Anti- HBc-Bestimmung: Sinn oder Unsinn Blood donor screening for anti-hbc sense or nonsense? Michael Schmidt German Red Cross Blood Donor Service Baden-Wuerttemberg-Hessen and Johann Wolfgang Goethe University Frankfurt / Main, Germany Institute for Transfusion Medicine and Immunohematology
2 Transfusion transmitted hepatitis B virus infections in Germany Chudy et al. Hepatology 2006
3 3 Platelet and 4 Plasma Pheresis Donations Positive in Indiv. Donation PCR (ID-NAT) 9000 Apheresis Platelets 8000 7000 Donations Follow-up x Plasma Pheresis Follow-up samples Pool-PCR positive (Geq/ml) 6000 5000 4000 ID-PCR 3000 2000 Look-Back 1000 0 1 6 11 16 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 106 111 Days Chudy et al. Hepatology 2006
4 Mutation in the primer probe binding region AP160501: HBV G-Type Stuyver et al. 2000, J Gen Virol; 81:67-74 Start Precore Stop Codon 2 1801 gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgttcatgtcctac Stop Codon 28 Start Core Insert 36 bp 1861 tgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc T Mismatch in Sense Primer Insert 36 bp 1921 atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt 1981 gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttc 2041 agctttgtaccgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact T C Mismatch in Antisense Primer 2101 caggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa Chudy et al. Hepatology 2006
5 Recipient related look back examinations with 22 invloved erythrocytes Date Anti-HBc Anti-HBc IgM Anti-HBs HBsAg HBV-ID-NAT HBV transmission 30.08.03 Pos Neg 17IU/l Neg 2,3 IU/ml no* 14.06.03 Pos Neg Neg Neg 5,3 IU/ml Confirmed 22.03.03 Pos Neg N.t. Neg Neg No 11.01.03 Pos Neg Neg Neg 4,7 IU/ml Possible 26.10.02 Pos n. t. Neg n. t. Neg No 25.05.02 Pos n. t. Neg n. t. 11,6 IU/ml Possible 02.03.02 Pos n. t. Neg n. t. 9,1 IU/ml no* 15.12.01 Pos n. t. Neg n. t. 2,4 IU/ml No 02.08.01 Pos n. t. Neg n. t. 6,7 IU/ml No 05.05.01 Pos n. t. Neg n. t. 3,7 IU/ml Possible 17.02.01 Pos n. t. Neg n. t. 10,6 IU/ml No 25.11.00 Pos n. t. Neg n. t. 7,7 IU/ml not transfused * death cause of primiary disease Gubbe et al. DGTI
Diagnostic windows for HBV 6 1. diag. window 2. diag. window DNA concentration HBsAg detection level anti HBc LOD NAT DNA Anti-HBc detection level HBsAg EIA EIA s/co 0 2 4 6 8 10 Weeks after infection Years after infektion
7 Overwiev of TTID for HBV, HCV and HIV-1 in Germany 14 Einführung HCV PCR Einführung HIV-1 PCR Numbers of TTID per year (N) 12 10 8 6 4 2 Einführung Anti-HBc HBV HCV HIV Mutation in primer/ probe binding region 0 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 Time (years) Virus concentration (app. 10IU/ml) Funk, Haemovigilance report 2008
8 First description of a new molecular detection method 95 C 95 C 72 C 60 C 60 C Denaturation Annealing Elongation Denaturation Annealing 3 5 3 Karry Banks Mullis Nobel prize chemistry 1993
Schmidt et al. V ox Sang. 2010;98:37-46 Blood donor screening for anti-hbc - sense or nonsense? 9 Roche s201 MPX v1.0 or v2.0 and DPX v1.0 Pools of 6, 24, 48 or 96 samples
Wuesten et al. Transfusion. 2011;51:203-15 Blood donor screening for anti-hbc - sense or nonsense? 10 Novartis Tigris Ultrio Plus ID-NAT or Pools of 8 or 16 samples
Blood donor screening for anti-hbc - sense or nonsense? Introduction anti-hbc screening German Red Cross, Zelos x100 MP-NAT pools of 96 samples anti-hbc studies HBV strategies 11
Comparison of three automated NAT systems 12 Parameter Roche s201 Novartis GRC, FFM MPX assay Tigris Ultrio Plus Zelos x100 (IU/ml) (IU/ml) (IU/ml) HAV 1.06 in development 0.8 HBV 3.8 2.1 0.6 HCV 11.0 3.1 9.6 HIV-1 49.0 27.6 8.9 HIV-2 2.2 ND 1.2 PB19 11.5 in development 9.7
Comparison of automated NAT systems 13 Pathogene DRK Zelos x100 Roche s201 MPX/ DPX Novartis Tigris ultrio plus HAV YES YES Projected HBV YES YES YES HCV YES YES YES HIV-1 YES YES YES HIV-1 dual targeting YES Projected YES HIV-2 Projected YES No PB19 YES YES Projected Bacteria Bakterienstrains Projected No No
Blood donor screening strategy at the German Red Cross 14 Serological HBsAg (1975) TPHA (1970s/1984) Anti-HIV 1/2 (1985) Anti-HCV (1992) CMV (1995) Anti-HBc (2006) HIV Combo (2008) MP-Pool PCR HBV (1997) HCV (1997) HIV-1 (1997) HAV (2000) Parvo B19 (2000) HIV-2 * * HIV-2 is currently tested in a validation study
15
16
17
18
19
20
21
22
23
24
25
Schmidt et al. V ox Sang. 2006;91:237-43 Blood donor screening for anti-hbc - sense or nonsense? 26
Hourfar et al. Int J Lab Hematol. 2009;31:649-56 Blood donor screening for anti-hbc - sense or nonsense? 27
28
29 Case control study results donors
30 Case control study results recipients
31 Case control study results recipients subgroups
32
33 3,475,605 donations 697 HBsAg RR 687/697 anti-hbc 540/697 MP-NAT 612/697 ID-NAT Screening by HBV MP-NAT and anti-hbc missed no HBV infective donation out of 3.4 million donations 2 MP-NAT/ ID-NAT only pos
34 Residual transfusion transmitted infection risk Bacterial risks NAT onlies Viral risks Contaminated platelets 1:1.428 Septic reactions 1:50.000 22 23 7 HBV HCV HIV 1 : 360.000 (CI: 0.19-3.36 million) 1 : 10.88 million (7.51-19.72 million) 1 : 4.3 million (2.39-21.37 million) Schrezenmeier H. Transfusion. 2007; 47: 644-52 Hourfar KM Transfusion 2008;48:1558-66
Blood donor screening in Europe 35 provided by JP Allain
Blood donor screening by NAT world wide 36 HCV 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 HIV 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 HBV 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 INT F. NAT Vox Sanguinis 2011
NAT only blood donations world wide 37 Region/ country Virus Number of tested donations NAT only positive Rate/1.000.000 donations HIV-1 2,202,295 81 36.78 Africa HCV 2,202,295 4 1.82 HBV 2,202,295 76 34.51 HIV-1 71,458,330 44 0.62 Asia/ Pacific HCV 71,458,330 169 2.37 HBV 50,679,100 1091 21.53 HIV-1 110,860,111 73 0.66 Europe HCV 139,474,595 206 1.48 HBV 56,352,555 550 9.76 HIV-1 87,652,586 45 0.51 North America HCV 89,652,687 299 3.34 HBV 5,062,264 11 2.17 HIV-1 347,374 1 2.88 South America HCV 408,167 2 4.90 HBV Not done Not done HIV-1 272,520,696 244 0.90 Total HCV 303,196,074 680 2.24 HBV 114,286,214 1,728 15.12 INT F. NAT Vox Sanguinis 2011
38 Testing strategy Acute infections Chronic infections Mini-pool NAT HBsAg Mini-pool NAT Anti-HBc
RKI Epidem. Bulletin 2011 Blood donor screening for anti-hbc - sense or nonsense? 39 25. Juli 2011 Epidemiologisches Bulletin Nr. 29 Robert Koch-Institut 263 Erkr. pro 100.000 Einw. 8 7 6 5 IfSG, nicht Referenzdefinition IfSG, Referenzdefinition BSeuchG 4 6.135 1.521 3 5.232 4.570 4.601 1.465 1.385 1.488 2 1.236 1.346 1.202 2.344 1.030 953 1.076 1 1.420 1.314 1.271 1.237 1.185 1.002 820 754 767 0 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 Meldejahr Abb. 1: An das RKI übermittelte Hepatitis-B-Fälle pro 100.000 Einwohner nach Meldejahr, Deutschland, 1997 2010 (in den Säulen: Anzahl der Fälle absolut)
RKI Epidem. Bulletin 2011 Blood donor screening for anti-hbc - sense or nonsense? 40 Anteil Geimpfter in % 100 80 vollständig begonnen 71 81 84 86 87 90,2 90,5 90,3 60 45 57 40 26 20 0 8 15 14 11 7 5 4 4 4 2 3,4 3,8 1996 1997 99 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 Abb. 6: Anteil gegen Hepatitis B geimpfter Kinder bei Einschulung, 1996 2009, Daten der Schuleingangsuntersuchungen (Stand: April 2011) Jahr
Conclusions 41 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: 360.000 for HCV, HIV-1 and HBV, respectively
Conclusions 42 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: 360.000 for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B)
Conclusions 43 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: 360.000 for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app. 20-30%
Conclusions 44 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: 360.000 for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app. 20-30% Re-entry strategies based on HBV ID-NAT and anti-hbs screening are safe and able to reduce the lost of unspecific reactive blood donors
Conclusions 45 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: 360.000 for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app. 20-30% Re-entry strategies based on HBV ID-NAT and anti-hbs screening are safe and able to reduce the lost of unspecific reactive blood donors More specific confirmation tests are still necessary for anti- HBc only reactive blood donations
Conclusions 46 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: 360.000 for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app. 20-30% Re-entry strategies based on HBV ID-NAT and anti-hbs screening are safe and able to reduce the lost of unspecific reactive blood donors More specific confirmation tests are still necessary for anti- HBc only reactive blood donations No transfusion transmitted HBV infections after introduction of anti-hbc in 2006 in our blood donor service
Acknowledgement 47 E. Seifried W. Sireis M.K. Hourfar B. Rüster K. Gubbe G. Capalbo H. Klüter H. Schrezenmeier K. Janetzko U. Mayr-Wohlfart