F129L monitoring. in Germany, Austria and Poland

Größe: px

Ab Seite anzeigen:

Download "F129L monitoring. in Germany, Austria and Poland"

Helga Schuster
vor 7 Jahren
Abrufe

1 F129L monitoring in Germany, Austria and Poland Birgit Adolf, Jürgen Leiminger, Andrea Volz, Nicole Metz, Andrea Klaus, Anna Livic, Hans Hausladen EuroBlight Early blight subgroup meeting May 9th 2016, Schiphol, Netherlands Wissenschaftszentrum Weihenstephan

2 Methods

3 Methods cytochrome b gene structure

4 Methods cytochrome b gene structure Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006)

5 Methods cytochrome b gene structure Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006)

6 Methods cytochrome b gene structure Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006) Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G131

7 Methods cytochrome b gene structure Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006) Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G131

8 Methods type I isolates: Primers and PCR conditions as published by Leiminger et al. 2013, sequencing of the 214pb product

9 Methods type I isolates: Primers and PCR conditions as published by Leiminger et al. 2013, sequencing of the 214pb product type II isolates: Primers and PCR conditions as published by Pasche et al. 2005, sequencing of the 207pb product

10 Occurence of the F129L mutation in A. solani :

11 Occurence of the F129L mutation in A. solani : 2005 (baseline)

12 Occurence of the F129L mutation in A. solani : 2005 (baseline) 6 isolates 2 locations Cologne Hannover Regensburg WT, I Munich WT, I

13 Occurence of the F129L mutation in A. solani : isolates, 23 locations Cologne WT, II Hannover Munich Regensburg

14 Occurence of the F129L mutation in A. solani : isolates, 12 locations Cologne Hannover Munich Regensburg

15 Occurence of the F129L mutation in A. solani : isolates, 3 locations Cologne Hannover Munich Regensburg

16 Occurence of the F129L mutation in A. solani : isolates, 21 locations Cologne Hannover Munich Regensburg

17 Occurence of the F129L mutation in A. solani : isolates, 21 locations 2 mutants in 1 loc. Cologne Hannover Regensburg Munich M, II

18 Occurence of the F129L mutation in A. solani : isolates, 7 locations Cologne Hannover Munich Regensburg

19 Occurence of the F129L mutation in A. solani : isolates, 7 locations 2 mutants in 2 loc. Cologne Hannover Munich Regensburg

20 Occurence of the F129L mutation in A. solani : isolates, 12 locations Cologne Hannover Munich Regensburg

21 Occurence of the F129L mutation in A. solani : isolates, 12 locations 74 mutants in 8 loc. Cologne Hannover Munich Regensburg

22 Occurence of the F129L mutation in A. solani : isolates, 10 locations Cologne Hannover Munich Regensburg

23 Occurence of the F129L mutation in A. solani : isolates, 10 locations 15 mutants in 8 loc. Cologne Hannover Munich Regensburg

24 Occurence of the F129L mutation in A. solani : isolates, 24 locations Cologne Hannover Munich Regensburg

25 Occurence of the F129L mutation in A. solani : 2013 type I type I+II 266 isolates, 24 locations 72 mutants in 20 loc. Cologne Hannover Munich Regensburg

26 Occurence of the F129L mutation in A. solani : isolates, 30 locations Cologne Hannover Munich type I Regensburg

27 Occurence of the F129L mutation in A. solani : isolates, 30 locations 20 mutants in 18 loc. Cologne Hannover Munich type I Regensburg

28 Occurence of the F129L mutation in A. solani : isolates 34 locations Cologne Hannover Munich Regensburg

29 EC50 in vitro tests (J. Leiminger, 2014)

30 fungicide efficacy (%) Technische Universität München C AB C C AB C sensitivity in vivo tests AB C C 100 µg/ml azoxystrobin 80 B 10 µg/ml azoxystrobin AB AB AB A B B A B B A A 10 A wild-type (genotype I) wild-type (genotype II) US reference wild-type F129L isolate (genotype II)

31 fungicide efficacy (%) Technische Universität München C AB C C AB C sensitivity in vivo tests AB C C 100 µg/ml azoxystrobin 80 B 10 µg/ml azoxystrobin AB AB AB A B B A B B A A 10 A wild-type (genotype I) wild-type (genotype II) US reference wild-type F129L isolate (genotype II)

32 Austria 2015

33 Austria 2015 locations samples isolates screened F129L mutants Breitstetten genotype I genotype II

34 Austria 2015 locations samples isolates screened F129L mutants Breitstetten 2 genotype I genotype II

35 Austria 2015 locations samples isolates screened F129L mutants Breitstetten 2 4 genotype I genotype II

36 Austria 2015 locations samples isolates screened F129L mutants Breitstetten 2 4 genotype I 0% - genotype II 100% 100%

37 Poland 2015

38 Poland 2015 locations samples isolates screened F129L mutants Koirmika, Prenzchno genotype I genotype II

39 Poland 2015 locations samples isolates screened F129L mutants Koirmika, Prenzchno 6 genotype I genotype II

40 Poland 2015 locations samples isolates screened F129L mutants Koirmika, Prenzchno 6 28 genotype I genotype II

41 Poland 2015 locations samples isolates screened F129L mutants Koirmika, Prenzchno 6 28 genotype I 60% - genotype II 40% 100%

42 F129L monitoring in Germany, Austria and Poland Birgit Adolf, Jürgen Leiminger, Andrea Volz, Nicole Metz, Andrea Klaus, Anna Livic, Hans Hausladen EuroBlight Early blight subgroup meeting May 9th 2016, Schiphol, Netherlands Wissenschaftszentrum Weihenstephan

Ähnliche Dokumente

Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany

Technische Universität München Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany H. Hausladen, B. Adolf and J. Leiminger outline introduction material and methods results