Über Gentests berichten die Medien aber Gentest Gentest

Transkript

1 Zentrum für Kardiovaskuläre Genetik und Gendiagnostik c/o Stiftung für Menschen mit seltenen Krankheiten SIM Jahrestagung 2014 Genetische Abklärung zu medizinischen Zwecken Olten, 13. März 2014 PD Dr. Gabor Matyas, FAMH Medizinische Genetik Leiter Zentrum für Kardiovaskuläre Genetik & Gendiagnostik Geschäftsleiter Stiftung für Menschen mit seltenen Krankheiten Über Gentests berichten die Medien aber Gentest Gentest

2 3 Personalisierte Medizin: die SAMW warnt vor Fehlentwicklungen Die Schweizerische Akademie der Medizinischen Wissenschaften (SAMW) befürchtet, dass Patientinnen und Patienten unnötig verunsichert werden, wenn sie ohne qualifizierte ärztliche Beratung mit Ergebnissen von Gentests konfrontiert werden. Sie warnt insbesondere vor unseriösen Gentest-Angeboten aus dem Internet und fordert eine bessere Aufklärung der Bevölkerung über Nutzen und Risiken von genetischen Untersuchungen. Die neuen technischen Möglichkeiten dürfen die persönliche Arzt-Patienten-Beziehung nicht verdrängen, sondern sollen in die ärztliche Beratung eingebettet werden. «Ohne richtige Interpretation Verkommt der Gentest zum Horoskop.» az az 4

3 GWAS: Genome-Wide Association Study 5 Penetrance: high/full penetrance, low/reduced penetrance Expressivity: describes quantitative differences in the manifestation of the disease

4 Gentest ist nicht gleich Gentest DNA Exons Gentest Gentest Splicing direkte vs. indirekte Analyse Protein von Transkript: bekannten ~10 vs. Kilobasen unbekannten Mutationen, Synthese N Protein: Analyse von einzelnen vs. Protein sämtlichen 2871 Aminosäuren Mutationen bzw. Faltung C Genen, Disulfidbrückenbildung Analyse von Exom vs. Calcium-Bindung Genom Ca Ca Glykosylierung Indirect testing is used when the gene or disease-causing mutation cannot Ca Ca be directly identified/analyzed but can be located within a specific region of a chromosome Downing et al Cell 85: Marker (e.g. SNP) Disease-causing mutation ACHTUNG: Bei 23andme werden nicht die einzelnen Gene auf Mutationen untersucht, sondern vorwiegend nur Risikofaktoren (ausgewählte SNPs). Daraus wird dann eine Wahrscheinlichkeit abgeleitet, ob man die Krankheit bekommt. 8

5 Grundlagen der Humangenetik (Einführung)

6 Das menschliche Erbgut (DNA) Zellkern Mitochondrium mtdna Chatterjee et al., Oncogene (2006) 25: The Human Genome (1) Nuclear genome (ndna) Size 3200 Mb 16.6 kb No. of different DNA molecules 23 (in XX cells) or 24 (in XY cells); all linear One circular DNA molecule Total no. of DNA molecules/cell 46 in diploid cells (varies in ploidy) Often several thousand (but variable) Associated protein Several classes of histone and nonhistone protein Largely free of protein No. of genes ~20, (13 polypeptides, 2 rrnas, and a set of 22 trnas) Gene density ~1/100 kb 1/0.45 kb Repetitive DNA Over 50% of genome Very little Transcription The most genes are transcribed individually Co-transcription of multiple genes from both the H and L strands Introns Found in most genes Absent % of coding DNA ~1.5% (~50 Mb) ~93% Mitochondrial genome (mtdna) Recombination At least once for each pair of homologs at meiosis Not evident (mtdna can replicate independently of ndna) Inheritance Mendelian for sequences on X and autosomes Exclusively maternal paternal for sequences on Y Codon usage Four codons are interpreted differently in the nucleus (N) and mitochondria (M): UGA = Stop(N), Trp(M); AUA = Ile (N), Met (M); AGA+AGG = Arg (N), Stop (M) mtdna Chatterjee et al., Oncogene (2006) 25:

7 Das menschliche Erbgut (DNA) Chromosom 15 DNA Gen Exons Downing et al Cell 85: Splicing Protein Synthese Protein Faltung Ca N... Ca Ca Gen: Abschnitt der DNA, der die Information zur Herstellung eines Proteins trägt... Ca C Transkript: ~10 Kilobasen Protein: 2871 Aminosäuren Disulfidbrückenbildung Calcium-Bindung Glykosylierung Das menschliche Erbgut (DNA) Chromosom 15q21.1 DNA FBN1: ~237,000 nucleotides Exons Downing et al Cell 85: Splicing Protein Synthese Protein Faltung Ca N... Ca Ca Gen: Abschnitt der DNA, der die Information zur Herstellung eines Proteins trägt... Ca C Transkript: ~10 Kilobasen Protein: 2871 Aminosäuren Disulfidbrückenbildung Calcium-Bindung Glykosylierung

8 Random monoallelic expression on the human autosomes (A) ~5 to 10% of assessed autosomal genes display random monoallelic transcription in human cells. (B) Distribution along autosomes of randomly monoallelically expressed and biallelic genes (brown boxes mark centromeres). (C) Gene-level view of allele-specific expression on chromosome 18 in clonal cell lines from three individuals. BUT, monoallelic expression also occurs due to genomic imprinting (*) (e.g. on chromosomes 11p, 15q): Paternally imprinted, maternally expressed maternal Gene 1 paternal* Gene 1 Maternally imprinted, paternally expressed maternal* Gene 2 paternal Gene 2 Gimelbrant et al., Science (2007) 318: *Imprinting: genetic information can be manifested in a different way when it is inherited from the mother than when it is inherited from the father Das menschliche Erbgut (DNA) Chromosomen (Karyotyp)

9 The Human Genome (2): X Chromosome Inactivation In the early XX female zygote, both X chromosomes are active. In der Embryonalentwicklung findet die X-Inaktivierung etwa zum Zeitpunkt der Differenzierung der pluripotenten Zellen zu verschiedenen Zellschichten statt, also während des Blastozystenstadiums (ca. 5 Tage nach der Befruchtung; ~100 Zellen) Around the late blastocyst stage a choice is made randomly in each cell to inactivate either the paternal or the maternal X. The choice that a cell makes is preserved in all its descendants. Adapted from Migeon, Trends Genet (1994) 10: The Human Genome (2): X Chromosome Inactivation X-linked (dominant) Incontinentia pigmenti (IP) (one X chromosome harbors a mutation) An adult XX female has clonal populations of cells with the paternal (here normal) or maternal (here mutated) inactivated X chromosome. Skin abnormalities known as Blaschko's lines

10 Classification of Mutations by Effect on Structure 1. Genome mutations Numerical change of the whole chromosome set (e.g. triploidy (3n), tetraploidy (4n)) Numerical change of a single chromosome (e.g. trisomy 21, 18, 13) 2. Chromosomal mutations 3. Gene mutations Point mutations, deletions, insertions, inversions C>T A>G Single nucleotide polymorphisms (SNP) SNP is a DNA sequence variation occurring when a single nucleotide in the genome (or other shared sequence) differs between members of a species (or between paired chromosomes in an individual). Classification of Mutations by Effect on Structure 1. Genome mutations Numerical change of the whole chromosome set (e.g. triploidy (3n), tetraploidy (4n)) Numerical change of a single chromosome (e.g. trisomy 21, 18, 13) 2. Chromosomal mutations 3. Gene mutations Point mutations, deletions, insertions, inversions C>T A>G

11 Classification of Mutations by Effect on Structure 1. Genome mutations Numerical change of the whole chromosome set (e.g. triploidy (3n), tetraploidy (4n)) Numerical change of a single chromosome (e.g. trisomy 21, 18, 13) 2. Chromosomal mutations 3. Gene mutations Point mutations, deletions, insertions, inversions C>T A>G Dynamic mutations (tandem repeats that often change size on transmission to children) Anticipation: Dynamic mutations can lead to the earlier onset of disease 15 CAG-Repeats 49 CAG-Repeats Size standards (Gusella & MacDonald, 2000, Nat Rev Neurosci 1: ) Frühere Manifestation von Trinukleotidexpansionskrankheiten bei zunehmender Anzahl von Tripletts

12 Zunahme der Anzahl von Triplettwiederholungen bei aufeinanderfolgenden Generationen + Frühere Manifestation von Trinukleotidexpansionskrankheiten bei zunehmender Anzahl von Tripletts Antizipation: zunehmender Schweregrad oder frühere Manifestation einer genetisch bedingten Krankheit bei aufeinanderfolgenden Generationen 1. Monogenic disorders Classification of Disorders Heteroplasmy: a mixture of mutant and wild-type mtdna Inheritance recessive dominant maternal

13 Das menschliche Erbgut (DNA) Das menschliche Erbgut (DNA) FBN1-Gendefekt Chromosom 15

14 Genetische Abklärungen zu medizinischen Zwecken (am Beispiel von seltenen Aortenkrankheiten) Genetic Testing Why? Why is important the genetic assessment of patients? Why is important to know which gene is mutated? Why is important to know the diseases-causing mutation? PD Dr. G. Matyas

15 Why is Genetic Testing Important? To make an accurate diagnosis To know the genetic background of the aortic disease: Requirement for targeted management, therapy, prevention To clarify whether the aortic disease is inherited: clarification on unclear phenotype, presymptomatic genetic testing, prenatal diagnosis, and preimplantation genetic diagnosis (in Switzerland only by using polar bodies => applicable for affected females) For mutation databases and special studies (genotypephenotype studies, understanding of the molecular pathogenesis and phenotypic variability of aortic diseases) Richtige Diagnose Die Diagnose ist die wichtigste Voraussetzung für den Entscheid «Behandlung ja oder nein» und somit die Grundlage einer erfolgreichen Therapie und Prävention. Falsche oder fehlende Diagnosen können zu Fehlbehandlungen mit schwerwiegenden Auswirkungen oder zur Geburt weiterer schwer betroffener Kinder innerhalb einer Familie führen. Über die persönliche Betroffenheit hinaus entstehen dadurch auch erhebliche volkswirtschaftliche Kosten

16 Hereditary Aortic Diseases ACTA2 MYH11 MYLK TGFBR1 TGFBR2 TGFB2 TAAD LDS TGFBR1 TGFBR2 SMAD3 TGFB2 COL3A1 EDS IV MFS FBN1 ATS SLC2A10 AOS SMAD3 But several other genes have been associated with hereditary aneurysm conditions in humans and/or in mouse models, such as ACVRL1, COL1A1, COL1A2, COL4A1, COL4A5, EFEMP2, ELN, ENG, FLNA, GAA, GLA, GJA1, JAG1, KLF15, KLF2, LOX, MED12, NF1, NOS3, NOTCH1, NPHP3, PKD1, PKD2, PLOD1, PLOD3, PTPN11, S100A12, and TSC2 Loeys-Dietz aortic aneurysm syndrome (LDS) characterized by arterial aneurysms, tortuous arteries, Marfanoid habitus, and craniofacial features; Familial thoracic aortic aneurysms and dissections (TAAD), in which the phenotype is essentially restricted to the aorta; Vascular type of Ehlers Danlos syndrome (EDS IV), characterized by arterial rupture, thin/translucent skin, extensive bruising, characteristic facial appearance, and intestinal/uterine rupture; Aneurysms-osteoarthritis syndrome (AOS), a syndromic form of aortic aneurysms and dissections with early-onset osteoarthritis; PD Autosomal Dr. G. Matyas recessive arterial tortuosity syndrome (ATS) characterized by elongation, tortuosity, kink, and aneurysm formation in the major arteries. Marfan Syndrome (MFS) High Degree of Clinical Variability Royce PM, Steinmann B (eds) Connective Tissue and Its Heritable Disorders, p Autosomal dominant (AD) connective tissue disorder (affects 1-3:10,000 individuals): Skeletal features: increased height (bone overgrowth), joint laxity, long limbs and digits, chest and vertebral column deformity Ocular features: Neonatal MFS myopia, luxation of the lenses (ectopia lentis), increased axial globe length, corneal flatness Cardiovascular features: dilatation (aneurysm), dissection, and rupture of the aorta, mitral valve prolapse with or without mitral regurgitation Neonatal MFS Classical MFS Classical MFS MFS (aorta dilation and ectopia lentis) Luxation Wrist sign Thumb sign PD Dr. G. Matyas / 32

17 MFS Klinische Hauptmerkmale Skelett - Lange Arme (+Grosswuchs) - Verbiegung der Wirbelsäule - Hühner- oder Trichterbrust - Lange, verschmälerte Finger - Plattfüsse Augen - Linsenluxation: Lockerung des Halteapparates der Linse Kardiovaskuläres System - Dilatation der Aortenwurzel und/oder Dissektion der Aorta Klassisches MFS PD Dr. G. Matyas MFS Klinische Hauptmerkmale Kardiovaskuläres System - Dilatation der Aortenwurzel und/oder Dissektion der Aorta Klassisches MFS PD Dr. G. Matyas

18 MFS Klinische Hauptmerkmale Carrel et al., 2003, Schweiz Med Forum 46: Operativer Ersatz der geschädigten Aorta Kindly provided by Thierry Carrel PD Dr. G. Matyas Patient wurde falsch beurteilt und starb... an einem geplatzten Aorta-Aneurysma Der Patient litt am Marfan-Syndrom, einer angeborenen Wandschwäche der Gefässe. Rettung wäre möglich gewesen,... wenn sich die Ärzte richtig verhalten hätten.

19 MFS Variables Symptommuster Royce PM, Steinmann B (eds) Connective Tissue and Its Heritable Disorders, p Neonatales MFS Klassisches MFS Klassisches MFS Äusserlich kaum erkennbares MFS (Aortendilatation + Linsenluxation) PD Dr. G. Matyas Marfan Syndrome (MFS) MFS FBN1 mutation Overview PD Dr. G. of Matyas the revised diagnostic criteria for MFS according to Loeys et al., 2010 (adapted from Bolar et al., 2012)

20 Hereditary Aortic Diseases ACTA2 MYH11 MYLK TGFBR1 TGFBR2 TGFB2 TAAD LDS COL3A1 EDS IV MFS ATS SLC2A10 AOS But several other genes have been associated with hereditary aneurysm conditions in humans and/or in mouse models, such as ACVRL1, COL1A1, COL1A2, COL4A1, COL4A5, COL5A1, COL5A2, EFEMP2, ELN, ENG, FLNA, GAA, GLA, GJA1, JAG1, KLF15, KLF2, LOX, MED12, NF1, NOS3, NOTCH1, NPHP3, PKD1, PKD2, PLOD1, PLOD3, PTPN11, S100A12, TGFBR1 TGFBR2 SMAD3 TGFB2 FBN1 SMAD3 SKI, TGFB3 and TSC2 PD Dr. G. Matyas / 39 PD Dr. G. Matyas

21 Shprintzen-Goldberg syndrome (SGS) Craniofacial, skeletal, cutaneous and cardiovascular features of LDS+MFS PD Dr. G. Matyas Hereditary Aortic Diseases ACTA2 MYH11 MYLK TGFBR1 TGFBR2 TGFB2 TAAD LDS TGFBR1 TGFBR2 SMAD3 TGFB2 COL3A1 EDS IV MFS FBN1 ATS SLC2A10 AOS SMAD3 But several other genes have been associated with hereditary aneurysm conditions in humans and/or in mouse models, such as ACVRL1, COL1A1, COL1A2, COL4A1, COL4A5, COL5A1, COL5A2, EFEMP2, ELN, ENG, FLNA, GAA, GLA, GJA1, JAG1, KLF15, KLF2, LOX, MED12, NF1, NOS3, NOTCH1, NPHP3, PKD1, PKD2, PLOD1, PLOD3, PTPN11, S100A12, SKI, TGFB3 and TSC2 In the presence of artic aneurysm/dissection and absence of other discriminating clinical features, only genetic testing can distinguish aortic diseases, allowing accurate diagnosis. PD Dr. G. Matyas / 42

22 Disorder/syndrome Marfan syndrome AD ~1:5, IA, MVP FBN1 TGF ß ACTA2, MYH11, and MYLK related TAAD PTPN11 related Noonan and LEOPARD syndromes JAG1 related Alagille syndrome Aortic valve disease Congenital Contractural Arachnodactyly SKI related Shprintzen Goldberg Syndrome ELN related cutis laxa EFEMP2 related cutis laxa Arterial tortuosity syndrome Fabry disease, cardiac variant X linked Alport syndrome Inheritance AD AD AR AD AD AD AD AD AD AR AR XLD XL XL unknown ~1:2,000 (1:70,000) unknown unknown unknown (<1:4,000,000) (<1:4,000,000) unknown (~1:3,000) (<1:50,000) BAV, CAD (ACTA2), PDA pulmonary valve stenosis pulmonary valve stenosis, COA, IA, TOF BAV with valve calcification/dysfunction atrial/ventricular septal defects, MVP MVP, splenic artery aneurysm arterial stenoses arterial stenoses HCM Gene (karyotype) TGFBR1/TGFBR2 related Loeys Dietz TGFBR1, syndrome (LDS) and thoracic aortic AD unknown BAV, IA, MVP TGF ß TGFBR2 aneurysm/dissection (TAAD) SMAD3 related LDS, TAAD, and unknown AD ++ BAV, IA, MVP SMAD3 aneurysms osteoarthritis syndrome TGF Vasculopathies / +++ TGF ß TGFB2 related LDS and TAAD AD unknown ++ / BAV, MVP TGFB2 TGF ß Ehlers Danlos syndrome, vascular type (EDS IV) Ehlers Danlos syndrome, kyphoscoliotic form (EDS VIA) FLNA related periventricularheterotopia Prevalence (incidence) unknown Aortic aneurysm ~1:50,000 + (~1:100,000) + + Early aortic dissection ACTA2, MYH11, MYLK PTPN11 JAG1 NOTCH1 FBN2 SKI ELN EFEMP2 SLC2A10 GLA COL4A5 RAS MEK ERK NOTCH1 JAGGED1 NOTCH1 JAGGED1 TGF ß TGF ß unknown TGF ß TGF ß unknown collagen metabolism Turner syndrome sporadic (1:2,000) + ++ BAV, COA, IA, LVOTO (45,X) unknown (rupture) ++ (rupture) + Arterial tortuosity + Other cardiovascular features IA, MVP MVP BAV, PDA COL3A1 PLOD1 FLNA Pathway IGF 1, ANG II collagen metabolism collagen metabolism Extremely rare aortic aneurysm (AA) is caused by mutations in the genes COL1A1, COL1A2 or MED12, whereas mutations in the genes PLOD3, ENG, ACVRL1 or NF1 cause medium sized AAs. BAV, bicuspid aortic valve; CAD, coronary artery disease; COA, coarctation of the aorta; HCM, hypertrophic cardiomyopathy; IA, intracranial aneurysms; LVOTO, left ventricular outflow tract obstruction; MVP, mitral valve prolapse; PDA, patent ductus arteriosus; TOF, tetralogy of Fallot;, absent or not observed/reported; +, sporadic; ++, common; +++, typical; AD, autosomal dominant; AR, autosomal recessive; XL, X linked; XLD, X linked dominant Attenhofer Jost,, and Matyas, Curr Cardiol Rev 2014 unknown Fibrillin-1 Mutations Lead to Excessive TGFβ Signaling in MFS Altered TGF signaling appears to be a common pathway to aneurysm formation Canonical TGFβ Signaling Neptune et al. Nature Gen, 2003 Judge et al. JCI, 2004 Ng et al. JCI, 2004 PD Dr. G. Matyas Habashi et al. Science, 2006 Cohn et al. Nature Med, 2007 Bruce D. Gelb 2006, N Engl J Med 355:

23 Why is Genetic Testing Important? To make an accurate diagnosis To know the genetic background of the aortic disease: Requirement for targeted management, therapy, prevention To clarify whether the aortic disease is inherited: clarification on unclear phenotype, presymptomatic genetic testing, prenatal diagnosis, and preimplantation genetic diagnosis (in Switzerland only by using polar bodies => applicable for affected females) For mutation databases and special studies (genotypephenotype studies, understanding of the molecular pathogenesis and phenotypic variability of aortic diseases) Bedeutung der Gendiagnostik (Beispiel Marfan Syndrom) Gezieltes Management und gezielte Therapie: Eine Person mit einer pathogenen Mutation benötigt regelmässige Kontrolle (z.b. Echokardiographie, um eine Aortadilatation rechtzeitig zu erkennen) und eine entsprechende Lebensweise (Sport, Berufswahl, Blutdruck!) Individuen mit TGFBR1- oder TGFBR2-Mutation benötigen eine häufigere kardiovaskuläre Kontrolle als Personen mit FBN1- Mutation (TGFBR1/TGFBR2-Mutationen können auch innerhalb von Monaten und bei kleinerem Aortadurchmesser zu Ruptur/Dissektion führen) SMAD3-Mutationen können zur Ruptur ohne Aortaerweiterung führen (ebenso wie COL3A1- und MYLK-Mutationen) Patienten mit einer bestimmten Mutation können von einer gezielten Therapie (Medikamente wie Losartan & Betablocker und/oder Doxycyclin, spezifische MMPIs, Gentherapie) profitieren PD Dr. G. Matyas

24 Gezielte Prävention Besonders bei Krankheiten der Hauptschlagader, wie beispielsweise bei Marfan Syndrom und der vaskulären Form des Ehlers-Danlos Syndroms, können nach positivem Nachweis der krankheitsverursachenden Mutation bei einer Risikoperson einfache Lebensstilanpassungen, die den Blutdruck nicht zu hoch steigen lassen (max ), das eigene Leben retten. Prävention ist auch nach einer Operation wichtig: In der Gefässwand der restlichen (nicht operierten) Aorta können erneut Aussackungen und Risse bilden und diese zum Platzen führen Targeted Therapy Postnatal treatment with losartan, propranolol, or placebo in mice with Fbn1 mutation (p.c1039g). Verhoeff van Gieson staining. Matt et al. 2008, J Thorac Cardiovasc Surg 135: Doxycycline (AGTR1) ERK (AGTR2) Whereas patients with mutations leading to increased level of TGF-beta could benefit from a treatment with losartan, patients with mutations leading to increased proteolysis in the aortic wall may respond to a drug therapy with doxycycline (inhibitor of matrix metalloproteases). In the future, patients with heterozygous mutations leading to true or functional haploinsufficiency may benefit from therapies that increase expression of the normal allele (research in progress).

25 Targeted Therapy Habashi et al. 2011, Science 332: (AGTR1) (AGTR2) ERK Agtr2 KO : Fbn1 C1039G/+ mice showed exacerbated medial thickening and elastic fiber fragmentation compared to Fbn1 C1039G/+ mice Doxycycline Extracellular signal Regulated Kinase (ERK) inhibitors AT2 signaling is needed for full protection by losartan (AT2 inhibits ERK activation in the MFS aortic root) Treatments for MFS may find broad application because altered TGF signaling appears to be a common pathway to aneurysm formation PD Dr. G. Matyas / 49 Drugs have been tested in Marfan mice and/or patients (green) Cave: Avoid calcium channel blockers! Ongoing research - Hydralazine - PKC antagonists - Oxytocin antagonists - Specific MMP inhibitors (adapted and modified from Doyle et al. 2012, Lee et al. 2010, and Willaert et al. 2012)

26 PD Dr. G. Matyas Trial identifier (reference) Year trial started Goal (study design) Number of patients, time follow up Age group included β blocker (sample size), dosing ARB (sample size), dosing Outcome parameter NCT (Lacro et al. REF ) 2007 Comparing losartan vs. atenolol (randomized, single blind) 604 MFS patients, 3 years follow up 6 months to 25 years and aortic root z score >3.0 Atenolol (302), mg/kg/day max. 250 mg/day Losartan (302), mg/kg/day max. 100 mg/day Rate of change in aortic root BSA adjusted z score NCT (Möberg et al. REF ) 2009 Additive effect of losartan and β blocker (randomized, double blind) 174 MFS patients, 3 years follow up 10 years and aortic root z score 2 β blocker and placebo (87), no data on dosing Losartan and β blocker (87), mg/day below 50 kg or mg/day over 50 kg Decrease in aortic root growth rate NCT (Detaint et al. REF ) 2008 Efficacy of losartan vs. placebo (randomized, double blind) 300 MFS patients, 3 years follow up 10 years No β blocker Losartan (150) and placebo (150), 50 mg/day below 50 kg or 100 mg/day over 50 kg Change in aortic root diameter NTR1423 (Radonic et al. REF ) 2008 Efficacy of losartan vs. not treated controls (randomized, open label) 330 MFS patients, 3 years follow up 18 years No β blockers (165) but patients continue taking their standard β blocker treatment Losartan (165), 50 mg/day (0 14 days) or 100 mg/day (>14 days) Change in aortic root diameter and skin gene expression NCT (Forteza et al. REF ) 2008 Efficacy of losartan vs. atenolol (randomized, double blind) 150 MFS patients, 3 years follow up 5 60 years and aortic diameter <45 mm Atenolol (75), 12.5 mg/day (0 14 days) and 25 mg/day (>14 days) below 50 kg or 25 mg/day (0 14 days) and 50 mg/day (>14 days) over 50 kg Losartan (75), 12.5 mg/day (0 14 days) and 25 mg/day (>14 days) below 50 kg or 25 mg/day (0 14 days) and 50 mg/day (>14 days) over 50 kg Progression of dilation of the aortic valve annulus, sinuses of Valsalva, sinotubular junction, ascending aorta, aortic arch, thoracic and abdominal aorta NCT (Gambarin et al. REF ) 2008 Effects of losartan vs. nebivolol vs. the combination of both (randomized, open label) 291 MFS patients with FBN1 mutation, 4 years follow up 12 months to 55 years and aortic root z score 2.5 but <50 mm Nebivolol ( in combination?), max. 10 mg/day for adults and max mg/kg/day for children <16 years Losartan ( in combination?), max. 100 mg/day for adults and max. 1.6 mg/kg/day for children <16 years BSA and age adjusted aortic root diameter (sinuses of Valsalva), drug responsiveness (losartan: CYP2C9 gene, nebivolol: CYP2D6 gene) NCT Effects of losartan vs. atenolol on aortic stiffness (randomized, double blind) 50 MFS patients, 6 months follow up 25 years Atenolol (25?), 50 mg/day Losartan (25?), 100 mg/day Aortic biophysical properties and diastolic function Attenhofer Jost,, and Matyas, Curr Cardiol Rev 2014

27 Why is Genetic Testing Important? To make an accurate diagnosis To know the genetic background of the aortic disease: Requirement for targeted management and therapy To clarify whether the aortic disease is inherited: clarification on unclear phenotype, presymptomatic genetic testing, prenatal diagnosis, and preimplantation genetic diagnosis (in Switzerland only by using polar bodies => applicable for affected females) For mutation databases and special studies (genotypephenotype studies, understanding of the molecular pathogenesis and phenotypic variability of aortic diseases) PD Dr. G. Matyas / 53 Spermatogenese Oogenese Polkörper (PK) werden während der Meiose gebildet und haften an der Eizelle. Beim Menschen existieren zwei Polkörper (PK1+PK2). Sie sind relativ arm an Plasma und besitzen einen haploiden Chromosomen- (PK1) bzw. Chromatidensatz (PK2) und werden in der Regel abgebaut. Bei der Polkörperdiagnostik (PKD) werden die PK der Eizelle entnommen und genetisch untersucht. Das Ziel ist es dabei, einen bestimmten genetischen Defekt der Eizelle zu erkennen. Besonderheiten der PKD bei monogenen Erbleiden: - Aussage nur über die Eizelle möglich, da das väterliche Erbgut (väterlicher Vorkern) in der befruchteten Eizelle verbleibt - Mutation bei der Mutter muss bekannt sein - PK lassen nur Rückschlüsse auf die Eizelle zu (indirekte Analyse der Eizelle) nach Passarge, Taschenatlas der Genetik, Thieme 2003

28 Why is Genetic Testing Important? affected person family members everybody To make an accurate diagnosis To know the genetic background of the aortic disease: Requirement for targeted management and therapy To clarify whether the aortic disease is inherited: clarification on unclear phenotype, presymptomatic genetic testing, prenatal diagnosis, and preimplantation genetic diagnosis (in Switzerland only by using polar bodies => applicable for affected females) For mutation databases and special studies (genotypephenotype studies, understanding of the molecular pathogenesis and phenotypic variability of aortic diseases) PD Dr. G. Matyas / 55 Genetic Testing for MFS/AD Why? When? How? Where in Switzerland? PD Dr. G. Matyas / 56

29 1. Aortic Aneurysm at Young Age Jondeau & Boileau, Curr Atheroscler Rep, 2012 Mar 14 [Epub ahead of print] Different groups of patients with thoracic aortic aneurysm according to their age at surgery. BAV bicuspid aortic valve PD Dr. G. Matyas / Clinical Signs Suggesting Aortic Disease PD Dr. G. Matyas / 58

30 3. Aortic Aneurysm in Family Members TGFBR2 ATG Extracellular Transmembrane Kinase Cytoplasmic c.773t>g p.v258g c.1106g>t p.g369v c.1159g>c p.v387l c.1159g>a p.v387m Human (H. sapiens) GTC GGG GTG TGC TGG TCG Chimp (P. troglodytes) Dog (C. familiaris) T Mouse (M. musculus) c Rat (R. norvegicus) c Chicken (G. gallus)..g..t.....t Fugu (T. rubripes).....a c Zebrafish (D. rerio)..g T.....T Ser/Thr c.1181g>a p.c394y c.1561t>c p.w521r TAG c.1657t>a p.s553t Matyas et al. 2006, Hum Mutat 27: I-1 I-2 SS: - CS: - I-1 I-2 I-1 I-2 SS: - SS: - CS: - CS: - I-1 I-2 II-1 II-2 (#104) SS: + SS: + CS: + CS: + segregating III-1 I-1 I-2 SS: - CS: - II-1 II-2 (#102) SS: (+) CS: + III-2 II-3 SS: - CS: - PD Dr. G. Matyas SS: - SS: (+) SS: - SS: - SS: / 59 CS: - CS: (+) segregating II-4 SS: - CS: - II-1 II-2 (#72) SS: - CS: + II-3 SS: - CS: + segregating III-1 (*1988) SS: - CS: - I-1 (#67) I-2 SS: (+) CS: + II-1 CS: - II-2 CS: - II-3 CS: - II-1 (#50) SS: + CS: + de novo SS: - CS: - segregating (normal allele) II-1 (#130) SS: - CS: + de novo? Genetic Testing for MFS/AD Why? When? How? Where in Switzerland? PD Dr. G. Matyas / 60

31 Genetic Assessment in Patients with a Large Aorta How to find point mutations and small ins/dels? Sanger DNA sequencing Polymerasekettenreaktion (PCR) DNA zu amplifizieren Zyklus 3 Zyklus 4 Zyklus 35 DNA-Sequenzierung Zyklus 2 DNA Zyklus 1... A>G 2 2 = 4 Kopien 2 3 = 8 Kopien 16 Kopien 32 Kopien 68 Mrd. Kopien / 61 Detection of Gene Mutations Point mutations, small deletions/insertions/inversions, dynamic mutations PCR-based standard qualitative sequencing (Sanger and NGS) Intron- Primer F Exon Intron+ Primer R not analyzed analyzed not analyzed Long-range PCR Whole genome sequencing (WGS) RNA-based transcript analysis (if possible) Problem: Deletions and duplications larger than the amplified region Real-time (long-range) PCR, MLPA, CGH/SNP arrays, Quantitative sequencing (Sanger or NGS), Southern PD Dr. G. Matyas DELETION DUPLICATION

32 Detection of Large Deletions How to find large deletions/insertions? Multiplex Ligation-Dependent Probe Amplification (MLPA): MLPA probes ( ) for COL3A1 (SALSA MLPA Kit P155, MRC-Holland) Control 1.5 Patient 53B Relative peak area Normal range COL3A1 Ex 1 COL3A1 Ex 5 COL3A1 Ex 1 COL3A1 Ex 2 COL3A1 Ex 43 COL3A1 Ex 11 COL3A1 Ex 20 COL3A1 Ex 17 COL3A1 Ex 29 COL3A1 Ex 32 COL3A1 Ex PD Dr. G. Matyas MLPA P155 fragment MLPA P155 fragment / 63 Meienberg et al. 2010, Eur J Hum Genet 18(12): Detection of Large Deletions How to find large deletions/insertions? Microarrays (SNP and array CGH) Custom designed array CGH with exon enriched probes (CGH 2.1M, NimbleGen ) Probes of CGH 3x720K human whole genome Additional exon probes Exon-intron annotation, July 2010 FBN1 CEP152 SHC4 Structural variants, DGV PD Dr. G. Matyas / 64 v0310, July 2010

33 Characterization of large deletions (Example Sanger sequencing) 46,489,479 46,724,391 46,820,637 46,890,519 46,903,226 47,042,933 EID1 FBN1 CEP152 SHC4 15q21.1 Centromere kb 15q21.1 Decreased MLPA signals SNP_A rs ,571,789 SNP_A rs ,888,783 SNP_A rs ,063,708 Loss of heterozygosity Decreased SNP array signal intensity LR primer 70F LR primer 70R Deletion of 302,580 bp 46,580,456 46,883,035 T T TTGAATA T T TTCA GTAC T TTAAACA GCC TACCCCa taatcatcatg t t a g a gtca at tca gct a ta tatc Junction Reference sequence T PD T TTGAATA Dr. G. Matyas T T TTCA GTAC T TTAAACA GCC TACCCCCCATTCTTGAAATGAGGGATATCCTACA TTCGGATG ,580,491 / 65 a t t t t t a t t a a c a t g a a g t t t t t t a c a a a t t t a a cca t a a t c a t c a t g t t a g a g t c a a t t c a g c t a t a t a t c 46,883,071 Matyas et al., 2007, Hum Genet 122:23-32 Precise breakpoint localization of large genomic deletions using PacBio and Illumina next-generation sequencers 384 reads, 99% C 103 reads, 89% C 315 reads, 52% A 1316 reads, 99% C PacBio RS 7081 reads, 100% C 5820 reads, 1% C reads, 62% A reads, 100% C HiSeq 2000 TACTTTAAACAGCCTACCCCCCATTCTTGAAA Deletion of 302,580 bp t t a c a a a t t t a a ccataatcatcatgt tag a g T T TTGAATA T T TTCA GTAC T TTAAACA GCC TACCCCa taatcatcatg t t a g a gtca at tca gct a ta tatc Junction T T TTGAATA T T TTCA GTAC T TTAAACA GCC TACCCCCCATTCTTGAAATGAGGGATATCCTACA TTCGGATG Biotechniques a Feb;54(2): t t t t t a t t a a c a t g a a g t t t t t t a c a a a t t t a a ccataatcatcatg t t a g a gt c a a t t c a g c t a t a t a t c Reference sequences

34 Genetic Assessment in Patients with a Large Aorta How to find a disease-causing mutation? Special analyses: identifying novel genes/mutations Linkage analysis/mapping Genetic association studies Future: next-generation sequencing (NGS) technologies (targeted, whole-exome, and whole-genome sequencing) PD Dr. G. Matyas / 67 Genetic Testing Future?

35 Zukunft der Gendiagnostik Einerseits stehen Ultra-Hochdurchsatz-Sequenzierungstechnologien (UHTS) zur Verfügung Andererseits stellt die Auswertung und Interpretation der durch UHTS entstandenen Datenmengen noch eine grosse Herausforderung für die Zukunft dar PD Dr. G. Matyas Comparison of different enrichment platforms and sequencing vendors Nimblegen (Roche); Vendor 1 Nimblegen (Roche); Vendor 4 SureSelect (Agilent); Vendor 2 SureSelect (Agilent); Vendor 4 Nextera (Illumina); Vendor 3 Nextera (Illumina); Vendor 4 Design: NimbleGen SureSelect Nextera

36 GC-rich regions - WES Nimblegen (Roche); Vendor 1 Nimblegen (Roche); Vendor 4 SureSelect (Agilent); Vendor 2 SureSelect (Agilent); Vendor 4 Nextera (Illumina); Vendor 3 Nextera (Illumina); Vendor 4 Design: NimbleGen SureSelect Nextera Exon 2: 77.5% GC Zukunft der Gendiagnostik Einerseits stehen Ultra-Hochdurchsatz-Sequenzierungstechnologien (UHTS) zur Verfügung Andererseits stellt die Auswertung und Interpretation der durch UHTS entstandenen Datenmengen noch eine grosse Herausforderung für die Zukunft dar PD Dr. G. Matyas

37 MFS Gendiagnostik Gendiagnostik Mutation gefunden Bekannte Mutation DIAGNOSE Ja Unbekannte Mutation Q1: Ist die identifizierte Sequenzänderung pathogen? Ja Q2: Verursacht die pathogene Sequenzänderung den klinischen Phänotyp des Patienten? PD Dr. G. Matyas MFS Gendiagnostik Q1: Ist die identifizierte Sequenzänderung pathogen? Analyse der evolutionären Konservierung der Sequenz TGFBR2 ATG Extracellular Transmembrane Kinase Cytoplasmic Ser/Thr TAG c.773t>g p.v258g c.1106g>t p.g369v c.1159g>c p.v387l c.1159g>a p.v387m c.1181g>a p.c394y c.1561t>c p.w521r c.1657t>a p.s553t Human (H. sapiens) GTC GGG GTG TGC TGG TCG Chimp (P. troglodytes) Dog (C. familiaris) t Mouse (M. musculus) c Rat (R. norvegicus) c Chicken (G. gallus)..g..t.....t PD Dr. Fugu G. Matyas (T. rubripes) Zebrafish (D. rerio)..g t.....t Matyas et al. 2006, Hum Mutat 27:

38 MFS Gendiagnostik Q1: Ist die identifizierte Sequenzänderung pathogen? Analyse der evolutionären Konservierung der Sequenz In silico Vorhersagen => Mutation => Mutation => Mutation => Mutation => Mutation => Keine Mutation => Unsicher => Mutation => Mutation => Unsicher Matyas et al. 2006, Hum Mutat 27: PD Dr. G. Matyas MFS Gendiagnostik Q1: Ist die identifizierte Sequenzänderung pathogen? Analyse der evolutionären Konservierung der Sequenz In silico Vorhersagen Aber Vorsicht: In silico Vorhersageprogrammen müssen sowohl mit bekannten krankheitsverursachenden Mutationen als auch mit harmlosen Polymorphismen für das betreffende Gen evaluiert werden (Bestimmung von falsch-positiven und falsch-negativen Vorhersagen) PD Dr. G. Matyas

39 MFS Gendiagnostik Q1: Ist die identifizierte Sequenzänderung pathogen? Analyse der evolutionären Konservierung der Sequenz In silico Vorhersagen In vitro Analysen, funktionelle Assays PD Dr. G. Matyas Genetic Assessment in Patients with a Large Aorta Difficulties in sequence data interpretation Prediction of the effect of novel sequence variants Silent mutation c.6354c>t (p.i2118i) Deletion of 66bp (22 amino acids) c.6314_6379del (p.glu2105_val2126del) C>T Exon 50 Intron 50 Exon 51 Intron 51 Exon 52 Intron 52 Exon 53...C 380bp 244bp 2247bp 150bp cf 66bp 117bp cr 120bp 400bp M a. Heteroduplex of b. + c bp 200bp b. Normal transcript (317bp) M 100bp marker 1. FBN1 c.6354c>t 2. FBN1 c.6354c>t 3. Control c. Transcript with deletion of exon 51 (251bp) PD Dr. G. Matyas / 78

40 FBN1 Schematische Darstellung RNA Synthese Splicing DNA Auswirkung intronischer (+ exonischer) Mutationen: - Exon Skipping Ca - Cryptic/Novel Splice Site (SS) - Intron Retention PD Dr. G. Matyas / 79 Ca hnrnp = heterogeneous nuclear ribonucleoproteins snrnp = small nuclear ribonucleoproteins (contain snrnas U1, U2, U4/6, and U5) SR = serine/arginine-rich proteins 35 = U2AF PD Dr. G. Matyas

41 PD Dr. G. Matyas Die Änderung im Kodon für dieselbe Aminosäure (silent mutation) führt zu veränderter Proteintranslation PD Dr. G. Matyas

42 Li et al. compared RNA sequences of 27 individuals to the corresponding DNA sequences from the same individuals and uncovered RNA sequences do not match that of the DNA. These differences were found in multiple individuals and in different cell types. Using mass spectrometry, Li et al. detected peptides that are translated from the discordant RNA sequences and thus do not correspond exactly to the DNA sequences. These widespread RNA-DNA differences in the human transcriptome provide a yet unexplored aspect of genome variation. Das Projekt ENCODE (the Encyclopedia of DNA Elements) zeigt, dass das Genom aus viel mehr als nur aus Genen besteht: Die rund 20'000 proteinkodierenden Gene werden von etwa vier Millionen «molekularen Schaltern», die je nach Zelltyp gewisse Abschnitte des Erbguts an oder ausschalten, kontrolliert.

43 Int J Mol Sci. 2013, 14: Trends Cardiovasc Med. 2011, 21: MFS Gendiagnostik Q1: Ist die identifizierte Sequenzänderung pathogen? Analyse der evolutionären Konservierung der Sequenz In silico Vorhersagen In vitro Analysen, funktionelle Assays Analyse von entsprechenden Kontrollproben In vivo Analysen in Modellorganismen (z.b. Mausmodell) PD Dr. G. Matyas

44 MFS Gendiagnostik Gendiagnostik Mutation gefunden Bekannte Mutation DIAGNOSE Ja Unbekannte Mutation Q1: Ist die identifizierte Sequenzänderung pathogen? Ja Q2: Verursacht die pathogene Sequenzänderung den klinischen Phänotyp des Patienten? PD Dr. G. Matyas MFS Gendiagnostik Q2: Verursacht die pathogene Sequenzänderung den klinischen Phänotyp des Patienten? Segregationsanalyse in der Familie des Patienten I-1 TGFBR2 ATG Extracellular Transmembrane Kinase Cytoplasmic c.773t>g p.v258g c.1106g>t p.g369v c.1159g>c p.v387l c.1159g>a p.v387m Human (H. sapiens) GTC GGG GTG TGC TGG TCG Chimp (P. troglodytes) Dog (C. familiaris) t Mouse (M. musculus) c Rat (R. norvegicus) c Chicken (G. gallus)..g..t.....t Fugu (T. rubripes).....a c Zebrafish (D. rerio)..g t.....t I-2 SS: - CS: - Ser/Thr c.1181g>a p.c394y I-1 I-2 c.1561t>c p.w521r I-1 I-2 SS: - SS: - CS: - CS: - TAG c.1657t>a p.s553t I-1 I-2 II-1 II-2 (#104) SS: + SS: + CS: + CS: + segregiert segregating ). III-1 III-2 SS: - SS: (+) CS: - CS: (+) I-1 I-2 SS: - CS: - II-1 II-2 (#102) II-3 II-4 SS: (+) CS: + SS: - CS: - SS: - CS: - segregating segregiert II-1 II-2 (#72) II-3 SS: - SS: - CS: + CS: + segregiert segregating III-1 (*1988) SS: - CS: - I-1 (#67) I-2 PD Dr. G. Matyas segregiert segregating (Normalallel) (normal allele) Matyas et al. 2006, Hum Mutat 27: SS: (+) CS: + II-1 SS: - CS: - II-2 SS: - CS: - SS: - CS: - II-3 SS: - CS: - II-1 (#50) SS: + CS: + II-1 (#130) SS: - CS: + de de novo de novo?

45 Comprehensive Genetic Testing for MFS in Switzerland Clinical signs of MFS: Referrals from - general practitioners and paediatricians because of Marfanoid habitus, - cardiologist because of aortic dilatation or dissection, - ophthalmologist because of dislocated lens. Preanalytical requirements: - Sample collection (3-6 ml EDTA blood, shipped without cooling) - Informed consent of the patient - Clinical data (needed to decide the order of the genes to be analyzed) - Approval of expenses (provided upon request) vom Arzt veranlasst genetische Beratung vor und nach dem Gentest Recht auf Nichtwissen präsymptomatischer Gentest nur bei Volljährigen schriftliche Zustimmung Genetic testing (analytical phase) - Sequence analysis - MLPA analysis - Special analyses (could be time-consuming) Special analyses Known mutation associated with the clinical phenotype Diagnosis is highly probable Yes Mutation found Novel mutation with unknown effect Q1: Is the identified sequence variant a pathogenic mutation? Yes Q2: Is the pathogenic sequence variant responsible for the clinical phenotype of the patient? No No No mutation found because the disease-causing mutation is - not detectable with the method used (ability of the testing method) - located in another gene Further analyses in order to find the disease-causing mutation (could be very time-consuming, up to several years) MFS Gendiagnostik EDTA-Blutprobe (>3ml) + klinische Angaben + Zustimmung des Patienten + Kostengutsprache Gendiagnostik (Analytische Phase) - Sequenzanalysis - MLPA-Analysis - Spezial Analysis (z.b. cdna-analyse) Yes Mutation gefunden Q1: Ist die identifizierte Sequenzänderung pathogen? No Yes Q2: Verursacht die pathogene Sequenzänderung den klinischen No Phänotyp des Patienten? Keine Mutation gefunden, da - die verwendete Methode/Strategie dies nicht ermöglicht, oder - ein anderes Gen mutiert ist Unsere Mission: Bekannte Unbekannte Mutation Mutation Bei allen uns zugewiesenen Patienten die krankheitsverursachende Mutation zu finden. (Nach negativen Pflichtleistungen erfolgt dies DIAGNOSE kostenlos für die KK; nur bei uns in der Schweiz.) Weitere Analysen (Forschung), um die krankeitsverursachende Mutation zu finden (kann sehr lange dauern, bis zu 5-15 Jahren!) PD Dr. G. Matyas / 90

46 Zukunft der Gendiagnostik Einerseits stehen Ultra-Hochdurchsatz-Sequenzierungstechnologien (UHTS) zur Verfügung Andererseits stellt die Auswertung und Interpretation der durch UHTS entstandenen Datenmengen noch eine grosse Herausforderung für die Zukunft dar COSTS: Next Generation Sequencing (NGS) technologies (targeted, whole-exome, and whole-genome sequencing) Sequence data $ ~ Data analysis/interpretation $ ~ PD Dr. G. Matyas Zukunft der Gendiagnostik Einerseits stehen Ultra-Hochdurchsatz-Sequenzierungstechnologien (UHTS) zur Verfügung Andererseits stellt die Auswertung und Interpretation der durch UHTS entstandenen Datenmengen noch eine grosse Herausforderung für die Zukunft dar Gentest ist nicht gleich Gentest (direkte vs. indirekte Analyse von bekannten vs. unbekannten Mutationen, Analyse von einzelnen vs. sämtlichen Mutationen/Genen, Analyse von Exom vs. Genom) Internet-Gentests sind problematisch: - bei Kindern, urteilsunfähigen und hypochondrisch veranlagten Personen - ohne begleitende Beratung von Experte zu Patient, vor allem bei Risikobewertung und Interpretation der Untersuchungsergebnisse - durch die Ungewissheit der Testqualität - bezüglich Datenschutz PD Dr. G. Matyas

47 Zukunft der Gendiagnostik Einerseits stehen Ultra-Hochdurchsatz-Sequenzierungstechnologien (UHTS) zur Verfügung Andererseits stellt die Auswertung und Interpretation der durch UHTS entstandenen Datenmengen noch eine grosse Herausforderung für die Zukunft dar Gentest ist nicht gleich Gentest (direkte vs. indirekte Analyse von bekannten vs. unbekannten Mutationen, Analyse von einzelnen vs. sämtlichen Mutationen/Genen, Analyse von Exom vs. Genom) Ethische Aspekte, genetische Beratung, Recht auf Unwissen Rechtliche Aspekte, Gesetzanpassung Kostenträger, Gesundheitssystem PD Dr. G. Matyas März 2013 publizierte die Arbeitsgruppe von American College of Medical Genetics and Genomics (ACMG) eine Liste von 57 Genen, die das Risiko für bestimmte Krankheiten (vor allem Krebs oder Herz- Kreislauf-Krankheiten) stark erhöhen und bei denen Vorsorgemassnahmen wirksam sind. Die Gruppe empfahl zudem, dass Labore im Rahmen von medizinischen Genomanalysen standardmässig alle diese «Risikogene» untersuchen.

48 Kosten genetischer Abklärung für MFS/AD Aufwendige genetische Abklärung von Indexpatienten (teuer + lang) CHF ~ ermöglicht genaue Diagnose sowie gezielte Therapie und Prävention von erneuten klinischen Ereignissen Gezielte genetische Abklärung von Nachkommen (günstig + schnell) CHF ~400 ermöglicht Prävention und eine günstige medikamentöse Behandlung (Losartan + Betablocker), wodurch teure Operationen (CHF ) vermieden werden können bzw. Leben gerettet werden kann Genetische Abklärung von MFS/AD kann Gesundheitskosten von $ ~ pro Familie sparen (Reed Pyeritz).

49 Genetic Testing for MFS/AD Why? When? How? Where in Switzerland? PD Dr. G. Matyas / 97 Zentrum für Kardiovaskuläre Genetik und Gendiagnostik

50 Foundation for People with Rare Diseases Center for Cardiovascular Genetics and Gene Diagnostics Uni Research - Teaching Gene Diagnostics Genetic Counselling PD Dr. G. Matyas Zentrum für Kardiovaskuläre Genetik und Gendiagnostik c/o Stiftung für Menschen mit seltenen Krankheiten Thank you for your attention! Our opinion about internet gene tests: «Die Zukunft der Medizin liegt in der Genetik: Es ist immer offensichtlicher, dass sich die Medizin in Prävention, Diagnose und Therapie an der Genetik orientieren muss.» (Prof. Dr. med. Jan Murken, Klinikum der Universität München) Fusszeile