Personalisierte Medizin

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Personalisierte Medizin"

Transkript

1 Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen

2 Kurzer Ausflug in die Genetik

3 DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin, Cytosin, Guanin und Thymin Basenpaarungen (Wasserstoffbrücken) C G A = T forward Strand ( ) reverse Strand ( )

4 Das menschliche Genom... ist auf 2 * 22 Chromosomen verteilt + X/X oder X/Y liegt im Zellkern ist eng zusammengefaltet wird von speziellen Proteinen (Histonen) zusammengehalten Besteht aus DNA (Desoxyribonukleinsäure)

5 Wie lang ist die DNA in allen unseren Zellen? Länge eines Nukleotids (Base) * Anzahl Nukleotide pro Zelle * Anzahl Zellen 0,34 * 10-9 m * 2 * 3 * 10 9 (Mrd) * m km km Länge der DNA 70mal zur Sonne und wieder zurück!

6 Veränderungen im Genom: Punktmutationen Menschen unterscheiden sich voneinander in kleinen Variationen im Genom (SNPs = Single Nucleotide Polymorphisms, sprich snips ): Person X: Person Y:...CGCTAGGATAGCTCTCTAGGATCGCCTCGATAGAGA......CGCTAGGATAGCTCTCTTGGATCGCCTCGATAGAGA... Aktuell > 100 Mio in der gesamten Menschheit bekannt Machen ca. 90% aller genetischen Variationen im menschlichen Genom aus

7 E. Check, "Patchwork people", Nature 437, , 2005 und sogenannte Strukturelle Variationen (> 1kb und < 3Mb), die komplette Gene und regulatorische Bereiche enthalten können

8 und Genommutationen Veränderung der Zahl der Chromosomen z.b. Trisomie21 3Mb Im Mikroskop sichtbar Karyotyp

9 CCTTCCCCCCATCCCAGGCAGGCTGACAGCGGTCATGTTTCTGCCTACAGCGCCTGCCTATCTCTTTTGAATGTCCTTCTCTAC ACTACTCTGTACTTATGGTGCCAGGTTTCTCTTAAGAATGTCCCCTTTGTCCTTCTTATCAGCATGTAGCCAGCAATATTGTGA CATTTTTACTGCAGAGTGAATGATGACTGGGGCATCTTAAATGGAGTTCTGGGGTGTTTCTTTCTGCATAGGTACCTCTGCAGT AGTAGTTTCCAAAATACTTTTGGTAATTTTTAACCTTAAAGTTAACCTTAAAGTTAAGCTAAGTAAAAGATTTGCATTAAATAT CTAGACCATTTATAAATAAGATACAATACTAAAACATTACTGAAGATAAATAATTCTAGTTTACATACTTTTGGCTACTTATTT TTACAGAGAAACTAAAGATATTTTAGCCCATTAATAAACATGTTTTTGTCTACCACACTGAGAAATTGTACTATGAGGAAACAC ATCCCTCTAGATGTTGGGAGATGGTATACTCATACATTTTCTAACCTACTATAGAATGCTAACATATGACAGTTTATAACTGTC TACTTCCTAGTTTTCTCTGGAAAATAAAAGATTACTAAGTATTAAAATTATAATCAATATGTGTAAATAAAACTACTGGAAATA ATAGAATAACTAGAAACAACTCTATGCAAAGCATGCAAGAAAAGTAGTGCATGTTTTGCAAGTAAAGTAGGACGTATTTTTTAT AAGGAAAACCATACAAAAGATACAAATAAAAAGAGATACCTAGCCTTCCCTGTGTTATATTTGTATGGGTAAAATGTCATGTTT TCAGAAAMANFANGWARDASWORTTCAATGTTCTCCTTATCCATGCTATGTGCCAGTATAGAGTTATGAGTCATAATTCCAATT ATTATTTTAAATGTTGTGCTGGGTGCAGTGGCTCACGTCTGTAATCCCACCACTTTGGGAGGCCTAGGCAGGTGGATCACAAGG TCAGGAGATCGAGAACATCCTGGCTGACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGCCAGGCGTGGTGGTGG GCACCTGTACTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGCATGAACCAGGGAGGCAGAGCTTGCAGTGAGCCAAGATA GCGCCACTGCACTCCAGCATGGGCAACAGAGCGAGACTCTGTCTCTAAATAAATAAATAAATAAATAAATAAATGTTTTATCCC ACAGAAAAAATCGAATATCCTTGTCAGTTGTGGTATAATGAACTCTCATCAGATCTTTCATCACAGCCATTTCATATTCTTTAT CATTTAGATATTATTTCCCCCTGATGCTTTCCTGAAAGCTCCTGCAATCAGCTACAGGTCAGAATGTTCATCTCCATCACGGGA CTCCCTCTGAGACACACAGAAAAGAGTATGCAAGATAGTCTGGTTATAGGCTTCTGATGATATTGCTTAAATAACTTTAAGACC ATACACTTCGCTCAGTGAAGATCTCCAGAAGTCTGCTTCAGAAATTGATGGGTTCATGACACTGCTAACCCAAGATGCAACAAG ACTGGAATTGATTACATGGTACTGAATGAACTGATGAAAATTGATTATAATTTTATAGCTTTTTGGAGCATTGCTGGTTCTTTA ATGTTCTAGTTTCTGGACTTAAGAAATCTCTTTCTCTTAACCTAACTGTAACATACAATTTAGTAGATTATACTTTTGAAAACA GAAGTGAAGCATTTATCTTTTTTCCCCTGCCTGATTTTTCCAGAATTTTGAAATCCTTACTGAACACTCTTATTTTTACGATGA TATAGTTGTTAGCAAAAGTCCAATAAGAATCTGTTCACCTTGAACAGAGACCTCAGAAATAATGCCGCATATCTACAACCATCT GATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCTATTTAWERBINICHATAAATGGTGCTGGGAAAACTG GCTAGCCATATGTAGAAAGCTGAAACTGGATCCCTTCCTTACACATTATACAAAAATTAATTCAAGATGGATTAAAGACTTACA TGTTAGACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGGCAGGGACTTCATGTT TAAAACACCAAAAACAATGGCAACAAAAGCCAAAATGGACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAAA AAACCTACTGTCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAACCTACTCATCTGACAAAGGGCTAATATCC AGAATCTACAATGAACACAAAGAAATTTACAAGAAAAAAACAAACAACCCCATCAAAAAGTGGGCGAAGGATGTGAACAGACAC TTCTCAAAAGAAGACATTTATGCAGCCAAAAGACATGTGAAGGAATGCTCATCATCATTGGCCATCAGAGAAATGCAAATCAAA ATCACAATGAGACACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGA GAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTAGAAGATGGTGTGGCGATTCCTCAGGGAT

10 CCTTCCCCCCATCCCAGGCAGGCTGACAGCGGTCATGTTTCTGCCTACAGCGCCTGCCTATCTCTTTTGAATGTCCTTCTCTAC ACTACTCTGTACTTATGGTGCCAGGTTTCTCTTAAGAATGTCCCCTTTGTCCTTCTTATCAGCATGTAGCCAGCAATATTGTGA CATTTTTACTGCAGAGTGAATGATGACTGGGGCATCTTAAATGGAGTTCTGGGGTGTTTCTTTCTGCATAGGTACCTCTGCAGT AGTAGTTTCCAAAATACTTTTGGTAATTTTTAACCTTAAAGTTAACCTTAAAGTTAAGCTAAGTAAAAGATTTGCATTAAATAT CTAGACCATTTATAAATAAGATACAATACTAAAACATTACTGAAGATAAATAATTCTAGTTTACATACTTTTGGCTACTTATTT TTACAGAGAAACTAAAGATATTTTAGCCCATTAATAAACATGTTTTTGTCTACCACACTGAGAAATTGTACTATGAGGAAACAC ATCCCTCTAGATGTTGGGAGATGGTATACTCATACATTTTCTAACCTACTATAGAATGCTAACATATGACAGTTTATAACTGTC TACTTCCTAGTTTTCTCTGGAAAATAAAAGATTACTAAGTATTAAAATTATAATCAATATGTGTAAATAAAACTACTGGAAATA ATAGAATAACTAGAAACAACTCTATGCAAAGCATGCAAGAAAAGTAGTGCATGTTTTGCAAGTAAAGTAGGACGTATTTTTTAT AAGGAAAACCATACAAAAGATACAAATAAAAAGAGATACCTAGCCTTCCCTGTGTTATATTTGTATGGGTAAAATGTCATGTTT TCAGAAAMANFANGWARDASWORTTCAATGTTCTCCTTATCCATGCTATGTGCCAGTATAGAGTTATGAGTCATAATTCCAATT ATTATTTTAAATGTTGTGCTGGGTGCAGTGGCTCACGTCTGTAATCCCACCACTTTGGGAGGCCTAGGCAGGTGGATCACAAGG TCAGGAGATCGAGAACATCCTGGCTGACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGCCAGGCGTGGTGGTGG GCACCTGTACTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGCATGAACCAGGGAGGCAGAGCTTGCAGTGAGCCAAGATA GCGCCACTGCACTCCAGCATGGGCAACAGAGCGAGACTCTGTCTCTAAATAAATAAATAAATAAATAAATAAATGTTTTATCCC ACAGAAAAAATCGAATATCCTTGTCAGTTGTGGTATAATGAACTCTCATCAGATCTTTCATCACAGCCATTTCATATTCTTTAT CATTTAGATATTATTTCCCCCTGATGCTTTCCTGAAAGCTCCTGCAATCAGCTACAGGTCAGAATGTTCATCTCCATCACGGGA CTCCCTCTGAGACACACAGAAAAGAGTATGCAAGATAGTCTGGTTATAGGCTTCTGATGATATTGCTTAAATAACTTTAAGACC ATACACTTCGCTCAGTGAAGATCTCCAGAAGTCTGCTTCAGAAATTGATGGGTTCATGACACTGCTAACCCAAGATGCAACAAG ACTGGAATTGATTACATGGTACTGAATGAACTGATGAAAATTGATTATAATTTTATAGCTTTTTGGAGCATTGCTGGTTCTTTA ATGTTCTAGTTTCTGGACTTAAGAAATCTCTTTCTCTTAACCTAACTGTAACATACAATTTAGTAGATTATACTTTTGAAAACA GAAGTGAAGCATTTATCTTTTTTCCCCTGCCTGATTTTTCCAGAATTTTGAAATCCTTACTGAACACTCTTATTTTTACGATGA TATAGTTGTTAGCAAAAGTCCAATAAGAATCTGTTCACCTTGAACAGAGACCTCAGAAATAATGCCGCATATCTACAACCATCT GATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCTATTTAWERBINICHATAAATGGTGCTGGGAAAACTG GCTAGCCATATGTAGAAAGCTGAAACTGGATCCCTTCCTTACACATTATACAAAAATTAATTCAAGATGGATTAAAGACTTACA TGTTAGACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGGCAGGGACTTCATGTT TAAAACACCAAAAACAATGGCAACAAAAGCCAAAATGGACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAAA AAACCTACTGTCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAACCTACTCATCTGACAAAGGGCTAATATCC AGAATCTACAATGAACACAAAGAAATTTACAAGAAAAAAACAAACAACCCCATCAAAAAGTGGGCGAAGGATGTGAACAGACAC TTCTCAAAAGAAGACATTTATGCAGCCAAAAGACATGTGAAGGAATGCTCATCATCATTGGCCATCAGAGAAATGCAAATCAAA ATCACAATGAGACACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGA GAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTAGAAGATGGTGTGGCGATTCCTCAGGGAT

11 Wie kommt die DNA-Sequenz in den Computer?

12 Sequenziertechniken 1. Genetisches Material liegt im Labor in kleinen DNA- Fragmenten vor 2. Sequenzierautomaten liefern Nukleotidfolge der Fragmente 3. Im Computer wird aus den Fragmenten die komplette DNA- Sequenz wieder zusammengesetzt

13 Vergleichbar mit geschredderten Akten?

14 Leider nicht warum? DNA ist kein natürlich-sprachlicher Text es gibt keine Satzzeichen, Leerzeichen, Absätze usw. niemand kennt den Inhalt Fragmente sind sehr kurz (25 bis 1200 Nukleotide) enthalten viele Wiederholungen (repetitive Elemente) haben keine Richtungsinformation sind fehlerhaft...

15 Next Generation Sequencing (NGS) Second Generation Sequencing, Pyrosequencing, Sequencing-by-Hybridization, Sequencing-by-Synthesis Liefert mehrere Terabyte an Rohdaten pro Experiment Sequenzieren ist damit kostengünstig und schnell geworden einige Anbieter: Roche 454 Genome Sequencer System Illumina Genome Analyzer Applied Biosystems SOLiD System Pacific Biosciences Oxford Nanopore

16 Wetterstrand KA. DNA Sequencing Costs: Data from the NHGRI Large-Scale Genome Sequencing Program Available at: Accessed November 18, 2015

17 Verfügbar seit Mai 2015 Starter Pack für 1.000$: Gerät + FlowCell + 3 * Chemikalien Jedes weitere Experiment: 99$ Chemikalien + FlowCell (270$-900$, je nach bestellter Anzahl)

18 Und wozu dieser ganze Aufwand?

19 Personalisierte Medizin Idee: Wenn das Genom jedes einzelnen Menschen bekannt ist, kann jeder individuell untersucht und behandelt werden Ziel: Nebenwirkungen von Medikamenten minimieren, Krankheiten gezielter und effektiver erkennen und behandeln

20 Personalisierte Medizin: Vorsorge Menschen unterscheiden sich genetisch voneinander einzelne Varianten können das Risiko für eine Erkrankung erhöhen das Wissen über persönliche genetische Varianten kann bei der persönlichen Lebensführung berücksichtigt werden und so das Risiko einer Erkrankung verringert werden z.b. sollte man bei einem erhöhten Risiko für Brustkrebs nicht rauchen

21 Personalisierte Medizin: Diagnose es gibt Krankheiten, die mit herkömmlichen diagnostischen Mitteln nicht eindeutig festgestellt werden können eine genetische Untersuchung kann hier Klarheit verschaffen gleiches gilt für unterschiedliche Stadien einer Krankheit Convincing An Insurance Company To Pay For Sequencing A Child s DNA von Maria Konovalenko s-dna/

22 Personalisierte Medizin: Diagnose die Ursache einer Krankheit ist nicht immer in unserem Genom zu finden eine Untersuchung kann auch genetisches Material von Viren, Bakterien, Pilzen usw. finden z.b. können rheumatische Erkrankungen durch Virusinfektionen verursacht sein oder könnte die Ursache von Alzheimer eine Pilzinfektion sein (Different Brain Regions are Infected with Fungi in Alzheimer s Disease, Pisa et al., Scientific Reports 5, Article number: (2015))

23 Personalisierte Medizin: Behandlung die Wirkrate eines Medikamentes gibt an, bei wieviel Prozent der behandelten Personen das Medikament die gewünschte Wirkung zeigt sie liegt üblicherweise bei 40-60%, im besten Fall bei 80% Medikation kann entsprechend der genetischen Voraussetzungen gezielter eingesetzt werden momentan noch unrentabel für Pharmafirmen Blockbuster werden von mehr Menschen eingenommen und bringen damit höhere Gewinne

24 Ein Medikament nur für Afroamerikaner Juni 2005 von der FDA (Food and Drug Administration) in den USA zugelassen wirkt gegen durch Bluthochdruck bedingte Herzinsuffizienz wirkte in Klinischen Studien besser bei Afroamerikanern, da diese häufiger unter dieser Krankheitsform leiden löste Diskussion um rassistische Medizin aus

25 Wer berät Patienten? Direct-to-Consumer-Testing (DTC): bei 23andme gehen die Ergebnisse direkt an den Kunden bei anderen Anbietern muss ein Arzt an der Bestellung beteiligt sein Gendiagnostikgesetz (seit in Kraft): Arztvorbehalt: gendiagnostische Untersuchungen dürfen in D nur von einem dafür qualifizierten Arzt vorgenommen oder veranlasst werden

26 Wer hat Zugriff auf die Daten? nur der Patient und der beratende Arzt (siehe Gendiagnostikgesetz) Versicherungsgesellschaften dürfen Ergebnisse bereits durchgeführter Tests nicht verlangen (Ausnahme: sehr hohe Versicherungssumme, z.b. > ) Arbeitgeber dürfen Ergebnisse bereits durchgeführter Tests nicht verlangen (Ausnahme: schwere Erkrankungen durch Arbeit, mit genetischer Ursache) Kritik (der Versicherer): Problem der Antiselektion, d.h. wer nicht bereit ist, seine Daten zu offenbaren, hat offensichtlich etwas zu verbergen

27 Wem gehört mein Genom? Was ist eigentlich ein Krankheitsgen? Was heißt eigentlich krank? Reicht es, eine Variante in einem Gen zu haben? Was tue ich, wenn ich ein Krankheitsgen habe? Was ist mit dem Datenschutz? Was, wenn Daten in der Cloud ausgewertet werden? Was, wenn die Firma in einem anderen Land sitzt? Was passiert mit meinem biologischen Material im Labor? Oder sollten alle ihr Genom einfach ins Internet stellen????

28 Und was nützt mir das?

29 Mai 2007 Firma: Foto: DNA Google Logo At Google Kirkland by Flickr Ziel: Entwicklung einer Suchmaschine für persönliche genetische Daten Zugriff geplant für Individuen und zu Forschungszwecken Google hat 3,9 Mio $ investiert

30 Wem gehören meine SNPs? Mir! (und 23andme)

31 Wem gehören meine SNPs? Mir! (und 23andme) Analyse von > Markern darunter ca SNP inklusive Informationen zur Abstammung Genotypisierung, keine Sequenzierung!

32 Bestellung bei 23andme Di, Online bestellt Fr, Testkit angekommen Sa, Probe verschickt Mi, Empfangsbestätigung Fr, Ergebnisse Online

33 Bestellung bei 23andme Di, Online bestellt Fr, Testkit angekommen Sa, Probe verschickt Mi, Empfangsbestätigung Fr, Ergebnisse Online

34 Bestellung bei 23andme Di, Online bestellt Fr, Testkit angekommen Sa, Probe verschickt Mi, Empfangsbestätigung Fr, Ergebnisse Online

35

36 My Health / Meine Gesundheit 1. Disease Risk 2. Carrier Status 3. Drug Response 4. Traits 5. My Ancestry 1. Krankheitsrisiken 2. Überträger 3. Reaktion auf Medikamente 4. Eigenschaften / Merkmale 5. Meine Abstammung

37 opensnp

38 Und nun? Warum habe ich es getan? Welche Konsequenzen ziehe ich daraus? Was werde ich an meinem Leben ändern? Gab es Überraschungen? Hätte ich es auch getan, wenn ich 30 Jahre jünger wäre?

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Literaturhinweise. Genanalyse und diagnostik

Literaturhinweise. Genanalyse und diagnostik Literaturhinweise Genanalyse und diagnostik Wiese, Gendiagnostikgesetz und Arbeitsleben, BB 2009 Schultz, DNA-Tests in der Migrationskontrolle, ZRP 2009, 115 Präve, Das Gendiagnostikgesetz aus versicherungsrechtlicher

Mehr

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung FRAUNHOFER-INSTITUT FÜR GRENZFLÄCHEN- UND BIOVERFAHRENSTECHNIK IGB NEXT-GENERATION SEQUENCING Von der Probenvorbereitung bis zur bioinformatischen Auswertung »Progress in science depends on new techniques,

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag. Priv. Doz. Dr. Stephan Becher Berlin 10.11.

Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag. Priv. Doz. Dr. Stephan Becher Berlin 10.11. Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag Priv. Doz. Dr. Stephan Becher Berlin 10.11.2014 Vom Gen zum Versicherungsantrag 1 Einführung 2 Begriffe

Mehr

Diese Broschüre fasst die wichtigsten Informationen zusammen, damit Sie einen Entscheid treffen können.

Diese Broschüre fasst die wichtigsten Informationen zusammen, damit Sie einen Entscheid treffen können. Aufklärung über die Weiterverwendung/Nutzung von biologischem Material und/oder gesundheitsbezogen Daten für die biomedizinische Forschung. (Version V-2.0 vom 16.07.2014, Biobanken) Sehr geehrte Patientin,

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Angebot und Nachfrage: Die Entwicklung von Gentests. Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut

Angebot und Nachfrage: Die Entwicklung von Gentests. Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut Angebot und Nachfrage: Die Entwicklung von Gentests Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut Themen Welche (neuen) genetischen Tests werden heute in der klinischen

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom HAMBURG SCHOOL OF FOOD SCIENCE Institut für Lebensmittelchemie Universität Hamburg, AiF/

Mehr

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien III. Interdisziplinärer Kongress JUNGE NATURWISSENSCHAFT

Mehr

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse?

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse? - 1 - Personalisierte Medizin ist der Überbegriff für die Strategie, Medikamente und Therapien zu entwickeln, die besser auf den einzelnen Patienten zugeschnitten sind. Dabei sollen routinemäßige Gentests

Mehr

Genetisch... Unterschied. DNA zu... 99,9% identisch

Genetisch... Unterschied. DNA zu... 99,9% identisch Genetisch... Unterschied DNA zu... 99,9% identisch Alle Menschen unterscheiden sich aus genetischer Sicht nur um 0,1% Die übrigen 99,9% sind exakt gleich, egal ob miteinander verwandt oder nicht. Diese

Mehr

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin Die richtige Therapie für den richtigen Patienten Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin: Was ist denn das? Februar 2011 Personalisierte Medizin:

Mehr

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik Karl J. Lackner Hochdurchsatzverfahren in der molekularen bzw. genetischen Diagnostik Next Generation-Sequenzierung

Mehr

Genetische Varianten: Aufgaben der Pharmakogenetik. Personalisierte Medizin mit Hilfe der Pharmacogenetik

Genetische Varianten: Aufgaben der Pharmakogenetik. Personalisierte Medizin mit Hilfe der Pharmacogenetik Personalisierte Medizin mit Hilfe der Pharmacogenetik Priv. Doz. Dr. Annette Kaiser Medizinsches Forschungszentrum Institut für Pharmakogenetik Hufelandstrasse 55 45147 Essen Telefon: 0201-723-3468 email:

Mehr

Labortests für Ihre Gesundheit. Therapie nach Maß 26

Labortests für Ihre Gesundheit. Therapie nach Maß 26 Labortests für Ihre Gesundheit Therapie nach Maß 26 01IPF Labortests für Ihre Gesundheit Therapie nach Maß Die individuelle Dosis finden Jeder Mensch ist einzigartig. Keiner gleicht dem anderen nicht nur

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Humangenom Größe 150 m 3.000.000.000 Nukleotide 3000 x 1000 x 1000 Bücher Seiten Buchstaben 1953 2003 Watson, J.D., and F.H.C.Crick.

Mehr

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Florian Frommlet Institut für medizinische Statistik, Medizinische Universität Wien Wien, November 2013 Einführung DNA Molekül Zwei

Mehr

Next Generation Gene Sequencing bei Brustkrebs

Next Generation Gene Sequencing bei Brustkrebs Institut für Medizinische Genetik Next Generation Gene Sequencing bei Brustkrebs Prof. Dr. med. Anita Rauch 08.10.2015 Seite 1 Benefit der Krebsfrüherkennung Antilla et al. 2014 08.10.2015 Anita Rauch

Mehr

Depression Die Krankheit Nr. 1!!!

Depression Die Krankheit Nr. 1!!! Depression Die Krankheit Nr. 1!!! Die WHO (Weltgesundheitsorganisation) hat festgestellt, dass die Erkrankung Depression in ca. 10 Jahren die häufigste Erkrankung in den Industrieländern darstellt, das

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie und Sequenzähnlichkeit Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie Verwandtschaft aufgrund gleicher Abstammung basiert auf Speziation (Artbildung): aus einer

Mehr

6WDWHPHQW 3URIHVVRU'U-RFKHQ7DXSLW],QVWLWXWI U'HXWVFKHV(XURSlLVFKHVXQG,QWHUQDWLRQDOHV 0HGL]LQUHFKW*HVXQGKHLWVUHFKWXQG%LRHWKLN 8QLYHUVLWlWHQ+HLGHOEHUJXQG0DQQKHLP 6FKORVV 0DQQKHLP )D[ (0DLOWDXSLW]#MXUDXQLPDQQKHLPGH

Mehr

Gene Silencing: was ist das noch mal?

Gene Silencing: was ist das noch mal? Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Gen Silencing macht einen zielstrebigen Schritt nach vorne Das

Mehr

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten Hilden (10. Januar 2012) - QIAGEN hat von zwei US-amerikanischen Biotechnologieunternehmen weltweit exklusive

Mehr

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1 I... I Abbildungs- und Tabellenverzeichnis... VI Abkürzungsverzeichnis... IX 1 Einleitung... 1 1.1 Untersuchte uro-rektale Fehlbildungen... 1 1.1.1 Blasenekstrophie-Epispadie-Komplex (BEEK)... 1 1.1.1.1

Mehr

Erbgutanalyse mit wachsendem Automatisierungsgrad

Erbgutanalyse mit wachsendem Automatisierungsgrad Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/erbgutanalyse-mitwachsendem-automatisierungsgrad/ Erbgutanalyse mit wachsendem Automatisierungsgrad Mit einer eigens

Mehr

Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie

Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Prof. Dr. Wolfgang Herr Innere Medizin III Hämatologie und intern. Onkologie Klinik und Poliklinik für Innere Medizin III

Mehr

Osteoporose. Ein echtes Volksleiden. Schon jetzt zählen die Osteoporose und die damit verbundene erhöhte Brüchigkeit der Knochen

Osteoporose. Ein echtes Volksleiden. Schon jetzt zählen die Osteoporose und die damit verbundene erhöhte Brüchigkeit der Knochen Osteoporose Osteoporose 9 Osteoporose Ein echtes Volksleiden Schon jetzt zählen die Osteoporose und die damit verbundene erhöhte Brüchigkeit der Knochen in den entwickelten Ländern zu den häufigsten Erkrankungen

Mehr

Ethische Fragestellungen zur Personalisierten Medizin

Ethische Fragestellungen zur Personalisierten Medizin Ethische Fragestellungen zur Personalisierten Medizin Softskills Seminar Ethik 05.02.2013 Ethik in der Personalisierten Medizin Personalisierte Medizin Ihre Anwendungsgebiete Fallbeispiele Wohin mit der

Mehr

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet

Mehr

Die Paten)erbarkeit von Gensequenzen - von Biomarkern. Prof. Dr. iur. Dr. rer. pol. Jürgen Ensthaler, TU Berlin

Die Paten)erbarkeit von Gensequenzen - von Biomarkern. Prof. Dr. iur. Dr. rer. pol. Jürgen Ensthaler, TU Berlin Die Paten)erbarkeit von Gensequenzen - von Biomarkern Prof. Dr. iur. Dr. rer. pol. Jürgen Ensthaler, TU Berlin Was sind Biomarker? Defini)on: Ø Es gibt noch keine einheitliche Defini)on für Biomarker.

Mehr

Lungenentzündung gehören Sie zu einer Risikogruppe?

Lungenentzündung gehören Sie zu einer Risikogruppe? copy 11pt Lungenentzündung gehören Sie zu einer Risikogruppe? Wo viele Menschen zusammenkommen, können sie besonders leicht übertragen werden: Die Erreger der Lungenentzündung. Niesen und Husten, ein Händedruck

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Big Data zwischen Hype und Realität Perspektiven im Gesundheitswesen. Dr. Peter Grolimund, Senior Industry Consultant Life Sciences 26-Januar-2015

Big Data zwischen Hype und Realität Perspektiven im Gesundheitswesen. Dr. Peter Grolimund, Senior Industry Consultant Life Sciences 26-Januar-2015 Big Data zwischen Hype und Realität Perspektiven im Gesundheitswesen Dr. Peter Grolimund, Senior Industry Consultant Life Sciences 26-Januar-2015 Zur Diskussion DATEN Spenden kann Leben retten Analysieren

Mehr

Der Code des Lebens. Prof. Ernst Hafen Treffpunkt Science City

Der Code des Lebens. Prof. Ernst Hafen Treffpunkt Science City Der Code des Lebens Prof. Ernst Hafen Treffpunkt Science City - 23.10.2011 ehafen@ethz.ch Inhalt Das Genom - wovon sprechen wir? Genom und Krankheiten Die genetische Revolution Die persönliche Genomanalyse

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Voraussetzungen für die Genomische Selektion beim Pferd

Voraussetzungen für die Genomische Selektion beim Pferd Agrar- und Ernährungswissenschaftliche Fakultät Institut für Tierzucht und Tierhaltung Voraussetzungen für die Genomische Selektion beim Pferd Prof. Dr. Georg Thaller 32. Jahrestagung zur Pferdegesundheit

Mehr

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin - Status und Zukunft PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin

Mehr

Anleitung für Backup und Absenden des Fragebogens

Anleitung für Backup und Absenden des Fragebogens Anleitung für Backup und Absenden des Fragebogens 1) Für den Zugriff auf die Backup Optionen und Absenden des Fragebogens, Klicken Sie auf "Mailen", die sich auf der letzten Seite des Dokuments : 2) Ein

Mehr

Klinik für Transplantationsmedizin Univ.-Prof. Dr. med. Hartmut H.-J. Schmidt [Adresse] Patienteninformation/Einwilligungserklärung

Klinik für Transplantationsmedizin Univ.-Prof. Dr. med. Hartmut H.-J. Schmidt [Adresse]  Patienteninformation/Einwilligungserklärung Universitätsklinikum Münster. Klinik für Transplantationsmedizin. 48149 Münster [Adresse] Klinik für Transplantationsmedizin Univ.-Prof. Dr. med. Hartmut H.-J. Schmidt Direktor Albert-Schweitzer-Campus

Mehr

Seminar Biomedical Informatics

Seminar Biomedical Informatics Martin Dugas und Xiaoyi Jiang Institut für Informatik Sommersemester 2017 Organisation Vorlage: Englischsprachige Publikation Vortrag: ca. 30min + 15min Diskussion, Hand-out, Blockseminar Anfang Juni Seminararbeit:

Mehr

Beispiel für eine innovative Versorgungsstruktur. Der Selektivvertrag mit dem Netzwerk Genomische Medizin Lungenkrebs

Beispiel für eine innovative Versorgungsstruktur. Der Selektivvertrag mit dem Netzwerk Genomische Medizin Lungenkrebs Beispiel für eine innovative Versorgungsstruktur. Der Selektivvertrag mit dem Netzwerk Genomische Medizin Lungenkrebs AOK Rheinland/Hamburg Dr. med. Astrid Naczinsky Düsseldorf, 15. Dezember 2015 Lungenkrebs

Mehr

Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur

Mehr

S Ü D W E S T R U N D F U N K F S - I N L A N D R E P O R T MAINZ S E N D U N G: 04.03.2014

S Ü D W E S T R U N D F U N K F S - I N L A N D R E P O R T MAINZ S E N D U N G: 04.03.2014 Diese Kopie wird nur zur rein persönlichen Information überlassen. Jede Form der Vervielfältigung oder Verwertung bedarf der ausdrücklichen vorherigen Genehmigung des Urhebers by the author S Ü D W E S

Mehr

Pressekonferenz 17.5.2004. Auf dem Weg zum «massgeschneiderten Medikament»?

Pressekonferenz 17.5.2004. Auf dem Weg zum «massgeschneiderten Medikament»? Pressekonferenz 17.5.2004 Auf dem Weg zum «massgeschneiderten Medikament»? Dr. Klaus Peter Rippe Andreas Bachmann Dr. Nicole Probst-Hensch Marion Völger Auf dem Weg zum massgeschneiderten Medikament? Das

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Datability. Prof. Dieter Kempf, Präsident BITKOM Oliver Frese, Vorstand Deutsche Messe AG. Hannover, 9. März 2014

Datability. Prof. Dieter Kempf, Präsident BITKOM Oliver Frese, Vorstand Deutsche Messe AG. Hannover, 9. März 2014 Datability Prof. Dieter Kempf, Präsident BITKOM Oliver Frese, Vorstand Deutsche Messe AG Hannover, 9. März 2014 Bürger fordern verantwortungsvollen Umgang mit Daten Inwieweit stimmen Sie den folgenden

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Krebs und Partnerschaft Bedürfnisse (an)erkennen

Krebs und Partnerschaft Bedürfnisse (an)erkennen Interview mit Frau Dr. Pia Heußner vom Mai 2012 Krebs und Partnerschaft Bedürfnisse (an)erkennen Die Diagnose Krebs ist für jede Partnerschaft eine große Herausforderung. Wie hält das Paar die Belastung

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

Workshop des WissGrid Fachberater-Teams

Workshop des WissGrid Fachberater-Teams Workshop des WissGrid Fachberater-Teams Virtuelle Forschungsumgebungen aufbauen - mit D-Grid - Communities mit datenlastigen Aufgaben 19. Januar 2011, Göttingen Benjamin Löhnhardt Vortragsinhalte Einleitung

Mehr

NATURHEILMITTEL IM SPIEGEL DER DEMOSKOPIE Einstellungen und Verbraucherverhalten im Trend

NATURHEILMITTEL IM SPIEGEL DER DEMOSKOPIE Einstellungen und Verbraucherverhalten im Trend Was beunruhigt die Bevölkerung, was ist ihr unheimlich? NATURHEILMITTEL IM SPIEGEL DER DEMOSKOPIE Einstellungen und Verbraucherverhalten im Trend von Edgar Piel Eröffnungsreferat zum Deutschen Heilpraktikerkongress

Mehr

Gendiagnose. Als nächstes möchte ich einige Verfahren von Gentests nennen und erläutern.

Gendiagnose. Als nächstes möchte ich einige Verfahren von Gentests nennen und erläutern. Gendiagnose Gentest Der Gentest ist ein molekularbiologisches Verfahren. Bei diesem wird die DNA untersucht, um Rückschlüsse auf genetische Aspekte zu erhalten. Gentests haben vielfältige Anwendungsmöglichkeiten,

Mehr

Hinweis zur Ergänzung im Fall schwerer Erkrankung. Anpassung der PATIENTENVERFÜGUNG für den Fall schwerer Krankheit

Hinweis zur Ergänzung im Fall schwerer Erkrankung. Anpassung der PATIENTENVERFÜGUNG für den Fall schwerer Krankheit 40 Hinweis zur Ergänzung im Fall schwerer Erkrankung Liegt bereits eine schwere Erkrankung vor, bedarf es einer hieran angepassten Patientenverfügung. Diese kann nur in engem Zusammenwirken mit dem behandelnden

Mehr

Neuer Gentest für erbliche Augenerkrankung

Neuer Gentest für erbliche Augenerkrankung Gesellschaft zur Förderung Kynologischer Forschung Abschlussbericht Neuer Gentest für erbliche Augenerkrankung aus der gkf-info 34 Dezember 2011 Info 33 Dezember 2011 Grußwort Abschlussbericht Neuer Gentest

Mehr

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Christian-Albrechts-Universität zu Kiel Next-Generation Sequencing (NGS) Nach Sanger Sequencing (1977) zweite Generation

Mehr

Gefühlte Risiken und die Illusion der Gewissheit. Gerd Gigerenzer

Gefühlte Risiken und die Illusion der Gewissheit. Gerd Gigerenzer in this world there is nothing certain but death and taxes. Benjamin Franklin The whole problem of the world is that fools and fanatics are always so certain of themselves, but wiser people so full of

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Untersuchung, Beratung und Vorsorge bei familiärem Brustkrebs

Untersuchung, Beratung und Vorsorge bei familiärem Brustkrebs Untersuchung, Beratung und Vorsorge bei familiärem Brustkrebs 20. Onkologisches Symposium Tumorzentrum Regensburg e.v. Teresa Neuhann MGZ München Einführung Brustkrebs häufigste Tumorerkrankung der Frau

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

5. Untersuchungsdesigns

5. Untersuchungsdesigns Dr. habil. Rüdiger Jacob Methoden und Techniken der empirischen Sozialforschung Vorlesung mit Diskussion 5. Untersuchungsdesigns Experimente als Instrument zur Prüfung von Kausalität Kohortenstudien, Fall-Kontroll-Studien,

Mehr

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen 9.1 Welche Funktionen haben Sinneszellen und Sinnesorgan? Sinneszellen nehmen die Reize auf und wandeln die Information in elektrische Signale um. Die Sinnesorgane dienen unter anderem dazu. Beispiel Auge

Mehr

Der Gesundheitskompass für die junge Frau

Der Gesundheitskompass für die junge Frau Haarausfall? Blutentnahme zu Hormonlabor, Eisenwerte, Schilddrüsenwerte, Biotin und Zink 86,87 EURO Wiederholte Scheideninfektionen? Mit dem Vaginalstatus können Infektionen durch spezielle Kulturen auf

Mehr

Chancen und Grenzen einer individualisierten Arzneimitteltherapie

Chancen und Grenzen einer individualisierten Arzneimitteltherapie einer individualisierten Arzneimitteltherapie Gießen 2006 Prof. Dr. Manfred Schubert-Zsilavecz Johann Wolfgang Goethe-Universität Frankfurt am Main Arzneimittelinnovationen Grundlage für die Erfolge in

Mehr

Genomische Selektion in der Pflanzenzüchtung

Genomische Selektion in der Pflanzenzüchtung Genomische Selektion in der Pflanzenzüchtung Chris-CarolinCarolin Schön 30. März 2012 Hybridzüchtung Population 1 Population 2 Kreuzungen 10.000000 Linieni Prüfung 1 Umwelt Kreuzungen 10.000000 Linen 2.000

Mehr

(Laotse) Dr. med. Andreas Tecklenburg Vorstand für das Ressort Krankenversorgung

(Laotse) Dr. med. Andreas Tecklenburg Vorstand für das Ressort Krankenversorgung Innovative Medizin als Verlustgeschäft: - Beispiele aus der Praxis - Innovative Medizin Lernen ist wie Rudern gegen den Strom sobald man aufhört, treibt man zurück. (Laotse) http://www.nurdie.de/azubi-blog/wpcontent/uploads/2013/05/unbenannt.jpg

Mehr

DNA-Sequenzierung. Martina Krause

DNA-Sequenzierung. Martina Krause DNA-Sequenzierung Martina Krause Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse

Mehr

Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information):

Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information): Frauenklinik Gynäkologie und Gynäkologische Onkologie Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information): Universitätsspital Basel Frauenklinik PD Dr. med. Nicole

Mehr

Unerfüllter Kinderwunsch. Ursachen erkennen, Lösungen finden. Informationen für Paare, die auf ein Baby warten

Unerfüllter Kinderwunsch. Ursachen erkennen, Lösungen finden. Informationen für Paare, die auf ein Baby warten Unerfüllter Kinderwunsch Ursachen erkennen, Lösungen finden Informationen für Paare, die auf ein Baby warten Das lange Warten auf ein Baby. Was können Sie tun? Wann sollten Sie sich untersuchen lassen?

Mehr

Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom

Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Von Navneet Ramesh und Maike Haehle, übersetzt von Sabine Schock Vom 8. Apr 2014 7:41 Uhr; aktualisiert am 8. Apr

Mehr

Bioinformatik: Hype oder Hoffnung?

Bioinformatik: Hype oder Hoffnung? Bioinformatik: Hype oder Hoffnung? Florian Markowetz Max-Planck-Institut für Molekulare Genetik Computational Molecular Biology Berlin Career Nights AKG Bensheim, 28. Januar 2005 1 Florian Markowetz, Bioinformatik:

Mehr

Tipps für Patienten: Individuelle Gesundheitsleistungen (IGeL)

Tipps für Patienten: Individuelle Gesundheitsleistungen (IGeL) Tipps für Patienten: Individuelle Gesundheitsleistungen (IGeL) Christoph Storch wollte eigentlich nur eine Beratung zu einer Lesebrille von seinem Augenarzt haben. Ich wollte wissen, ob ich auch mit den

Mehr

Chemotherapie -ein Bilderbuch für Kinder

Chemotherapie -ein Bilderbuch für Kinder Chemotherapie -ein Bilderbuch für Kinder Unser Körper besteht aus verschiedenen Zellen, die ganz unterschiedlich aussehen. Jede Art erfüllt eine besondere Aufgabe. Da gibt es zum Beispiel Gehirnzellen,

Mehr

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen Bild 1 Ausdehnung eines Chromosoms (C) 1. Besteht aus Chromatin. Das ist die DNS + Proteine 2. Chromosomen liegen im Zellkern 3. Menschliche Körperzellen

Mehr

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Grundwissen Pränataldiagnostik 4 Grafik Pränataldiagnostiken 6 Die Produktefamilie 9 Robustheit von

Mehr

Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems

Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems 16. Heiligenstädter Kolloquium, IBA Heilbad Heiligenstadt, 2012-09-25 Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems Christine Steinbach

Mehr

Mit. BKK MedPlus. einfach besser versorgt!

Mit. BKK MedPlus. einfach besser versorgt! Mit BKK MedPlus einfach besser versorgt! DMP - Was ist das? Das Disease Management Programm (kurz DMP) ist ein strukturiertes Behandlungsprogramm für Versicherte mit chronischen Erkrankungen. Chronisch

Mehr

Personalisierte Krebsmedizin

Personalisierte Krebsmedizin Personalisierte Krebsmedizin Oncology PERSONALISIERTE MEDIZIN IN DER KREBSTHERAPIE gesunde Zelle Zellkern mit intakter DNA intakte DNA Genveränderung/ -mutation Zellteilung Genetisch veränderte Tochterzellen

Mehr

Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas

Mehr

Diese Liste von Überschriften aus den unterschiedlichsten

Diese Liste von Überschriften aus den unterschiedlichsten Quelle: NHGRI GWA Catalog, www.genome.gov/tudies Juli 2007, Deutsches Ärzteblatt: Asthma-Gen entdeckt. Eine Genvariante in Chromosom 17 erhöht bei Kindern das Risiko, an Asthma zu erkranken, um 70 Prozent.

Mehr

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Institut für f r Biochemische Verfahren und Analysen (IBVA) Genomik?! Tobias Schäfer Institut für f r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Inhalt Methoden der Gensequenzierung Nutzen genetischer

Mehr