 3 - RNA 10-2 µg 8 - RNA 10-7 µg 4 - RNA 10-3 µg 9 - RNA 10-8 µg 5 - RNA 10-4 µg WB - water blank Comparison of RT-PCR with TthPlus DNA polymerase and MMLV-RT in 16S-rRNA system MW WB 1100 bp MW - molecular weight marker (λ PstI) 1 - MMLV RT (100 u), RNA 1 µg 5 - TthPlus (5 u), RNA 10-2 µg 2 - MMLV RT + HS 21-9, RNA 1 µg 6 - TthPlus (5 u), RNA 10-3 µg 3 - TthPlus (5 u), RNA 1 µg 7 - TthPlus (5 u), RNA 10-4 µg 4 - TthPlus (5 u), RNA 10-1 µg WB - water blank

45 Quantification of HCV Control RNA using two different Tth DNA Polymerases EXPERIMENTAL PROTOCOL Material HCV Control crna (10,000,000; 1,000,000; 100,000; 10,000; 1,000; 100; 50; and 10 molecules per 8- well Control strip [8 tubes/strip or 0.1 ml tubes, respectively]), Lot 008 rtth DNA Polymerase, 2.5 U/µl (Applied Biosystems; supplier ABI) plus: 5x EZ-buffer (Roboscreen) Mn-acetate-solution, 25 mm (Roboscreen) TthPlus DNA Polymerase, 5 U/µl (supplier Genecraft) plus: 10x One-Tube RT-PCR-buffer (supplier Genecraft) Mn-acetate-solution, 50 mm (supplier Genecraft) Instruments ABI PRISM 7000 Sequence Detection System (Applied Biosystems) Rotor-Gene 2000 (Corbett Research) RESULTS Saturation curves Enzyme rtth DNA Polymerase (Applied Biosystems, supplier ABI); instrument: 7000SDS REACTION CONDITIONS (BOTH INSTRUMENTS) Reaction component 10x/5x buffer Mn-acetate solution Nucleotide mix Forward and reverse primer TaqMan probe (FAM/TAMRA) Tth DNA Polymerase CYCLER PROGRAM Final concentration (25 µl-assay) 1x 3.5 mm 0.3 mm datp, dctp and dgtp, 0.6 mm dutp 7.5 pmol each 3.4 pmol 1.5 U Rotor-Gene RT Hold Cycle Hold Temperature ( C) Time (min:s) Cycles 60 10:00 00:15 01: SDS RT Hold Cycle Hold shut off 9600 emulation (window instrument ) Temperature ( C) Time (min:s) Cycles 60 10:00 00:30 01:

46 Quantification of HCV Control RNA using two different Tth DNA Polymerases Enzyme TthPlus DNA Polymerase (supplier Genecraft); instrument: 7000SDS 46 Enzyme rtth DNA Polymerase (Applied Biosystems, supplier ABI); instrument: Rotor-Gene Enzyme TthPlus DNA Polymerase (supplier Genecraft); instrument: Rotor-Gene

47 Quantification of HCV Control RNA using two different Tth DNA Polymerases REFERENCE CURVES 47 Molecules reference RNA per assay Instrument 7000SDS RG, 0,1 ml Enzyme supplier ABI supplier GC supplier ABI supplier GC Tube No. Molecules _HCV_ _HCV_ _HCV_2RG _HCV_2RG per tube ,55 15,04 16,83 14, ,08 18,85 20,43 17, ,16 22,48 23,94 21, ,56 25,35 27,27 25, ,77 28,97 30,61 29, ,34 32,59 33,72 32, ,4 33,05 34,52 33, ,31 35,89 37,21 36,15 SUMMARY The use of the TthPlus DNA Polymerase (supplier Genecraft) improved the sensitivity of the HCV RNA quantification significantly.

48 GeneScript REVERSE TRANSCRIPTASE 48 SOURCE E.coli strain that carries a plasmid with the cloned and modified M-MuLVRT gene with deleted RNAseH coding part. Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase is a RNA-dependent DNA polymerase. This enzyme can synthesize a complementary DNA strand initiating from a primer using either singlestranded RNA or DNA template. The enzyme lacks RNaseH activity. Moloney Murine Leukemia Virus (M-MuLV) Reverse Transkriptase ist eine RNA-abhängige DNA-Polymerase. Das Enzym synthetisiert einen komplementären DNA-Strang ausgehend von einem Primer, der entweder einzelsträngige RNA oder DNA als Template benutzt. Das Enzym besitzt keine RNaseH-Aktivität. CONCENTRATION 100 units/µl UNIT DEFINITION One unit is the amount of enzyme required to incorporate 1 nmol of dttp into an acid insoluble form in 10 minutes at 37ºC using poly(ra)-oligo(dt) as template primer. STORAGE BUFFER 50 mm Tris-HCl ph 8.3, 1 mm EDTA, 0.1 mm DTT, 0.1 mm NaCI, 0.1% Triton X-100, 50% glycerol 5X REACTION BUFFER 250 mm Tris-HCI ph 8.3, 15 mm MgCl 2, 400 mm KCl Add to buffer: dntps (end concentration 2 mm), MnCl 2 (end concentration 2-4 mm) and DTT (end concentration 10 mm). Incubate at 37ºC. EXTRA SOLUTIONS 25 mm MnCl mm DTT UNIT ASSAY CONDITIONS 20 mm Tris-HCI ph 8.0, 2 mm MnCl 2, 100 mm KCl, 1 mm DTT, 0.6 mm poly ra, 0.1 mm poly(dt)10-20; 0.5 mm dttp( 3 H) units of enzyme QUALITY ASSURANCE GeneScript reverse transcriptase is tested for its ability to synthesize full length cdna from 4kb RNA. RT-PCR using GeneScript reverse transcriptase PROTOCOL Set up a 20 µl reaction mixture as follows: total RNA 2-5 µg; RT-buffer; primer; 1 mm each dntp; optional: 1 U/µl RNasin incubate at 70 C for 2 min, chill to 23 C to anneal primer to RNA add 200 units GeneScript and incubate 10 min at 23 C followed by 30 min at 42 C optional: incubate with RNaseH heat the reaction at 95 C for 5 min and chill on ice Store the RT-reaction by -20 C and use 2 µl for subsequent PCR. The addition of 2 mm MnCl 2 in the 1x RT buffer is optional. GC GC GC GC GC u 1000 u 5000 u u u

49 RNase-Inhibitor Native RNase-Inhibitor from human placenta exerts its inhibitory effect by binding non-covalently to RNases in a 1:1 ratio with an association constant of It is a protein with molecular weight of 51 kda and inhibits common eukaryotic RNases including RNase A, RNase B, RNase C. It does not inhibit RNase H, S1 Nuclease, SP6, T7 or T3 RNA polymerase, AMV or M-MLV Reverse Transcriptase, Taq DNA polymerase and RNase T1. The enzyme is active over a broad ph range between 5 and 8, with a maximum activity at ph 7-8. Dieser native RNase-Inhibitor aus der menschlichen Plazenta übt seinen hemmenden Effekt aus, indem er in einem 1:1 Verhältnis und einer Asoziations-Konstante von 1014 eine nicht-kovalente Bindung zu RNasen ausbildet. Das Protein besitzt ein Molekulargewicht von 51 kda und inhibiert alle herkömmlichen eukaryotischen RNasen einschließlich RNaseA, RNaseB, RNaseC. Allerdings hemmt es folgende Enzyme nicht: RNaseH, S1 Nuklease, SP6, T7 oder T3 RNA- Polymerase, AMV oder M-MLV Reverse Transkriptase, Taq-DNA-Polymerase und RNase T1. Dieser RNase-Inhibitor behält seine Aktivität über einen weiten ph-bereich, der zwischen 5 und 8 liegt, mit einer maximalen Aktivität bei ph APPLICATION Any application where eukaryotic RNase contamination is a potential problem RNA transcription In vitro RNA translation cdna synthesis DNA and RNA sequencing RT-PCR CONCENTRATION 10 units/µl UNIT DEFINITION One unit inhibits 5 ng of RNase A by 50% using cytidine 2',3'-cyclic monophosphate (ccmp) as a substrat. STORAGE BUFFER 20 mm Hepes-KOH, 50 mm KCl, 8 mm DTT, 50% glycerol STORAGE TEMPERATURE -20 C QUALITY CONTROL Activity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases. REFERENCE Blackburn, P. (1979) J. Biol. Chem. 254:12484 GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

50 50 KLENOW FRAGMENT Klenow fragment is a DNA-dependent polymerase with 3'-5' exonuclease activity. It lacks 5'-3' exonuclease activity of the native enzyme and is suited for random-primed labelling of DNA with random oligonucleotides and for filling-in of 5' protruding ends to blunt-ends. Klenow Fragment ist eine DNA-abhängige Polymerase mit einer 3-5 -Exonuklease-Aktivität. Dem nativen Enzym fehlt eine 5-3 -Exonuklease-Aktivität und ist für Amplifikationen mit willkürlich gewähltem Primer und Oligonukleotiden, sowie für das Auffüllen von hervorstehenden 5 -Enden zu Blunt-Ends geeignet. CONCENTRATION 5 units/µl UNIT DEFINITION One unit is the amount of enzyme that incorporates 10 nmoles of deoxynucleotides into acid-insoluble form in 30 minutes at 37ºC. STORAGE BUFFER 20 mm Tris-HCl ph 7.5, 100 mm NaCl, 0.1 mm EDTA, 2 mm DTT, 0.1 mg/ml BSA; 50% glycerol (v/v) STORAGE TEMPERATURE Store Klenow Enzyme below 0ºC, preferably at -20ºC, in a constant temperature freezer. 10X REACTION BUFFER 100 mm Tris-HCl ph 7.5, 100 mm MgCl 2, 10 mm DTE (= buffer L for restriction endonucleases!) COMPANION PRODUCTS T4 DNA Ligase, dntp GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

51 T4 POLYNUCLEOTIDE KINASE Isolated from a recombinant E. coli strain this enzyme catalyzes the transfer of the terminal phosphate group of ATP to 5'-OH ends of DNA. T4 polynucleotide kinase is suited for labelling of 5'-OH ends of DNA with γ 32 P-ATP. Dieses aus einem rekombinanten E. coli-stamm isolierte Enzym katalysiert den Transfer der terminalen Phosphat-Gruppe von ATP an das 5 -OH-Ende der DNA. Die T4 Polynukleotid-Kinase ist ebenfalls dazu geeignet an das 5 -OH-Ende der DNA γ 32 P-ATP anzuhängen 51 CONCENTRATION 10 units/µl UNIT DEFINITION One unit is the amount of enzyme that incorporates 1 nmol of acid-insoluble 32 P in 30 minutes at 37ºC. STORAGE BUFFER 10 mm K-phosphate buffer ph 7.0; 100 mm NaCl; 0.5 mm EDTA; 1 mm DTT; 0.01% Tween 20; 50% glycerol (v/v) STORAGE TEMPERATURE Store T4 polynucleotide kinase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 5X REACTION BUFFER 350 mm Tris-HCl ph 7,6; 50 mm MgCl 2 ; 25 mm DTT GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

52 52 T4 DNA LIGASE T4 DNA ligase is isolated from a recombinant E. coli strain and is suitable for ligation of sticky- and blunt ended DNA fragments. T4 DNA-Ligase ist aus einem rekombinanten E. coli Stamm isoliert worden und für die Ligation von DNA- Fragmenten mit sowohl sticky- als auch blunt-ends geeignet. CONCENTRATION 10 Weiss units/µl UNIT DEFINITION One unit (Weiss unit) is the amount of enzyme that catalyses the conversation of one nanomol 32 P-ATP in 20 minutes at 37ºC. 1 ligation unit = 0,015 Weiss unit. STORAGE BUFFER 20 mm Tris-HCI buffer ph 7.5; 100 mm NaCI; 0.1 mm EDTA; 2 mm DTT; 0.1 mg/ml BSA; 50% glycerol (v/v) STORAGE TEMPERATURE Store T4 DNA ligase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 10X REACTION BUFFER 660 mm Tris-HCI ph 7.5; 50 mm MgCI2; 10 mm DTE; 10 mm ATP REACTION CONDITION optimal ligation occurs at 15ºC efficiency of T4 DNA ligase lane 1: λ DNA BstEII marker lane 2: 2 Weiss units of ligase lane 3: 0.2 Weiss units of ligase lane 4: 0.02 Weiss units of ligase lane 5: no ligase added lane 6: λ DNA BstEII marker 0.8 µg of pbs digested with Hind III were incubated overnight at +15ºC with indicated amounts of ligase. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

53 Tth DNA LIGASE Thermus thermophilus DNA ligase (recombinant form of the enzyme; cloned from strain HB27) catalyses the formation of a phosphodiester bond between the 5`phosphate and 3`-hydroxil groups of adjacent nucleotides which are hybridized to a complementary target DNA. The ligation will occur only if the oligonucleotides are perfectly paired to the complementary target DNA and have no gaps between them. There fore, a single-base substitution can be detected. Thermus thermophilus DNA Ligase (rekombinante Form des Enzyms; kloniert aus dem Stamm HB27) katalysiert die Bildung von Phosphodiester-Bindungen zwischen dem 5 -Phosphat-Ende und der 3 -Hydroxil- Gruppe benachbarter Nukleotide, welche mit einem komplementären Strang der Ziel-DNA hybridisieren. Die Ligation kann jedoch nur erfolgreich sein, wenn die Oligonukleotide vollkommen an den komplementären DNA-Strang gebunden sind und keine Lücken zwischen den Nukleotiden bestehen. Auf diese Weise kann der Austausch einzelner Basen ermittelt werden. 53 APPLICATION LCR DNA ligation CONCENTRATION 5 units/µl UNIT DEFINITION One unit is defined as the amount of the enzyme required to give 50% (cohesive end unit) ligation of the 12-base pair cohesive ends of 1 µg of BstE II-digested λ DNA in 15 minutes at 45 C in a total reaction volume of 50 µl. One cohesive end ligation unit equals 0,015 Weiss units. STORAGE BUFFER 10 mm Tris-HCl ph 7.5; 50 mm KCl; 0.1 mm EDTA; 1 mm DTT; 0.2% Triton X-100; 50% glycerol STORAGE TEMPERATURE -20 C 10X REACTION BUFFER 200 mm Tris-HCl ph 7.6; 250 mm KCl; 100 mm MgCl 2, 100 mm DTT; 10 mm NAD, 1% Triton X-100 Optimal ligation occurs at 45 C. QUALITY CONTROL Activity, SDS-PAGE purity, absence of RNases, ssdnases, endonucleases and phosphatases. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

54 SP6 RNA POLYMERASE 54 Isolated from a recombinant E. coli strain this DNAdependent RNA polymerase is strictly specific for its promoter. It is used to transcribe RNA from DNA templates, cloned into vectors containing SP6 promoter. CONCENTRATION 60 units/µl UNIT DEFINITION One unit is the amount of enzyme that incorporates 1 nmol of labelled nucleoside triphosphates into acidprecipitable RNA in 60 minutes at 37ºC. STORAGE BUFFER 20 mm Tris-HCl ph 7.5; 100 mm NaCl; 0,1 mm EDTA; 2 mm DTT; 0,1 mg/ml BSA; 50% glycerol (v/v) Diese DNA-abhängige RNA-Polymerase ist aus einem rekombinanten E. coli Stamm isoliert worden und absolut spezifisch für den eigenen Promoter. Das Enzym wird verwendet, um RNA von DNA-Templates zu transkribieren, welche in Vektoren kloniert wurden, die den SP6-Promoter enthalten. STORAGE TEMPERATURE Store SP6 RNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 5X REACTION BUFFER 200 mm Tris-HCl ph 7.9; 30 mm MgCl 2 ; 50 mm DTT GC GC GC GC GC u 3000 u 5000 u u u T7 RNA POLYMERASE Isolated from a recombinant E. coli strain this DNAdependent RNA polymerase is strictly specific for its promoter. It is used to transcribe RNA from DNA templates, cloned into vectors containing T7 promoter. Diese DNA-abhängige RNA-Polymerase ist aus einem rekombinanten E. coli Stamm isoliert worden und absolut spezifisch für den eigenen Promoter. Das Enzym wird verwendet, um RNA von DNA-Templates zu transkribieren, welche in Vektoren kloniert wurden, die den T7-Promoter enthalten. CONCENTRATION 60 units/µl UNIT DEFINITION One unit is the amount of enzyme that incorporates 1 nmol of labelled nucleoside triphosphates into acidprecipitable RNA in 60 minutes at 37ºC. STORAGE TEMPERATURE Store T7 RNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer. 5X REACTION BUFFER 200 mm Tris-HCl ph 7.9; 30 mm MgCl 2 ; 50 mm DTT STORAGE BUFFER 20 mm Tris-HCl ph 7.5; 100 mm NaCl; 0,1 mm EDTA; 2 mm DTT; 0,1 mg/ml BSA; 50% glycerol (v/v) GC GC GC GC GC u 3000 u 5000 u u u

55 RESTRICTION ENDONUCLEASES GeneCraft offers most restriction enzymes from pbs polylinker. Reaction buffers are supplied together with enzymes free of charge. GeneCraft bietet die meisten Restriktionsenzyme des pbs polylinker an. Die jeweiligen Reaktions-Puffer werden zu den Enzymen kostenlos mitgeliefert. 55 UNIT DEFINITION & CONCENTRATION One unit of the enzyme is the amount required to hydrolyze 1 µg of DNA in 1 hour in a total reaction volume of 50 µl. Most restriction enzymes are normallly delivered at the concentration of 20 units/µl. STORAGE BUFFER 20 mm Tris-HCI ph 7.5; 100 mm NaCI; 0.1 mm EDTA; 2 mm DTT; 0.1 mg/ml BSA; 50% glycerol (v/v) STORAGE TEMPERATURE Store restriction enzymes below 0 C, preferably at -20 C, in a constant temperature freezer. A B L M H Tris-Acetat 330 mm Tris-HCl 100 mm 100 mm 100 mm 100 mm ph at 37 C Mg-(Acetat) mm MgCl 2 50 mm 100 mm 100 mm 100 mm K-Acetat 660 mm NaCl 1 M 500 mm 1 M Dithioerythriol (DTE) 10 mm 10 mm 10 mm Dithiothreitol (DTT) 5 mm 10 mm ß-Mercaptoethanol 10 mm

56 GeneCraft Schnittmuster activity [%] in buffer optimal heat in- Cat. No. restriction 5 -> 3 reaction activable enzyme 3 -> 5 A B L M H temp. 20 at 56 GC-RE-017 Acs I R/AATTY C YTTAA/R GC-RE-001 Alu I AC/GT C 65 C AC/GT GC-RE-018 Apa I GGGCC/C C 65 C C/CCGGG GC-RE-043 AspLE I GCG/C C 65 C C/GCG GC-RE-044 AsuNH I G/CTAGC C 65 C GCTAG/C GC-RE-002 Bam H I G/GATCC C 80 C CCTAG/G GC-RE-003 Bgl I GCCNNNN/NGGC C 65 C CGGN/NNNNCCG GC-RE-057 Bgl II A/GATCT C 80 C - NO TCTAG/A GC-RE-056 Bsc4 I CCNNNNN/NNGG C GGNN/NNNNNCC GC-RE-039 Bse21 I CC/TNAGG C GGANT/CC GC-RE-019 Bsp19 I C/CATGG C 65 C GGTAC/C GC-RE-048 BstH2 I RGCGC/Y C 80 C - NO Y/CGCGR GC-RE-049 BstHP I GTT/AAC C 65 C CAA/TTG GC-RE-020 BsuR I GG/CC CC/GG C CC/GG GC-RE-052 Btr I CAC/GTC C 80 C GTG/CAG GC-RE-036 CciN I GC/GGCCGC C 65 C CGCCGG/CG GC-RE-004 Cla I AT/CGAT C 65 C TAGC/TA GC-RE-026 Dra I TTT/AAA C 65 C AAA/TTT GC-RE-005 EcoR I G/AATTC C 65 C CTTAA/G GC-RE-028 EcoR V GAT/ATC C 80 C CTA/TAG GC-RE-047 Erh I C/CWWGG C 65 C GGWWC/C GC-RE-058 FauND I CA/TATG C GTAT/AC GC-RE-027 Fok I GGATG (9/13) C 65 C CCTAC GC-RE-006 Hae III GG/CC C 80 C CC/GG GC-RE-007 Hind III A/AGCTT C 65 C TTCGA/A GC-RE-038 Hinf I G/ANTC C 80 C CTNA/G GC-RE-041 Hpa II C/CGG C 80 C - NO GGC/C GC-RE-008 Kpn I GGTAC/C C 80 C - NO C/CATGG GC-RE-021 Ksp22 I T/GATCA C 65 C ACTAG/T

57 GeneCraft Schnittmuster activity [%] in buffer optimal heat in- Cat. No restriction 5 -> 3 reaction activable enzyme 3 -> 5 A B L M H temp. 20 at GC-RE-051 Kzo9 I /GATC C 65 C CTAG/ GC-RE-022 Mlu I A/CGCGT C 65 C TGCGC/A GC-RE-046 MroX I GAANN/NNTTC C 65 C CTTNN/NNAAG GC-RE-009 Msp I C/CGG C 65 C GGC/C GC-RE-029 Nco I C/CATGG C 65 C GGTAC/C GC-RE-010 Not I GC/GGCCGC C 65 C CGCCGG/CG GC-RE-011 Nru I TCG/CGA C 65 C AGC/GCT GC-RE-053 Pci I A/CATGT C 80 C TGTAC/A GC-RE-054 Psi I TTA/TAA C 65 C AAT/ATT GC-RE-023 Psp124B I GAGCT/C C 65 C C/TCGAG GC-RE-030 PspE I G/GTNACC C 65 C CCANTG/G GC-RE-012 Pst I CTGCA/G C 80 C G/ACGTC GC-RE-035 Pvu II CAG/CTG C 80 C - NO GTC/GAC GC-RE-031 Rsa I GT/AC C 65 C CA/TG GC-RE-013 Sal I G/TCGAC C 65 C CAGCT/G GC-RE-032 Sbf I CCTGCA/GG C 80 C - NO GG/ACGTCC GC-RE-050 SfaN I GCATCN 5 /NNNN C 65 C CGTAGNNNNN 5 / GC-RE-024 Sfi l GGCCN 4 /NGGCC C 80 C - NO CCGGN/N 4 CCGG GC-RE-045 Sfr303 I CCGC/GG C 65 C GG/CGCC GC-RE-025 Sma I CCC/GGG C GGG/CCC GC-RE-033 Sph I GCATG/C C 65 C C/GTACG GC-RE-037 Ssp l AAT/ATT C 65 C TTA/TAA GC-RE-014 Taq I T/CGA C 80 C AGC/A GC-RE-042 Tru9 I T/TAA C 80 C - NO AAT/T GC-RE-015 Xba l T/CTAGA C 65 C AGATC/T GC-RE-016 Xho l C/TCGAG C 65 C GAGCT/C GC-RE-034 Xma I C/CCGGG C 65 C GGGCC/C GC-RE-055 Zsp2 I ATGCA/T C T/ACGTA 57

58 58 RANDOM PRIME LABELING KIT The random prime labeling kit can be used for rapid random-primed labeling of DNA with [ 32 P], [ 32 S] or [ 3 H] dctp to a specific activity.the kit is based on the method described by Feinberg and Vogelstein (1, 2), in which a mixture of random hexamers is used to prime DNA synthesis from any DNA template. In particular this kit may be used to label DNA fragments directly after isolation from agarose gels using the MegaPure TM DNA purification kit. Der Random Prime Labeling Kit kann für die schnelle willkürliche Bindung der DNA mit [ 32 P], [ 32 S] oder [ 3 H] dctp bis zu einer bestimmten Aktivität verwendet werden. Der Kit basiert auf der Methode beschrieben von Feinberg und Vogelstein (1, 2), in der eine Mischung zufälliger Hexamere verwendet wird, um DNA von jedem beliebigen Template zu synthetisieren. Dieser Kit kann insbesondere direkt für DNA-Fragmente verwendet werden, die gerade frisch mit Hilfe des MegaPure DNA Purification Kit aus einem Agarose- Gel isoliert wurden. APPLICATIONS Generation of high specific activity DNA hybridization probes from 10 ng to 3 µg of DNA in a standard reaction. Supercoiled or linearized DNA may be used for labeling DNA of different lengths. Probes can be produced from fragments purified from a variety of sources. STANDARD REACTION Thaw all reagents on ice, keep the Klenow fragment at -20ºC until required. Double-stranded template DNA must be denatured by heating in a microcentrifuge tube at 95ºC for 2 minutes and rapidly chilled on ice. Assemble the reaction in a microcentrifuge tube, on ice, in the following order: Add water to achieve a final volume of 50 µl. 10x Primer mix 5 µl 10x dntp mix 5 µl denatured DNA template 25 ng [ 32 P]dCTP, 50 µci 5 µl Klenow fragment 1 µl Incubate the reaction at room temperature for 60 minutes, remove unincorporated dctp using a Sephadex G-50 spin column. STORAGE TEMPERATURE Store at -20ºC in a constant temperature freezer. MIXES 10x primer mix: 100 mm Tris-HCl ph 7.5; 100 mm MgCl 2 ; 4.5 µm hexamers 10x dntp mix: 5 mm each datp, dgtp, dttp, 10 mm DTE COMPANION PRODUCTS Klenow fragment, MegaPure DNA purification kit REFERENCES 1 Feinberg A.P. and Vogelstein B. (1983) Anal. Biochem. 132, 6 2 Feinberg A.P. and Vogelstein B. (1984) Anal. Biochem. 137, 266 GC-025 PACK SIZE 20 labeling reactions: 25 µl Klenow fragment (125 u), 100 µl primer mix, 100 µl dntp mix

59 dntp SET Ready-to-use dntp solutions are available as tetrasodium salts for use in DNA polymerization reactions and all DNA labelling and sequencing processes. Das dntp Set besteht aus dntp-lösungen, die direkt verwendet werden können und als Tetrasodium-Salze erhältlich sind, um in DNA-Polymerisations-Reaktionen, allen DNA-Labellings und Sequenzierungen ihren Einsatz zu finden. 59 GC dgtp, datp, dttp, dctp GC dgtp, datp, dutp, dctp PACK SIZE 100 mm each solution, 4 x 25 µmol each, 250 µl each vial dgtp Na 4 *3H 2 O MW Deoxyguanosine 5'-triphosphate tetrasodium salt Purity: UV - 98%, column chromatography (polysil) % Integral spectral ratio: 250/ ; 270/ ; 280/ ; 290/ PCR reaction is successful for the template up to 10 kb length. datp Na 4 *3H 2 O MW Deoxyadenosine 5'- triphosphate, tetrasodium salt Purity: UV - 95%, column chromatography (polysil) % Integral spectral ratio: 250/ ; 270/ ; 280/ PCR reaction is successful for the template up to 10 kb length. dttp Na 4 *3H 2 O MW Deoxythymidine 5 -triphosphate, tetrasodium salt Purity: UV - 96%, column chromatograohy (polysil) % Integral spectral ratio: 250/ ; 270/ ; 280/ ; 290/ PCR reaction is successful for the template up to 10 kb length. dctp Na 4 *3H 2 O MW 591,2 Deoxycytidine 3'-triphosphate, tetrasodium salt Purity: UV - 99%, column chromatography (polysil) % Integral spectral ratio: 250/ ; 270/ ; 280/ ; 290/ PCR reaction is successful for the template up to 10 kb length.

60 60 DNA POLYMERIZATION MIX 20/10 Contains all four dntps in a pre-mixed solution, ready for immediate use. For procedures requiring unlabeled mixtures of all four dntps such as PCR or cdna synthesis. PURITY 97-99% by UV and polysil column chromotography. PCR reaction is successful for the template up to 10 kb length indicating high purity and absence of deleterious terminators BECHREIBUNG Dieser Mix enthält alle vier dntps in einer vorgemischten Lösung, welche zur sorfortigen Verwendung gedacht ist. Er ist für alle Verfahren geeignet, für die man unmarkierte Mischungen aller vier dntps benötigt, wie z.b. PCR oder cdna-synthese. GC GC mm each dntp, each 10 µmol, 500 µl 10 mm each dntp, each 5 µmol, 500 µl dntps Supplied in a convenient solution at ph 7,0 PURITY 95% purity by HPLC. QUALITY CONTROL Quality controlled by HPLC for maximum purity and minimal di- and monophosphate content. All batches tested in standard labelling reactions. STORAGE CONDITIONS dntps are stable at -20ºC in a constant-temperature freezer. Avoid multiple freeze/thawing. For long term usage it is recommended to aliquote the nucleotides. GC GC GC GC GC dgtp datp dttp dctp dutp PACK SIZE 100 mm solution, 25 µmol, 250 µl

61 dntp CUSTOM SERVICE BIOTIN-4-dUTP Any of the nucleotide products described can be prepared to your custom specifications; i.e. concentration, volume, various dntp combinations for labelling, etc. BENEFITS Fast efficient service (normally next day) Meeting your precise custom requiremnts for all nucleotide combinations Cost-effective service STORAGE CONDITIONS dntps are stable at -20ºC in a constant-temperature freezer. Avoid multiple freeze/thawing. For long term usage it is recommended to aliquote the nucleotides. BECHREIBUNG Alle unsere beschriebenen Nukleotid-Produkte können auch nach Ihren ganz persönlichen Wünschen gemischt werden; wie z.b. die Konzentration, Volumen, verschiedene dntp Kombinationen etc. QUALITY CONTROL Quality controlled by HPLC for maximum purity and minimal di- and monophosphate content. All batches tested in standard labelling reactions. 61 CONCENTRATION 1 mm GC GC µl (50 nmol) 1 ml (1 µmol) BIOTIN-11-dUTP CONCENTRATION 1 mm GC GC µl (50 nmol) 1 ml (1 µmol)

62 62 URACIL-DNA GLYCOSYLASE E. coli uracil-dna glycosylase (UDG) is the recombinant form of the enzyme, which catalyzes the release of free uracil from uracil-containing DNA (U-DNA) and creates an alkali-sensitive apyrimidinic site in the DNA. UDG efficiently hydrolyzes uracil from single-stranded or double-stranded U-DNA, but not from oligomers (6 or fewer bases). E. coli Uracil-DNA-Glycosylase (UDG) ist die rekombinante Form des Enzyms, das die Freisetzung von freiem Uracil aus Uracil-haltiger DNA (U-DNA) katalysiert und für hohe ph-werte empfindliche, Pyrimidinfreie Orte in der DNA erzeugt. UDG hydrolysiert effizient Uracil aus einzel- oder doppelsträngiger U-DNA, jedoch nicht aus Oligomeren (6 Basen oder weniger). APPLICATIONS PCR RT-PCR site-directed mutagenesis as a probe for protein-dna interaction studies producing highly labeled oligonucleotide probes CONCENTRATION 5 units/µl UNIT DEFINITION One unit of enzyme activity is the amount that catalyzes the degradation of 1 µg single-stranded uracilcontaining DNA at 37 C in 60 minutes. STORAGE BUFFER 20 mm Tris-HCl ph 8.0; 100 mm NaCl; 0.1 mm EDTA; 1 mm DTT; 0.1 mg/ml BSA; 50% glycerol STORAGE TEMPERATURE store at -20 C 10X REACTION BUFFER 500 mm Tricine ph 8.5, 10 mm MgCl 2 or buffer for PCR or RT-PCR protocol QUALITY CONTROL Activity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases. GC GC GC GC GC u 250 u 500 u 1000 u 5000 u λ-dna SOURCE Wild-type λ-phage COMPANION PRODUCTS BstE II- λ-dna marker STORAGE TEMPERATURE store at -20 C GC µg

63 T-VECTOR SYSTEM Cloning of PCR products using plasmid T-vectors is an easy and well established method (1-4). This method takes advantage of the terminal transferase activity of Taq polymerase (5). This enzyme adds a single deoxyadenosine base to the 3 end of their reaction products. These PCR products can be ligated directly into a vector containing compatible single T-nucleotide overhangs. The BS-SK-T-vector was produced by a very efficient procedure using terminal deoxynucleotidyl transferase and ddttp (4). The T-vector is prepared from 2961-bp vector pbluescript II SK(+) by cutting with EcoR I, filling recessed 3 termini and adding a 3 terminal thymidine to both ends. These single 3 -T overhangs at the insertion site greatly improve the efficiency of ligation of a PCR product into the plasmids by preventing recircularization of the vector and providing a compatible overhang for PCR products generated by certain thermostable polymerases. These polymerases often add a single deoxyadenosine, in a template-independent fashion, to the 3 -ends of the amplified fragments. The T-vector contain T7 and T3 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of the enzyme β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be directly identified by color screening on indicator plates. To increase the efficiency of the vector the tailed product was religated and the linear form was purified from an agarose gel. This vector cannot be used for cloning of PCR products generated with some DNA polymerases like Pfu DNA polymerase that does not exhibit any terminal transferase activity (for cloning of such PCR products use our pbs-ecorv vector, page 66). However a simple incubation of such PCR products with Taq polymerase will add 3 nucleotide overhang, enabling the cloning of these products into T-vector. Das Klonieren von PCR-Produkten mit Hilfe eines Plasmid-T-Vectors ist eine einfache und etablierte Methode (1-4). Diese Methode nutzt den Vorteil der terminalen Transferaseaktivität einer Taq-Polymerase (5). Dieses Enzym hängt eine einzelne Deoxyadenosin- Base an das 3 -Ende ihrer Reaktionsprodukte. Diese PCR-Produkte können direkt in einen Vector eingebracht werden, welcher einzelne kompatible T-Nukleotid-Überhänge enthält. Der BS-SK-T-Vector ist mit Hilfe einer sehr effizienten Methode mittels terminaler Deoxynucleotidyl-Transferase und ddttp hergestellt worden. Der T-Vector ist aus dem 2961-bp Vector pbluescript II SK(+) angefertigt worden, indem dieser mit EcoRI geschnitten, die vertieften 3 -Enden aufgefüllt und ein 3 -terminaler Thymidin-Rest an beide Enden angehängt wurde. Diese einzelnen 3 -T-Überhänge an der Einfügestelle verbessern die Effizienz der Ligation eines PCR-Produktes in das Plasmid drastisch, indem die Recirculation des Vectors verhindert wird und die Überhänge eine kompatible Ansatzstelle für PCR-Produkte darstellen, welche mit Hilfe von herkömmlichen hitzestabilen Polymerasen erzeugt wurden. Diese Polymerasen hängen oft in einer Template-unabhängigen Art und Weise einen einzelnen Deoxyadenosin-Rest an das 3 -Ende der amplifizierten Fragmente. Der T-Vector enthält Promotoren für die T7 und T3 RNA-Polymerasen, welche eine Multiple-Cloning-Site flankieren. Zusätzlich enthält der T-Vector die kodierende Region für das α-peptid des Enzyms β-galactosidase. Durch die Inaktivierung dieses α-peptids erhält man rekombinante Klone, die direkt anhand eines Farb-Screenings auf speziellen Indikator-Platten identifiziert werden können. Um die Effizienz des Vectors zu steigern, ist das End-Produkt religiert und die lineare Form aus einem Agarose-Gel gereinigt worden. Dieser Vector kann nicht für die Klonierung von PCR-Produkten verwendet werden, die mit bestimmten DNA-Polymerasen wie z.b. der Pfu-DNA-Polymerase erzeugt wurden, da diese keine terminale Transferase-Aktivität aufweisen. Jedoch kann man mit einer einfachen Inkubation dieser PCR-Produkte mit einer Taq-Polymerase einen 3 -Nukleotid-Überhang anhängen, was die Klonierung dieser PCR-Produkte in den T-Vector ermöglicht. 63

64 T-VECTOR SYSTEM 64 PROTOCOL Ligations Using the T-Vector 1. Briefly centrifuge the T-Vector and Insert DNA tubes to collect contents at the bottom of the tube. 2. Set up ligation reactions as described below. Standard Reaction Background Control 5X Ligation Buffer 2µl 2µl T-Vector (50ng) 1µl 1µl PCR product Xµl* T4 DNA Ligase (2 Weiss units/µl) 1µl 1µl ATP (5 mm) 2µl 2µl deionized water to a final volume of 10µl a final volume of 10µl *Molar ratio of PCR product:vector may require optimization as described below 3. Mix the reactions by pipetting. Incubate the reactions 1 hour at room temperature. Alternatively, if the maximum number of transformants is required, incubate the reactions overnight at 4 C. NOTES 1. Use GeneCraft s T4 DNA Ligase in performing T- Vector ligations. Other commercial preparations of T4 DNA ligase may contain exonuclease activities that may remove the terminal deoxythymidines from the vector. 2. 5X Ligation Buffer (without ATP) contains: 250 mm Tris-HCl (ph 7.8); 50 mm MgCl 2 ; 50 mm dithiothreitol. 3. It is important to vortex the 5X Ligation Buffer before each use. 4. Longer incubation times will increase the number of transformants. Generally, incubation overnight at 4 C will produce the maximum number of transformants. 5 Use 0.5ml tubes known to have low DNA-binding capacity OPTIMIZING INSERT: VECTOR MOLAR RATIOS The T-Vector have been optimized using a 1:1 molar ratio of the Control Insert DNA to the Vector. However, ratios of 8:1 to 1:8 have been successfully used. If initial experiments with your PCR product are suboptimal, ratio optimization may be necessary. Ratios from 3:1 to 1:3 provide good initial parameters. The concentration of PCR product should be estimated by comparison to DNA mass standards on a gel. The T- Vector is approximately 3kb and is supplied at 50ng/µl. T-VECTOR MULTIPLE CLONING SITE REGION (sequence shown ) M13 Reverse primer BssH II T3 promoter > 5 CAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAAC 3 GTCCTTTGTCGATACTGGTACTAATGCGGTTCGCGCGTTAATTGGGAGTGATTTCCCTTG Met ß-galactosidase > 820 BstX I Eag I Sac I Sac II Not I Xba I Spe I BamH I Sma I Pst I AAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAG TTTTCGACCTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTC Cla I Hinc II Dra II EcoR V Hind III Sal I Xho I Apa I Kpn I GAATTT-3 AATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACC CTTAA 3 -TTTAAGCTATAGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGG BssH II CAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTAC 3 GTTAAGCGGGATATCACTCAGCATAATGCGCGCGAGTGACCGGCAGCAAAATG 5 < T7 promoter M13 17-base primer 620

65 T-VECTOR SYSTEM CONCENTRATION 50 ng/µl REFERENCES 1. Trower, M.K. and Elgar G.S. PCR cloning using T- vectors. Methods in Molecular Biology, Vol. 31: Protocols for Gene Analysis, 1994 Humana Press Inc., Totowa, NJ 2. Mead, D.A. etal. (1991) A universal method for the direct cloning of PCR amplified nucleic acid. Biotechniques 9: Marchuk, D.A. et al. (1991) Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19: 1154 STORAGE TEMPERATURE -20 C 4. Holton, T.A. and Graham, M.W. (1991) A simple and efficient method for direct cloning of PCR products using ddt-tailed vectors. Nucleic Acids Res. 19: Clark, J.M. (1988) Novel non-templated nucleotide reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 18:L T7 Kpn I Xho I Sal I Hind III Eco R V pbluescript II SK (+) 3.0 kb T T Pst I BamH I Xba I Not I Sac I T3 GC µg (ca. 20 reactions)

66 pbs-ks-ecorv 66 The pbs-ks-ecorv vector was produced by digestion of pbs-ks plasmid with EcoRV and the linear form was purified from an agarose gel. This vector is a ready-touse product, designed for cloning of PCR products containing blunt ends and amplified with a class of Synergy DNA polymerases containing Pfu-DNA polymerase. For protocol see T-Vector System (page 64). CONCENTRATION 50 ng/µl : Der pbs-ks-ecorv Vector entsteht durch den Verdau eines pbs-ks Plasmids mit EcoRV, und die lineare Form ist aus einem Agarosegel gereinigt worden. Der Vector kann sofort verwendet werden. Er ist für die Klonierung von PCR-Produkten mit blunt ends hergestellt und mit einer Klasse von Synergy DNA-Polymerasen, welche eine Pfu-DNA-Polymerase enthalten, erweitert worden. Das Protokoll finden Sie auf der Seite des T-Vectors (S. 64). STORAGE TEMPERATURE -20 C GC µg (ca. 20 reactions) DNA MOLECULAR WEIGHT MARKER BSTE II-λ-DNA MARKER BstE II-λ-DNA Marker consists of 15 fragments ranging in size from 117 to bp. Their asymmetric distribution makes determination of molecular weight easier. Two fragments containing the cos sites hybridize to each other resulting in additional band of bp at the top. This can be avoided by heating the marker to 80ºC for 15 minutes and cooling it on ice. BstE II-λ-DNA Marker besteht aus 15 Fragmenten mit einer Größe von 117 bis bp. Die ungleichmäßige Verteilung der Banden macht die Bestimmung des Molekulargewichtes einfacher. Zwei Fragmente tragen eine cos-site, so daß diese zu einem Fragment von bp hybridisieren. Dies kann durch Erhitzen des Markers für 15 min. auf 80 C und anschließendem auf Eis halten verhindert werden. STORAGE TEMPERATURE Store at +4 C to -20 C. GC PACK SIZE 100 µg in 1 ml (100 rxns) loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose in water), the marker is ready to use. Load 10 µl in one lane.

67 DNA MOLECULAR WEIGHT MARKER Hpa II-pBS-DNA MARKER Hpa II-pBS-DNA Marker consists of 13 fragments ranging in size from 26 to 712 bp. Their asymmetric distribution makes determination of molecular weight easier. Hpa II-pBS-DNA Marker besteht aus 13 Fragmenten mit einer Größe von 26 bis 712 bp. Die ungleichmäßige Verteilung der Banden macht die Bestimmung des Molekulargewichtes einfacher. STORAGE TEMPERATURE Store at +4 C to -20 C. 67 GC PACK SIZE 50 µg in 500 µl (100 rxns) loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose in water), the marker is ready to use. Load 5-10 µl in one lane. BSTE II-λ-DNA MARKER Hpa II-pBS-DNA MARKER BOTH MARKERS LOA- DED SIMULTANEOUS- LY IN ONE LANE AND RUN ABOUT 1 HOUR ON 1% AGAROSE GEL.

68 68 EcoRI-λ-DNA MARKER EcoRI-λ-DNA marker consists of 6 fragments ranging in size from 3530 to bp. Their asymmetric distribution makes determination of molecular weight easier. Two fragments (3530 bp and bp) containing the cos sites of bacteriophage lambda may hybridise to each other resulting in an additional band at bp. This can be avoided by heating the marker to 80 C for 15 minutes and cooling it on ice. EcoRI-λ-DNA Marker besteht aus 6 Fragmenten mi einer Größe von 3530 bis bp. Die ungleichmäßige Verteilung der Banden macht die Bestimmung des Molekulargewichtes einfacher. Zwei Fragmente (3530 bp und bp) enthalten die cos-sites des Bakteriophagen Lambda und können sich deshalb zu einer Bande von bp addieren. Dies kann durch Erhitzen des Markers für 15 min. auf 80 C und anschließendem auf Eis halten verhindert werden. STORAGE TEMPERATURE Store at +4 C to -20 C 21226* The marker is ready to use. Load 10 µl in one lane. To demonstrate the mobility of the DNA fragments, 1µg of marker was loaded onto a 0.7% agarose gel * GC µg in 1 ml (100 rxns) loading buffer(0.25 % bromphenol blue, 0.25 % xylene cyanol FF, 40 % sucrose in water).

69 HindIII-λ-DNA MARKER HindIII-λ-DNA marker consists of 7 fragments ranging in size from 564 to bp. Their asymmetric distribution makes determination of molecular weight easier. Two fragments (4361 bp and bp) containing the cos sites of bacteriophage lambda may hybridise to each other resulting in an additional band at bp. This can be avoided by heating the marker to 80 C for 15 minutes and cooling it on ice. HindIII-λ-DNA Marker besteht aus 7 Fragmenten mi einer Größe von 564 bis bp. Die ungleichmäßige Verteilung der Banden macht die Bestimmung des Molekulargewichtes einfacher. Zwei Fragmente (4361 bp und bp) enthalten die cos-sites des Bakteriophagen Lambda und können sich deshalb zu einer Bande von bp addieren. Dies kann durch Erhitzen des Markers für 15 min. auf 80 C und anschließendem auf Eis halten verhindert werden. 69 STORAGE TEMPERATURE Store at +4 C to -20 C The marker is ready to use. Load 10 µl in one lane. To demonstrate the mobility of the DNA fragments, 1µg of marker was loaded onto a 1 % agarose gel * * GC µg in 1 ml (100 rxns) loading buffer (0.25 % bromphenol blue, 0.25 % xylene cyanol FF,40 % sucrose in water).

70 70 EcoRI+HindIII-λ-DNA MARKER EcoRI+HindIII-λ-DNA marker consists of 13 fragments ranging in size from 564 to bp. Their asymmetric distribution makes determination of molecular weight easier. Two fragments (3530 bp and bp) containing the cos sites of bacteriophage lambda may hybridise to each other resulting in an additional band at bp. This can be avoided by heating the marker to 80 C for 15 minutes and cooling it on ice. STORAGE TEMPERATURE Store at +4 C to -20 C The marker is ready to use. Load 10 µl in one lane. To demonstrate the mobility of the DNA fragments, 1µg of marker was loaded onto a 1 % agarose gel. Beschreibung EcoRI+HindIII-λ-DNA Marker besteht aus 13 Fragmenten mit einer Größe von 564 bis bp. Die ungleichmäßige Verteilung der Banden macht die Bestimmung des Molekulargewichtes einfacher. Zwei Fragmente (3530 bp und bp) enthalten die cos-sites des Bakteriophagen Lambda und können sich deshalb zu einer Bande von bp addieren. Dies kann durch Erhitzen des Markers für 15 min. auf 80 C und anschließendem auf Eis halten verhindert werden * * GC µg in 1 ml (100 rxns) loading buffer (0.25 % bromphenol blue, 0.25 % xylene cyanol FF, 40 % sucrose in water).

71 100 bp DNA LADDER The 100 bp DNA ladder is suitable for sizing linear double-stranded DNA fragments from 100 to 1000 bp. The 10 bands of the ladder contain fragments with the following sizes: 100, 200, 300, 400, 500, 600, 700, 800, 900 and 1000 bp Die 100 bp DNA Ladder ist für die Größenbestimmung linearer, doppelsträngiger DNA-Fragmente von 100 bis 1000 bp geeignet. Der Einsatz dieser Ladder ergibt 10 Banden folgender Größe: 100, 200, 300, 400, 500, 600, 700, 800, 900 und 1000 bp 71 CONCENTRATION 1 µg/10 µl TO DEMONSTRATE THE MOBILITY OF THE DNA FRAGMENTS, 1 µg OF MARKER WERE LOADED ONTO A 1% AGAROSE GEL. The recommended amount of size marker to load on an agarose gel is µg per lane (5-10 µl). GC µg in 500 µl (100 rxns) loading buffer (0.25% bromphenoblue, 0.25% xylene cyanol FF, 40% sucrose in water).

72 72 1 kb DNA LADDER The 1 kb DNA ladder is suitable for sizing linear double-stranded DNA fragments from 0.25 to 10 kb. The 13 bands of the ladder contain fragments with the following sizes: 250, 500, 750, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 8000 and bp For easy reference on agarose gels, the 1000 and 3000 bp bands are three times brighter than the other bands in the ladder. CONCENTRATION 1 µg/10 µl Die 1 kb DNA Ladder ist für die Größenbestimmung linearer, doppelsträngiger DNA-Fragmente von 0.25 bis 10 kb geeignet. Der Einsatz dieser Ladder ergibt 13 Banden folgender Größe: 250, 500, 750, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 8000 und bp Für die bessere Vergleichbarkeit auf dem Gel sind die 1000 bp und die 3000 bp Bande dreimal stärker als die anderen. TO DEMONSTRATE THE MOBILITY OF THE DNA FRAGMENTS, 1 µg OF MARKER WERE LOADED ONTO A 1% AGAROSE GEL. The recommended amount of size marker to load on an agarose gel is µg per lane (5-10 µl). GC µg in 1 ml (200 rxns) in loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose in water).

73 MegaPure DNA PURIFICATION KIT The kit is based on the defined size silica matrix used for purification of DNA from agarose gels. COMPONENTS OF THE STANDARD KIT 15 ml MELT solution 1 ml BIND solution 3 ml 40x WASH solution (for 120 ml WASH solution mix with 60 ml ethanol and 57 ml H 2 O) COMPONENTS OF THE SAMPLE KIT 1 ml MELT solution 20 µl BIND solution 100 µl WASH solution, 40x concentrate SOLUTIONS MELT solution: BIND solution: WASH solution: 6 M NaI DNA-binding silica matrix 50 mm NaCI 10 mm Tris-HCI ph 7.5; 2,5 mm EDTA; 50% v/v ethanol STORAGE TEMPERATURE Store the components of the DNA purification kit at +4ºC in the dark. PROTOCOL 1 Add water to MELT powder to obtain 15 ml solution. 2 Mix 60 ml ethanol and 57 ml water with 3 ml of 40x WASH concentrate. For sample kit, mix 2 ml ethanol and 1,9 ml wate with 100 µl of 40x WASH concentrate Dieser Kit basiert auf der definierten Größe der Silica- Matrix, die für die Reinigung von DNA in Agarose- Gelen verwendet wird. 3 Excise the DNA fragment from agarose gel and add one volume of MELT ( µl) 4 Melt the gel slice at 65 C for 5 min. Cool down 5 Add 5-15 µl of BIND (will bind up to 4 µg DNA) and incubate 5 min. at room temperature 6 Centrifuge 1 min. at 7000 rpm, remove the supernatant 7 Add 500 µl of WASH solution to the pellet and vortex. Centrifuge 1 min. at 7000 rpm. Repeat washing. 8 Dry pellet at room temperature. Speedvac and airdrying are admissible. 9 Elute DNA by resuspending the pellet in µl water and incubate 5 min. at 55 C. Centrifuge 5 min. at maximum speed. 10Transfer the supernatant in another tube. If necesssary, repeat centrifugation step to clean you sample from the remaining BIND. Keep this DNA probe at +4 C or 20 C. If necessary, concentrate or dry DNA in Speedvac. The DNA purified by this protocol can be used for digestion with restriction enzymes, for ligation, transformation and labeling with Klenow enzyme. This kit can also be used for purification of PCR products. DNA fragments from 20 bp up to 10 kb length can be succcessfully purified with this kit. 73 GC preps

74 TREPONEMA PALLIDUM RECOMBINANT ANTIGEN - tmpa 74 tmpa protein is the main surface protein of Treponema pallidum. The protein is modified by means of genetic engineering, all major epitops are intact, hydrophobic anchor is removed. rec-tmpa was shown to bind effectively with Ig from T. pallidum infected patients. The protein is purified from water-soluble fraction of rec-e.coli proteins. SOURCE The protein is purified from E. coli strain harboring the plasmid with the tmpa gene. CONCENTRATION 2.6 mg/ml tmpa ist das wohl bedeutenste Protein der Zelloberfläche von Treponema pallidum Dieses Protein ist mit Hilfe der Gentechnik modifiziert worden, alle wichtigen Epitope sind intakt und hydrophobe Anker-Sequenzen wurden entfernt. Man konnte zeigen, daß rec-tmpa effektiv an den entsprechenden Antikörper, aus mit T. pallidum infizierten Patienten, bindet. Das Protein ist aus einer wasserlöslichen Fraktion rekombinanter E. coli-proteine gereinigt worden. STORAGE BUFFER 10 mm Tris-HCl ph 7.5; 150 mm NaCl; 0.08% sodium azide STORAGE TEMPERATURE +4 C. Do not freeze!!! PURITY More than 90% by SDS-PAGE. Purified by affinity chromatography. GC-AG-001 0,52 mg MONOCLONAL IgG TO THERMUS AQUATICUS DNA POLYMERASE SOURCE Clone: 109, mouse astitic fluid ISOLATION Ammonium sulphate precipitation, followed by ionexchange chromatography on DEAE-cellulose PROTEIN CONCENTRATION 1 mg/ml PRESENTATION Solution in 100 mm NaCl; 10 mm Na-phosphate; ph 8.0, 50% Glycerol STORAGE TEMPERATURE 2 years at -20 C For research and manufacturing use only. GC-AG µg

75 IPTG (ISOPROPYL-ß-D-THIOGALACTOSIDE) Chemical analogue of galactose that cannot be cleaved by ß-galactosidase. Dies ist das chemische Analogon von Galactose, welches nicht mit Hilfe der ß-Galactosidase gespaltet werden kann 75 APPLICATIONS Very effective inducer of the lac operon for the ß- galactosidase by binding and inactivating the lac repressor. It is recommended to use 0,1-1 mm IPTG in LB-media. So a stock solution of 100 mm or 500 mm, which should be stored at -20 C after sterilization, is useful. CHARACTERISTICS White crystalline powder. Soluble in water and methanol. Formula C 9 H 18 O 5 S Molecular weight M r = 238,3 Melting point C α20 /D; 1%, H 2 O -30 ± 2 Moisture content NMT 1,0% Residue on ignition NMT 0,5% Purity (by TLC) NLT 98,0% STORAGE TEMPERATURE -20 C, protected from light. GC-SS g (or as requested)

76 ACRYLAMID 76 Acrylamid, TBE, TEMED und APS sind nur für den Verkauf in Deutschland bestimmt. Acrylamides, TBE, TEMED and APS are sold only in Germany. wässrige Lösungen HS-Nr.: Lagerung: RT R: E24/25-E48/24/25 LGK: 6.1 B S: / WGK: 3 Entsorgung: 9 giftig, krebserzeugend, erbgutverändernd RID/ADR: 6.1/12 c UN 2074 Giftkl. (CH): 2 Acrylamid 4K-Fertiglösungen für nicht denaturierende DNA-PAGE Die hier aufgelisteten Acrylamid-Fertiglösungen sind aus der hochreinen 4K-ultrapure Qualität und 30%igen Stammlösungen hergestellt. Sie bestehen aus Acrylamid/Bisacrylamid im Verhältnis 29:1 mit den jeweils angegebenen Konzentrationen an freiem Monomer und 1X TBE (ph 8,3). LAGERUNG Raumtemperatur Für die Polymerisation des Gels müssen pro 100 ml Gellösung 1 ml APS (GC-A2941) (aus einer 10%igen Stocklösung) und 50 µl TEMED (GC-A1148) zugegeben werden. Als Elektrophoresepuffer wird TBE-Puffer (GC-A3945) verwendet. EIGENSCHAFTEN 250 ml, 500 ml, 1 L Kat. Nr. % Acrylamid (4K) Trennbereich (bp) GC-A0721 3,5 ca GC-A ca GC-A ca GC-A ca GC-A ca GC-A ca GC-A ca Acrylamid 4K-Fertiglösungen für denaturierende DNA-PAGE HINWEIS Da Sauerstoff die Polymerisation von Acrylamid hemmt, sollten Acrylamidlösungen vor der Zugabe von TEMED entgast werden. Die empfohlene und relativ große Menge an APS macht dies in der Regel jedoch überflüssig. Falls der Harnstoff bei niedrigen Temperaturen ausfällt, kann er durch Erwärmen der Lösung im 37 C-Wasserbad wieder gelöst werden. Die hier aufgelisteten Acrylamid-Fertiglösungen sind aus der hochreinen 4K-ultrapure Qualität und 40%igen Stammlösungen hergestellt und für die DNA-Sequenzierung geeignet. Sie bestehen aus Acrylamid/Bisacrylamid im Verhältnis 19:1 mit den jeweils angegebenen Konzentrationen an freiem Monomer und 50% Harnstoff und 1X TBE (ph 8,3). LAGERUNG Raumtemperatur Kat. Nr. % Acrylamid (4K) Wanderungsverhältnis Bromphenolblau/Xylencyanol (b) GC-A GC-A /130 GC-A /106 GC-A /76 GC-A /55 Für die Polymerisation des Gels müssen pro 100 ml Gellösung 1 ml APS (GC-A2941) (aus einer 10%igen Stocklösung) und 50 µl TEMED (GC-A1148) zugegeben werden. Als Elektrophoresepuffer wird TBE-Puffer (GC-A3945) verwendet. EIGENSCHAFTEN 250 ml, 500 ml, 1 L

77 ACRYLAMID Acrylamid 4K-Fertiglösungen für SDS-PAGE Die hier aufgelisteten Acrylamid-Fertiglösungen basieren auf der Arbeit von Laemmli (1) und sind aus der hochreinen 4K-ultrapure Qualität sowie 30%igen Stammlösungen hergestellt. Sie bestehen aus Acrylamid/Bisacrylamid im Verhältnis 29:1 mit den jeweils angegebenen Konzentrationen an freiem Monomer und 0.1% SDS sowie 380 mm Tris (ph 8.8). LAGERUNG Raumtemperatur SAMMELGEL Zu jeder Packung 250 ml (bzw. 500 ml und 1 Liter) Trenngellösung wird 100 ml (bzw. 125 ml und 250 ml) Sammelgellösung mitgeliefert. Die Konzentration der Sammelgellösung (125 mm Tris, ph 6.8) beträgt unabhängig von der gewählten Trenngellösung 4%. Für die Polymerisation des Gels müssen pro 100 ml Gellösung 1 ml APS (GC-A2941) (aus einer 10%igen Stocklösung) und 50 µl TEMED (GC-A1148) zugegeben werden. Als Elektrophoresepuffer wird der Laemmli (SDS-Tris-Glycin)-Puffer (GC-A1415) verwendet. EIGENSCHAFTEN 250 ml, 500 ml, 1 L 77 Kat. Nr. % Acrylamid (4K) Trennbereich (bp) GC-A ca GC-A0710 7,5 ca GC-A ca GC-A ,5 ca GC-A ca LITERATUR Laemmli, U.K. (1970) Nature 227, HINWEIS Die Länge des Sammelgels sollte ungefähr 1,5fach länger sein als die Tiefe des Kammes, da bei einem kürzeren Sammelgel die Gefahr besteht, dass beim Herausziehen des Kammes das Sammelgel zerstört wird. Da Sauerstoff die Polymerisation von Acrylamid hemmt, sollten Acrylamidlösungen vor der Zugabe von TEMED entgast werden. Die empfohlene und relativ große Menge an APS macht dies in der Regel jedoch überflüssig.

78 REAGENZIEN FÜR DIE ELEKTROPHORESE 78 Laemmli (SDS-Tris-Glycin)-Puffer (10x) HS-Nr.: Laemmli-Puffer, SDS-Tris-Glycin-Puffer, 10fach konzentriert für die Elektrophorese Laemmli hat mit der SDS-Polyacrylamidgelelektrophorese ein SDS-Tris-Glycin-Puffersystem (ph 8,3) eingeführt. Der Puffer wird als 10fach Konzentrat geliefert. SPEZIFIKATION Tris g/l (0.25 M) Glycin g/l (1.92 M) ph (H 2 O) 8.3 ± 0.1 (25 C) SDS 10 g/l (1%) GC-A GC-A GC-A ml 500 ml 1 L TBE (Tris-Borat-EDTA)-Puffer (10x) für die Molekularbiologie HS-Nr.: Lagerung: RT TBE-Puffer wird als Elektrophoresepuffer für Polyacrylamidgele und für Agarose-Gele verwendet. TBE hat eine höhere Pufferkapazität als TAE, allerdings wandert doppelsträngige, lineare DNA bei gleicher Auflösung 10% schneller durch TAE als durch TBE. Supercoiled DNA wird jedoch besser in TAE als in TBE aufgetrennt. Normalerweise verwendet man den Puffer in SPEZIFIKATION Tris g/l (0.89 M) EDTA-Na 2 * 2 H 2 O 7.44 g/l (0.20 M) Borsäure g/l (0.89 M) den Arbeitskonzentrationen 1x für Polyacryamidgele und 0,5x für Agarose-Gele. Für band shifts (gel mobility shift assay) wird ebenfalls 0.5x TBE eingesetzt. TBE wird meist als 10x Konzentrat bei Raumtemperatur gelagert. Bei langer Lagerung bildet sich ein Präzipitat - der Puffer sollte dann theoretisch nicht mehr verwendet werden. DNasen/RNasen nicht nachweisbar ph (20 C, H 2 O) 8.3 ± 0.2 GC GC GC GC GC u 250 u 500 u 1000 u 5000 u

79 REAGENZIEN FÜR DIE ELEKTROPHORESE TEMED, N,N,N,N -Tetrametrylendiamin TEMED, N,N,N,N -Tetramethylendiamin TMEDA C 6 H 16 N 2 Lagerung: +4 C R: 11-20/22-34 S: /37/39-45 Siedepunkt 121 C M = g/mol LGK: 3 A n 20 /D CAS-Nr.: HS-Nr.: RID/ADR: 3/3 b EINECS : UN 2372 Giftkl. (CH): 4 Entsorgung: 5 leichtentzündlich, gesundheitsschädlich, ätzend TBE-Puffer wird als Elektrophoresepuffer für Polyacrylamidgele und für Agarose-Gele verwendet. TBE hat eine höhere Pufferkapazität als TAE, allerdings wandert doppelsträngige, lineare DNA bei gleicher Auflösung 10% schneller durch TAE als durch TBE. Supercoiled DNA wird jedoch besser in TAE als in TBE aufgetrennt. Normalerweise verwendet man den Puffer in SPEZIFIKATION Gehalt (GC) min. 99% Wasser max. 0.3% den Arbeitskonzentrationen 1x für Polyacryamidgele und 0,5x für Agarose-Gele. Für band shifts (gel mobility shift assay) wird ebenfalls 0.5x TBE eingesetzt. TBE wird meist als 10x Konzentrat bei Raumtemperatur gelagert. Bei langer Lagerung bildet sich ein Präzipitat - der Puffer sollte dann theoretisch nicht mehr verwendet werden. ACHTUNG TEMED ist gesundheitsschädlich. Dämpfe sollten nicht eingeatmet werden! 79 GC-A GC-A GC-A ml 250 ml 500 ml AMMONIUMPERSULFAT FÜR DIE MOLEKULARBIOLOGIE Ammoniumperoxodisulfat, APS H 8 N 2 O 8 S 2 Lagerung: RT M = g/mol LGK: 5.1 HS-Nr.: R: /43 S: / WGK: 1 Löslichkeit (20 C) 582 g/l (H 2 O) CAS-Nr.: Schmelzpunkt: 120 C (Zers.) RID/ADR: 5.1/18 c Giftkl. (CH): 4 EINECS: UN 1444 Entsorgung: 22 gesundheitsschädlich, sensibilisierend Ammoniumpersulfat (APS) dient als Initiator der Polymerisation von Acrylamid. Da APS in wässriger Lösung nicht sehr stabil ist, sollte die Lösung frisch angesetzt werden. Aus Erfahrung kann sie aber bei +4 C mehrere Wochen gelagert werden. SPEZIFIKATION DNasen/RNasen nicht nachweisbar Chlorat max % Gehalt (titr.) min. 98% Chlorid max % ph (5%, H 2 O) (20 C) Fe max % Freie Säure max. 0.1% Mn max % Glührückstand max. 0.05% Pb max % GC-A GC-A GC-A g 250 g 500 g

80 80 GeneCraft AGAROSE LSL 8100 For preparative and analytical separation of nucleic acids. GeneCraft Agarose LSL 8100 is ideally suited for electrophoresis of nucleic acids. It is a high purity agarose extracted from the Gelidium species of seaweed and is characterised by a low sulphate content. GeneCraft Agarose LSL 8100 is recommended for preparative as well as analytical nucleic acid electrophoresis. It provides very firm gels at low concentrations. GeneCraft Agarose LSL 8100 is quality assured specifically to meet the stringent requirement of nucleic acid applications. GeneCraft Agarose LSL 8100 is manufactured and quality-controlled under very stringent conditions and in accordance with ISO 9000 certified quality system to ensure conformance with the demanding requirements of nucleic acid applications. Für die präparative und analytische Trennung von Nukleinsäuren. GeneCraft Agarose LSL 8100 ist für Elektrophoresen mit Nukleinsäuren ideal geeignet. Diese hochgereinigte Agarose wird aus der Rotalgengattung Gelidium gewonnen und zeichnet sich durch einen geringen Sulfat-Gehalt aus. GeneCraft Agarose LSL 8100 ist sowohl für die präparative als auch für die analytische Elektrophorese mit Nukleinsäuren geeignet. Mit dieser Agarose erhält man auch bei niedrigen Konzentrationen trotzdem stabile Gele. GeneCraft Agarose LSL 8100 steht für eine garantierte, ganz besondere Qualität, die alle Anforderungen im Bereich der Einsatzmöglichkeiten von Nukleinsäuren erfüllt. GeneCraft Agarose LSL 8100 ist unter äußerst strengen Bedingungen nach ISO 9000 hergestellt und kontrolliert worden, um die Anforderungen im Einsatzbereich von Nukleinsäuren voll erfüllen zu können. SPECIFICATION Gelling temperature C (dynamic measurement in 1.5% solution) Gel strength (1.5% gel) 2300 g/cm 2 Electroendosmosis (-m r ) Sulphate 0.05% Loss on drying 10% Residue on ignition 1.0% DNase and RNase activity and DNA binding None COMPANION PRODUCTS GeneCraft Agarose S 18000, GeneCraft Agarose S-IM GC-BMA g

81 GeneCraft AGAROSE S For preparative and analytical separation of nucleic acids < 1000 bp. Für die präparative und analytische Trennung von Nukleinsäuren < 1000 bp. 81 GeneCraft Agarose S offers very fine and consistent resolution of nucleic acid fragments below 1000 bp. The agarose is capable of separating DNA or RNA fragments, which only differ with few a basepairs. The fine physical properties of GeneCraft Agarose S provide the opportunity consistently to decide the perfection and size of amplified fragments, in vitro translation, transcriptional mapping and small restriction digestion fragments. In addition, GeneCraft Agarose S offers high gel strength, which provides easy-to-handle, flexible gels for electrophoresis of small DNA and RNA fragments. For separation of nucleic acids > 1000 bp we recommmend to use GeneCraft Agarose LSL 8100, which offers superior resolution of high molecular weight fragments. GeneCraft Agarose S is manufactured and quality-controlled under very stringent conditions and in accordance with ISO 9000 certified quality system to ensure conformance with the demanding requirements of nucleic acid applications. SPECIFICATION Gelling temperature C (dynamic measurement in 4% solution) Melting temperature (4% solution) 92 C Gel strength (4% gei) 1200 g/cm 2 Electroendosmosis (-m r ) Sulphate 0.15% Loss on drying 10% Residue on ignition 1.0% DNase and RNase activity and DNA binding None COMPANION PRODUCTS GeneCraft Agarose LSL 8100, GeneCraft Agarose S-IM GC-BMA g GeneCraft Agarose S weist eine ausgezeichnete und gleichbleibende Auflösung von Nukleinsäure-Fragmenten unter 1000 bp auf. Die Agarose ist für die Trennnung von DNA und RNA geeignet, die sich nur durch ein paar Basenpaare voneinander unterscheiden. Die ausgezeichneten physikalischen Eigenschaften der GeneCraft Agarose S ermöglicht immer wieder die Bestimmung von Erfolg und Größe amplifizierter Fragmente, in-vito Translationen, Transkriptions-Kartierungen und kleiner Fragmente nach Restriktions-Verdaung. Darüber hinaus bietet GeneCraft Agarose S eine hohe Gel-Festigkeit, was einfach zu handhabende, flexible Gele für die Elektrophorese von kleinen DNA- und RNA-Fragmenten gewährleistet. Für die Trennung von Nukleinsäuren > 1000 bp empfehlen wir GeneCraft Agarose LSL 8100, welche eine äußerst hohe Auflösung von Nukleinsäure-Fragmenten mit hohem Molekulargewicht bietet. GeneCraft Agarose LSL 8100 ist unter äußerst strengen Bedingungen nach ISO 9000 hergestellt und kontrolliert worden, um die Anforderungen im Einsatzbereich von Nukleinsäuren voll erfüllen zu können.

82 82 GeneCraft AGAROSE S-IM For high resolution and analytical separation of nucleic acids < 1000 bp. GeneCraft agarose S-IM is an intermediate melting temperature agarose which offers unique resolution capabilities. It is ideally suited for electrophoretic separation and analysis of nucleic acid fragments below 1000 bp. GeneCraft agarose S-IM forms a clear and highly resolving gel which can separate DNA fragments down to a 2% difference between 200 bp and 800 bp. In addition, it is easy to prepare and cast. The high resolution capabilities of GeneCraft agarose S-IM make a perfect choice for separation of amplified products as well as STRs and tri- and tetranucleotide repeats. For separation of nucleic acids > 1000 bp, we recommend GeneCraft agarose LSL 8100 which offers superior resolution of high molecular weight DNA fragments. GeneCraft agarose S-IM is manufactured and quality-controlled under very stringent conditions and in accordance with ISO 9000 certified quality system to ensure conformance with the demanding requirements of nucleic acid applications. Für die präparative und analytische Trennung von Nukleinsäuren < 1000 bp. GeneCraft Agarose S-IM ist eine bei mittleren Temperaturen schmelzende Agarose, die einzigartige Auflösungseigenschaften besitzt. Diese Agarose ist für Elektrophoresen mit Nukleinsäure-Fragmenten unter 1000 bp ideal geeignet. GeneCraft Agarose S-IM bildet ein klares und hochauflösendes Gel, welches DNA-Fragmente einer Größe zwischen 200 und 800 bp mit bis zu 2%-igem Unterschied trennt. Die hochauflösenden Eigenschaften der GeneCraft Agarose S-IM bietet eine perfekte Auswahl bei der Trennung von amplifizierten Produkten, sowie STRs und Tri- bzw. Tetranukleotid-Wiederholungen. Für die Trennung von Nukleinsäuren > 1000 bp empfehlen wir GeneCraft Agarose LSL 8100, welche eine äußerst hohe Auflösung von Nukleinsäure-Fragmenten mit hohem Molekulargewicht bietet. GeneCraft Agarose S-IM ist unter äußerst strengen Bedingungen nach ISO 9000 hergestellt und kontrolliert worden, um die Anforderungen im Einsatzbereich von Nukleinsäuren voll erfüllen zu können. SPECIFICATION Gelling temperature 36 C (dynamic measurement in 3% solution) Melting temperature (3% solution) 75 C Gel strength (3% gei) 400g/cm 2 Electroendosmosis (-m r ) Sulphate 0.25% Loss on drying 10% Residue on ignition 1.0% DNase and RNase activity and DNA binding None COMPANION PRODUCTS GeneCraft Agarose LSL 8100, GeneCraft Agarose S GC-BMA g

83 BOUNDED ETHIDIUM BROMIDE AGAROSE To avoid usage of hazardous Ethidium bromide and improve the gel resolution, we introduce the novel Ethidium bromide (EtBr) bounded Agarose. Um die gesundheitsgefährdende Handhabung mit Ethidium Bromid zu verhindern, empfehlen wir die neue mit Ethidium Bromid gebundene Agarose. Außerdem verbessert dieses Produkt die Auflösung des Gels. 83 A B A B A Chemical bounded EtBr-agarose gels B Non bounded (standard) agarose gels with EtBr DNA fragments- 1 kb and 100bp ladders 1% - agarose 1,5% - agarose COMPANION PRODUCTS Agarose LSL 8100, Agarose S 18000, Agarose S-IM GC-EtBrAgarose 100 g

84 STREPTAVIDIN-COATED PARTICLES Cat. No. GC-SER ml 1% MAGNETIC STREPTAVIDIN-COATED PARTICLES 84 Sera-Mag MG-SA microparticles have a highly unique surface. These particles combine the fast magnetic response time of a 1 µm particle with the high biotin binding capacities and fast reaction kinetics of a 0.3 µm particle. Three levels of biotin binding capacity (low, medium and high) are available. Sera-Mag MG- SA microparticles are colloidally stable in the absence of a magnetic field. When a magnetic force is applied, the particles are separated from suspension rapidly and completely. Covalently-bound Streptavidin Super-Paramagnetic Cat. No. GC-SER ml 1% Sera-Mag MG-SA Mikropartikel besitzen eine absolut einzigartige Oberfläche. Diese Partikel vereinen die schnellen magnetischen Reaktionszeiten eines 1 µm Partikels mit dem hohen Biotin-Bindungsvermögens und der schnellen Reaktions-Kinetik eines 0.3 µm Partikel. Drei verschiedene Stärken des Biotin-Bindungsvermögens (niedrig, mittel und hoch) sind erhältlich. Sera-Mag MG-SA Mikropartikel sind außerhalb von magnetischen Feldern weiterhin stabil. Wird ein magnetisches Feld angelegt, so können die Partikel schnell und restlos aus der Suspension entfernt werden. Uniform 1 Micron Diameter CARBOXYLATE-MODIFIED PARTICLES Cat. No. GC-SER ml 10% MAGNETIC CARBOXYLATE-MODIFIED PARTICLES Sera-Mag MG-CM microparticles have a highly unique surface. These particles combine the fast magnetic response time of a 1 µm particle with the high biotin binding capacities and fast reaction kinetics of a 0.3 µm particle. Sera-Mag MG-CM microparticles are collloidally stable in the absence of a magnetic field. When a magnetic force is applied, the particles are separated from suspension rapidly and completely. Covalent coupling to carboxyl groups on the surface is easily accomplished using the Seradyn standard coupling technology. Patent Granted Uniform 1 Micron Diameter Super-Paramagnetic Sera-Mag MG-CM Mikropartikel besitzen eine absolut einzigartige Oberfläche. Diese Partikel vereinen die schnellen magnetischen Reaktionszeiten eines 1 µm Partikels mit dem hohen Biotin-Bindungsvermögens und der schnellen Reaktions-Kinetik eines 0.3 µm Partikel. Sera-Mag MG-CM Mikropartikel sind außerhalb von magnetischen Feldern weiterhin stabil. Wird ein magnetisches Feld angelegt, so können die Partikel schnell und restlos aus der Suspension entfernt werden. Kovalente Bindungen an die Carboxyl-Gruppen auf der Oberfläche werden unter Verwendung der Standard-Techniken von Seradyn perfekt ausgebildet. For detailed technical information visit the Seradyn web page at Cat. No. GC-SER ml 10%

85 MagicTubes FOR PERFECT PCR In MagicTubes (pending patent) we realize a new approach to the increase of PCR specificity and reaction product yield. The advantages of the MagicTubes can be especiallly revealed at the PCR amplification of difficult templates (GC-rich DNA sequences, templates with complex structure etc.), when performing the multiplex PCR and at the amplification of small quantities of the initial DNA. MagicTubes are very easy to use, crystals of magnesium salt are fixed on inner walls by a special polymer. This polymer provides conditions for strong hot start of PCR by means of magnesium ion diffusion regulation. The performing of the hot start in MagicTubes instead of wax-barrier, manual, or antibodymediated hot starts to prevent nonspecific amplification and primer-dimer formation, provides enhancing the specifity and sensitivity of PCR. Since no extra reagents (as antibody) are added during setup, there is no risk of contamination of eucariotic DNA traces from antibody solution or due to re-opening reaction tubes after heating as in manual hot start. Mit den MagicTubes (zum Patent angemeldet) sind wir bei den Bemühungen Spezifität und Ausbeute von PCR-Reaktionen zu erhöhen einen großen Schritt weitergekommen. Die herausragenden Vorteile der MagicTubes zeigen sich besonders bei der Amplifikation schwieriger Templates (GC-reiche DNA-Sequenzen, Templates mit komplexer Struktur etc.), bei der Durchführung von Multiplex-PCR und der Amplifikation mit einer sehr geringen Menge Template-DNA. MagicTubes sind in der Handhabung sehr einfach, Kristalle eines Magnesiumsalzes sind mit Hilfe eines speziellen Polymers an der inneren Wand der Tubes fixiert. Dieses Polymer schafft aufgrund der Regulation mit diffundierenden Magnesium-Ionen stabile Bedingungen für eine hot start PCR. Die Durchführung einer hot start in den MagicTubes, statt der Verwendung von Wachs, einer manuellen oder Antikörper-vermittelten hot start, um unspezifische Amplifikationen und die Bildung von Primer-Dimeren zu verhindern, verstärkt die Spezifität und Sensitivität der PCR. Da keine zusätzlichen Reagenzien (wie z.b. Antikörper) zugegeben werden besteht kein Risiko der Kontamination mit Spuren eukaryotischer DNA aus der Antikörper-Lösung bzw. aufgrund des nochmaligen Öffnens der Tubes nach dem Heizschritt wie es in manuellen hot start nötig ist. 85 APPLICATIONS Obtain the hot start effect using ordinary (i.e. unmodified by antibodies or chemically) DNApolymerases Reduce nonspecific amplification product caused by low-temperature priming Increase the reaction specifity Increase the yield of the target PCR product PROTOCOL 1. Prepare the full reaction mixture with MagicBufffer and Taq-polymerase. (If you use another enzyme, you should adjust the reaction buffer to your enzyme by AdjustingBuffer application.) 2. Add the full reaction mixture into the MagicTube 3. Incubate for 5 min. at C 4. Start cycling the PCR reaction: C 30 sec C sec C 30 sec. NOTES In order to achieve the best results, the PCR with Taqpolymerase should be performed with the 10x reaction Magic-buffer provided with MagicTubes. This reaction-buffer was specially developed for the performing of the PCR with Taq-polymerase in MagicTubes. MagicTubes can be used with various polymerases and not only with Taq, as the reaction buffer can be easily adjusted to the properties of the enzymes used in the PCR.

86 MagicTubes FOR PERFECT PCR In order to optimize your reaction mixture to the used enzyme, the 10x Adjusting-buffer should be used with the Magic-buffer (as shown in the table) for the reaction mixture preparation. 86 Polymerases Mg 2+ concentration Volume of 10x Volume of 10x required for ordinary PCR MagicBuffer (mkl) AdjustingBuffer (mkl) Taq, Tth, BioTherm mm 10 0 Pfu, Pwo, Vent, mm 4 6 DeepVent KlenTaq, KlenTherm, mm 2 8 KlenThermN, Synergy AccuTherm mm bp Optimization of the reaction mixture to used polymerase by 10x AdjustingBuffer application. (Final volume of PCR mixture 100 mkl) It is possible to prepare and store the PCR mixture at room temperature. ATTENTION! 1. The 10x reaction MagicBuffer provided is optimized for the application with Taq-polymerases 2. The reaction hot start is achieved by the 5-minutes preheating at the temperature of C during the first PCR cycle 3. When the 10x MagicBuffer is used, Mg 2 + should not be added to the reaction mixture 4. The recommended volume of the reaction mixture is µl INCREASED SPECIFITY OF PCR IN MAGICTUBES A 180 bp DNA-fragment was amplified from 50 ng of human genomic DNA for 30 cycles. Hot start was performed manually (the enzyme was brought in into the 94 C preheated reaction mixture) (lanes 1, 2) or with the use of MagicTubes (lanes 3, 4). The PCR was performed in the volume of 25 µl containing 0.5 activity units (lanes 1, 3) or 2.0 activity units (lanes 2, 4) of Taq polymerase accordingly. Lane 5: molecular weight marker OPTIMIZATION EXPERIMENTS We found that optimization of the amplifications is critical to get amplification products with the Magic- Tubes. In two optimization experiments we were able to get amplification when we increased the amount of Taq DNA Polymerase in each reaction and/or when we optimized the magnesium level using both the 10x Magic Buffer and 10x Adjusting Buffer. The methods and results for these two experiments are given below. In these experiments the magnesium concentration was titrated using the 10x Magic buffer and 10x Adjusting buffer. The four different levels of magnesium were generated as recommended in the Magic- Tubes literature: mM, mM, mM, and mM. Three levels of Taq DNA Polymerase were used in the 50ml reactions: 1.25U, 2.5U and 4U. As a positive control, amplifications in Promega s Thermophilic DNA Polymerase buffer with 1.5mM magnesium in Gene Amp tubes were included. Amplification of a 1.5kb fragment from plasmid DNA that requires hot start amplification. Final concentration of the components: 1x buffer 200 µm each dntp (datp, dctp, dgtp, dttp) 0.2 µm upstream primer 0.2 µm downstream primer 20 pg/µl plasmid template in 50 µl reactions The reactions were assembled at room temperature and tubes were put into a room temperature thermal cycler. THERMAL CYCLING CONDITIONS 1 cycle (5 min. at 95 C) 30 cycles (30 sec. at 93 C, 45 sec. at 60 C, 1 min. at 72 C) 1 cycle (5 min. at 72 C)

87 MAGICTUBES FOR PERFECT PCR M M Figure 1 Hot Start amplification using a template/primer pair that requires hot start amplification MagicTubes were used in lanes 1-16 and Gene Amp tubes were used in lanes Magnesium titrations were done: lanes 1-4 Magic buffer only to give mM magnesium, lanes 5-8 Magic and Adjusting buffers to give mM magnesium, lanes 9-12 Magic and Adjusting buffers to give mM magnesium, lanes Adjusting buffer only to give mM magnesium, lanes Promega Thermophilic DNAP buffer with 1.5mM magnesium. Three levels of Taq DNA Polymerase were used: lanes 1, 5, 9, 13, 17 had 1.25U Taq DNA Polymerase/50ml reaction, lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 had 2.5U Taq DNA Polymerase/50ml reaction, lanes 3, 7, 11, 15,19 had 4U Taq DNA Polymerase/50ml reaction. No template control reactions: lanes 4, 8, 12, 16, 20. Lane M is pgem DNA Markers. Amplification of a 1.3kb beta-globin fragment from human genomic DNA that does not require hot start amplification Final concentration of the components: 1x buffer 200 µm each dntp (datp, dctp, dgtp, dttp) 1 µm upstream primer 1 µm downstream primer 100 ng human genomic DNA template in 50 µl reactions The reactions were assembled at room temperature and tubes were put into a room temperature thermal cycler. THERMAL CYCLING CONDITIONS 1 cycle (5 min. at 95 C) 35 cycles (30 sec. at 95 C, 30 sec. at 60 C, 1 min. at 72 C) 1 cycle (5 min. at 72 C) Figure 2 Amplification using a template/primer pair that does not require hot start amplification. MagicTubes were used in lanes 1-16 and Gene Amp tubes were used in lanes Magnesium titrations were done: lanes 1-4 Magic buffer only to give mM magnesium, M M lanes 5-8 Magic and Adjusting buffers to give mM magnesium, lanes 9-12 Magic and Adjusting buffers to give mM magnesium, lanes Adjusting buffer only to give mM magnesium, lanes Promega Thermophilic DNAP buffer with 1.5mM magnesium. Three levels of Taq DNA Polymerase were used: lanes 1, 5, 9, 13, 17 had 1.25U Taq DNA Polymerase/50ml reaction, lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 had 2.5U Taq DNA Polymerase/50ml reaction, lanes 3, 7, 11, 15, 19 had 4U Taq DNA Polymerase/50ml reaction. No template control reactions: lanes 4, 8, 12, 16, 20. Lane M is pgem DNA Markers. 87 GC GC pcs./bulk+buffer, 0,2 ml tube-volume 100 pcs./bulk+buffer, 0,5 ml tube-volume

88 88 LABORATORY CONSUMABLES GeneCraft distributes products of the companies Alpha Laboratories Ltd. (UK) and Brand GmbH (Germany). If you are interested in closer informations of these companies, please contact us and we will be pleased to send you catalogs of our partners. GeneCraft vertreibt Produkte der Firmen Alpha Laboratories Ltd. (UK) und Brand GmbH (Deutschland). Wenn Sie an weiteren Informationen über diese Firmen interessiert sind, dann setzen Sie sich bitte mit uns in Verbindung. Wir werden Ihnen dann gerne Kataloge unserer Partnerfirmen zusenden.

89 ALPHABETICAL PRODUCT INDEX 89 Product Page Product Page A B C D G H I K AccuTherm DNA polymerase 36 Acrylamide solutions 76 Agarose LSL Agarose S Agarose S-IM Amoniumpersulfate 79 BioTherm DNA polymerase 5 BioThermAB DNA polymerase 22 BioThermBio DNA polymerase 17 BioThermMix 8 BioThermRed DNA polymerase 14 BioThermStar DNA polymerase 18 BioThermStarMix DNA polymerase 20 BioThermT DNA polymerase 15 Biotin-4-dUTP 61 Biotin-11-dUTP 61 Bounded ethidium bromide agarose 83 BstE II-l-DNA marker 66 CoverIt 12 Crystal violet buffer 13 DNA cycle sequencing kit 32 DNA marker DNA polymerization mix 20 & DNA purification kit 73 dntp custom service 61 dntps 60 dntp set 59 GeneScript reverse transcriptase 48 Hot Start PCR compound 24 Hot Start Taq monoclonal antibody 23 Hpa II-pBS-DNA marker 67 IPTG 75 Klenow Fragment 50 KlenTherm DNA polymerase 25 KlenThermase DNA polymerase 31 KlenThermaseN DNA polymerase 32 KlenThermN DNA polymerase 28 KlenThermPlatinum DNA polymerase 29 L M N P R S T U Ladder, 100 bp 71 Ladder, 1 kb 72 Laemmli-buffer 78 λ DNA 62 MagicTubes for perfect PCR 85 Marker MegaPure DNA purification kit 73 Monoclonal IgG to Thermus aquaticus DNA polymerase 74 NeoTherm DNA polymerase 10 Nucleotides Particles 84 pbs-ks-ecorv 66 PCR-Grade H 2 O 12 Pyrophosphatase, Tth 34 Random Prime labeling kit 58 Restriction endonucleases 55 Reverse transcriptase 48 RNA polymerase, SP6 54 RNase Inhibitor 49 SDS-Tris-Glycin buffer 78 SP6 RNA polymerase 54 SupraTherm DNA polymerase 11 Synergy DNA polymerase 38 SynergyN DNA polymerase 39 SynergyPlus DNA polymerase 41 SynergyT DNA polymerase 40 T7 RNA polymerase 54 T-Vector System 63 TBE buffer 78 TEMED 79 Treponema pallidum recombinant antigen - tmpa 74 Tth inorganic pyrophosphatase 34 TthPlus DNA polymerase 42 T4 polynucleotide kinase 51 T4 DNA ligase 52 Tth DNA ligase 53 Uracil-DNA glycosylase 62

90 FAX-BESTELLUNG NAME DATUM KUNDEN NR. 90 UNTERNEHMEN/ UNIVERSITÄT ADRESSE TEL./ FAX / BESTELLUNG POS. BESTELL NR. PAKETGRÖSSE PREIS GESAMTPREIS Alle Preise gelten zuzüglich der 16% Mehrwertsteuer. Für Bearbeitung, Verpackung, Versand und den umweltfreundlichen Rückholservice werden innerhalb Deutschlands Euro 15,- berechnet. Die Lieferung erfolgt gegen offene Rechnung. Rechnungen sind innerhalb von 30 Tagen nach Rechnungsdatum zur Zahlung fällig. Preise gemäß der jeweils aktuellen Preisliste (siehe Anlage). Bitte faxen Sie uns Ihre Bestellung zu oder schicken sie per oder Post an: GENECRAFT GmbH Adresse Raiffeisenstr. 12, Lüdinghausen Tel Bestell-Fax [email protected]

91 THAT S NEW Ab sofort erhalten Sie bei uns bis auf weiteres auf alle Brand Produkte 5% Rabatt. Möchten Sie unsere Produkte einmal austesten? Kein Problem! Wir schicken Ihnen gerne von unseren Enzymen, dntps, Markern und Kits kostenlose Proben zu. Selbstverständlich berechnen wir dabei keine Versandund Verpackungsgebühr. Bei Ihrer ersten Bestellung erhalten Sie von uns einen Einführungsrabatt von 20% - ganz gleich, was oder wieviel Sie bestellen. Beim Kauf von insgesamt 5000 u thermostabiler DNA Polymerasen erhalten Sie von uns auf Wunsch kostenlos einen DNA Polymerization Mix 10. Wir liefern Ihnen alle unsere Produkte in unterschiedlichen Packungsgrößen nach Ihrem Wunsch - selbstverständlich ohne Preisaufschlag. Bei GeneCraft gibt es keine Mindestbestellmengen! Jede Bestellung ist stets willkommen. Selbstverständlich richten wir Ihnen auch gerne ein Konto ein. Sollten Sie daran interessiert sein, so setzen Sie sich doch einfach mit uns in Verbindung. Wir sind ständig darum bemüht, unser Warenangebot zu erweitern. Alle Produkte, die nach Druck unseres Kataloges hinzugekommen sind, haben wir in der Preisliste mit NEW gekennzeichnet. Beschreibungen zu diesen Waren finden Sie als Beilagen in unserem Katalog. Produkte, die Sie vor 14:30 Uhr (Mo-Do) bestellen, werden noch am selben Tag durch UPS abgeholt und sind am nächsten Tag in Ihrem Labor. Für den Versand verwenden wir Kühlakkus, die zuverlässig die notwendige Kühlung unserer Produkte während des Transports gewährleisten. Die wertvollen Kühl-Verpackungen werden regelmässig wieder abgeholt und an uns retourniert. Das schont auch die Umwelt! Bitte stellen Sie aus diesem Grunde die Boxen mit Kühlakkkus für die Rückführung durch den Fahrer bereit. Wir bitten Sie um Verständnis, dass wir die realen Kosten für Verpackung und Versand nicht in unserer Preisliste verstecken, sondern die tatsächlichen Kosten von 15,- berechnen. Alle Preise gelten zuzüglich der 16% Mehrwertsteuer. Für die Bearbeitung, Verpackung, den UPS-Versandkostenanteil und den umweltfreundlichen Rückholservice werden 15,- berechnet. Die Lieferung erfolgt gegen offene Rechnung. Rechnungen sind innerhalb von 30 Tagen nach Rechnungsdatum zur Zahlung fällig. 91

92 GENECRAFT GmbH Adresse Raiffeisenstr. 12, Lüdinghausen Tel Bestell-Fax E N Z Y M E S F O R M O L E C U L A R B I O L O G Y