Python im Bioinformatiker-Alltag

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Python im Bioinformatiker-Alltag"

Transkript

1 Python im Bioinformatiker-Alltag Marcel Martin Bioinformatik für Hochdurchsatztechnologien, TU Dortmund 6. Oktober von 27

2 Worum gehts? Bioinformatik Löst Probleme in Biologie oder Medizin Teilbereich Genominformatik Analysie des Erbguts (Genom) von Lebewesen Python im Bioinformatiker-Alltag 2 von 27

3 Übersicht 1 Ein bisschen Biologie 2 Sequenzdaten und Datenformate 3 Wie wir Python einsetzen 4 Unsere Python-Software 5 Gedanken zu Python in der Bioinformatik Python im Bioinformatiker-Alltag 3 von 27

4 Übersicht 1 Ein bisschen Biologie 2 Sequenzdaten und Datenformate 3 Wie wir Python einsetzen 4 Unsere Python-Software 5 Gedanken zu Python in der Bioinformatik Python im Bioinformatiker-Alltag 4 von 27

5 Molekularbiologie DNA Träger der Erbinformation Für Biologen: Zwei Kettenmoleküle aus vier Basen Adenin, Cytosin, Guanin, Thymin Paarung: immer A T und C G Für Informatiker: String über dem Alphabet {A, C, G, T} PD by Forluvoft Gen: Ein Abschnitt auf der DNA Python im Bioinformatiker-Alltag 5 von 27

6 Was machen wir? Fragen Welche Gene sind in bestimmten Zelltypen aktiv und wie stark? Python im Bioinformatiker-Alltag 6 von 27

7 Was machen wir? Fragen Welche Gene sind in bestimmten Zelltypen aktiv und wie stark? Wie unterscheidet sich Genaktivität in kranken und gesunden Zellen? Welche Gene sind an, welche aus? Python im Bioinformatiker-Alltag 6 von 27

8 Was machen wir? Fragen Welche Gene sind in bestimmten Zelltypen aktiv und wie stark? Wie unterscheidet sich Genaktivität in kranken und gesunden Zellen? Welche Gene sind an, welche aus? Welche Mutationen führen zu Krebs? Python im Bioinformatiker-Alltag 6 von 27

9 Was machen wir? Fragen Welche Gene sind in bestimmten Zelltypen aktiv und wie stark? Wie unterscheidet sich Genaktivität in kranken und gesunden Zellen? Welche Gene sind an, welche aus? Welche Mutationen führen zu Krebs? Welche Veränderungen in welchem Gen sind für eine erbliche Krankheit verantwortlich? Python im Bioinformatiker-Alltag 6 von 27

10 Was machen wir? Fragen Welche Gene sind in bestimmten Zelltypen aktiv und wie stark? Wie unterscheidet sich Genaktivität in kranken und gesunden Zellen? Welche Gene sind an, welche aus? Welche Mutationen führen zu Krebs? Welche Veränderungen in welchem Gen sind für eine erbliche Krankheit verantwortlich? Beantwortung mit Hochdurchsatz-DNA-Sequenzierung Python im Bioinformatiker-Alltag 6 von 27

11 Hochdurchsatz-DNA-Sequenzierung DNA-Fragmente aus Gewebeprobe (z. B. Blut) Sequenziergerät Kurze Zeichenketten bestehend aus A, C, G, T: Reads Foto: Illumina, Inc. Python im Bioinformatiker-Alltag 7 von 27

12 Technische Daten Illumina HiSeq 100 Basen pro Read 6 Milliarden Reads pro Durchlauf (14 Tage) 600 Gigabasen pro Durchlauf Python im Bioinformatiker-Alltag 8 von 27

13 Technische Daten Illumina HiSeq 100 Basen pro Read 6 Milliarden Reads pro Durchlauf (14 Tage) 600 Gigabasen pro Durchlauf Zum Vergleich Humangenom: 6 Gigabasen (in 2 23 Chromosomen) Python im Bioinformatiker-Alltag 8 von 27

14 Technische Daten Illumina HiSeq 100 Basen pro Read 6 Milliarden Reads pro Durchlauf (14 Tage) 600 Gigabasen pro Durchlauf Zum Vergleich Humangenom: 6 Gigabasen (in 2 23 Chromosomen) Gerätesoftware Frontend: Vista; Compute-Server: Linux Software teilw. in Python Python im Bioinformatiker-Alltag 8 von 27

15 Übersicht 1 Ein bisschen Biologie 2 Sequenzdaten und Datenformate 3 Wie wir Python einsetzen 4 Unsere Python-Software 5 Gedanken zu Python in der Bioinformatik Python im Bioinformatiker-Alltag 9 von 27

16 Sequenzdaten Ausgabe: gzip-komprimierte Textdatei im FASTQ-Format Zwei Reads plus ASCII-kodierte ATATATTATGTTACTTCCTTTAATGCATGTAACACATTTTGTAGTCATGTGTTTA... ATACCCATTCTGCACAGCACACACACTGTACAGCATACACACTGCACTTCACACA... + CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ... Python im Bioinformatiker-Alltag 10 von 27

17 Was geschieht mit den Daten? Read Mapping (wenn Genom der Spezies bekannt) Positioniere Reads mit Textsuchalgorithmen auf dem Genom Erlaube Unterschiede Sequenzierfehler oder Mutationen Finde Mutationen Vergleiche bekannte Referenz mit Reads und liste abweichende Stellen auf Python im Bioinformatiker-Alltag 11 von 27

18 Read Mapping Platziere Read auf Chromosom Erlaube: Zeichenveränderung, -löschung, -einfügung Alignment ( - : Lücke) Read: CT-ATCGCTTCTGTC Chromosom:... CAGCCAGGCTGATCCCTT-TGTCGAGTAGGAC... diff macht Ähnliches Python im Bioinformatiker-Alltag 12 von 27

19 SAM-Dateiformat Ausgabe der positionierten Reads im SAM-Dateiformat 1 Readname 2 Chromosom und Position 3 Alignment 4 Sequenz und Qualitätswerte Python-API für Zugriff auf SAM-Dateien: pysam 1 (nicht von uns) 1 Python im Bioinformatiker-Alltag 13 von 27

20 SAM-Viewer Python im Bioinformatiker-Alltag 14 von 27

21 Übersicht 1 Ein bisschen Biologie 2 Sequenzdaten und Datenformate 3 Wie wir Python einsetzen 4 Unsere Python-Software 5 Gedanken zu Python in der Bioinformatik Python im Bioinformatiker-Alltag 15 von 27

22 Software-Arten Einmal-Skripte Software-Bibliothek Neue Algorithmen Python im Bioinformatiker-Alltag 16 von 27

23 Einmal-Skripte Nur in einem Projekt interessant Wenn als Einzeiler möglich, dann in Bash, ansonsten in Python programmiert Beispiele quick and dirty, aber: immer mit (kurzer) Doku Konvertiere andere Sequenzformate zu FASTQ Importiere Mutationen in SQLite-Datenbank, führe ein SELECT aus, gib Ergebnis aus Python im Bioinformatiker-Alltag 17 von 27

24 Bibliothek / Sammlung Anforderungen Aufnahme wenn mehrfach ( 2) benötigt Hartkodierte Werte ok aber sofort Kommandozeilenparameter hinzufügen wenn nötig Wenn ich im Code nachschauen muss Doku verbessern Zur Zeit nur teilweise: Unit Tests Python im Bioinformatiker-Alltag 18 von 27

25 Entwicklung neuer Algorithmen Beispiele Read-Mapping-Algorithmus für Sequenziertechnologie mit besonderen Fehlertypen Suffix-Array-Konstruktionsalgorithmus Ablauf Prototyp immer in Python schnelle iterative Verbesserung Evaluation auf kleinen Testdaten Prototyp auf große Daten loslassen Langsam? Parallelisieren (Cluster), C-Erweiterung programmieren oder abwarten Python im Bioinformatiker-Alltag 19 von 27

26 Effizienz Python ist langsam! Oder? Beispiel Python ist schnell und effizient zu programmieren Rechenzeit ist billig, Arbeitszeit ist teuer Fremdes C++-Tool zum Kürzen von Reads in FASTQ-Datei reimplementiert in reinem Python Python war doppelt so schnell Wahl der Algorithmen ist viel wichtiger als Wahl der Programmiersprache! Python im Bioinformatiker-Alltag 20 von 27

27 Übersicht 1 Ein bisschen Biologie 2 Sequenzdaten und Datenformate 3 Wie wir Python einsetzen 4 Unsere Python-Software 5 Gedanken zu Python in der Bioinformatik Python im Bioinformatiker-Alltag 21 von 27

28 sqt SeQuencing Tools Kommandozeilentools (Python- und Shell-Skripte) Python-Module (in Python und C) MIT-Lizenz, Python im Bioinformatiker-Alltag 22 von 27

29 sqt SeQuencing Tools Kommandozeilentools (Python- und Shell-Skripte) Python-Module (in Python und C) Idee ähnlich wie Git: sqt-binary plus externe Subcommands in beliebiger Programmiersprache (sogar Perl) MIT-Lizenz, Python im Bioinformatiker-Alltag 22 von 27

30 sqt SeQuencing Tools Kommandozeilentools (Python- und Shell-Skripte) Python-Module (in Python und C) Idee ähnlich wie Git: sqt-binary plus externe Subcommands in beliebiger Programmiersprache (sogar Perl) Momentan unvollständig MIT-Lizenz, Python im Bioinformatiker-Alltag 22 von 27

31 Beispiel: fastamutate 1 import sys 2 from sqt import seqio 3 4 def mutate ( seq, rate =0.01): 5 # mutate and return 6 7 out = seqio. FastaWriter ( sys. stdout, wrap =80) 8 for record in seqio. FastaReader ( sys. argv [1]): 9 mutated = mutate ( record. sequence ) 10 out. write ( record.name, mutated ) Python im Bioinformatiker-Alltag 23 von 27

32 Cutadapt DNA-Moleküle enthalten am Ende Adaptoren (techn. Gründe) Wenn DNA-Fragment zu kurz, wird Adapter mitsequenziert GAGTGGTTGGAGAGGAGTTGTTGGGAGTTTGTGTCCTGCTGAGACACGCA cutadapt schneidet Adapter fehlertolerant ab Füllt anscheinend eine Marktlücke Läuft mit Python 2.6 bis 3.2 MIT-Lizenz, Python im Bioinformatiker-Alltag 24 von 27

33 Übersicht 1 Ein bisschen Biologie 2 Sequenzdaten und Datenformate 3 Wie wir Python einsetzen 4 Unsere Python-Software 5 Gedanken zu Python in der Bioinformatik Python im Bioinformatiker-Alltag 25 von 27

34 Python in der Bioinformatik ja bitte Bioinformatik-Tools: Es scheint alles zu geben aber schlecht (Abstürze, seltsame Ein- oder Ausgabeformate, verwaist, unsinnige oder keine Fehlermeldungen) Das wäre auch mit Python möglich ist aber schwieriger! (Exceptions, argparse) Python-Code ist aufs Wesentliche reduziert macht das Verstehen von Algorithmen einfacher Python im Bioinformatiker-Alltag 26 von 27

35 Um was es ging Moderne Sequenziergeräten produzieren Massen von Daten Python lässt sich dennoch sinnvoll anwenden Python-Code muss nicht von Anfang an wartbar und schön sein Die Bioinformatik verträgt mehr Python es würde Arbeit erleichtern und macht einfach Spaß! Python im Bioinformatiker-Alltag 27 von 27

36 Quelltextkompatibel mit Python 2 und 3 überall: from future import print_function, division 5 6 Stellen mit: if sys.version_info[0] >= 3: (darin z.b. xrange = range) Größtes Problem: str vs. bytes/bytearray (Elemente sind Strings der Länge 1 oder ints) Wie erstellt man sinnvoll installierbare gemischte Pakete aus Python-2- und Python-3-Tools? Python im Bioinformatiker-Alltag 1 von 1

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund Die Suche nach Genen in Bakteriengenomen BWInf-Workshop 22.-23. März 2011 Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund 1 Bioinformatik was ist das? Aufgabe: Analyse (molekular)biologischer

Mehr

Einführung in Python Teil I Grundlagen

Einführung in Python Teil I Grundlagen Einführung in Python Teil I Grundlagen Valentin Flunkert Institut für Theoretische Physik Technische Universität Berlin Do. 27.5.2010 Nichtlineare Dynamik und Kontrolle SS2010 1 of 22 Diese Einführung

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Read Mapping Projektmanagement im So3warebereich SeqAn

Read Mapping Projektmanagement im So3warebereich SeqAn Read Mapping Projektmanagement im So3warebereich SeqAn David Weese April 2010 Inhalt Einführung Reads erzeugen read simulator SWP Teilprojekte Projektplan EINFÜHRUNG 2 nd /Next GeneraGon Sequencing Technologien:

Mehr

Algorithmische Bioinformatik

Algorithmische Bioinformatik Algorithmische Bioinformatik Biologische Daten als Strings Ulf Leser Wissensmanagement in der Bioinformatik Ziele für heute Wert von Reduktionismus: Genome als Strings Reinschmecken in Stringmatching Erster

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

Funktionales Programmieren in Python

Funktionales Programmieren in Python Wintersemester 2008/2009 1 Funktionen sind Objekte 2 lambda Funktionen 3 apply 4 map 5 zip 6 filter 7 reduce 8 List Comprehension Funktionales Programmieren Wer nicht funktional programmiert, programmiert

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Erbgutanalyse mit wachsendem Automatisierungsgrad

Erbgutanalyse mit wachsendem Automatisierungsgrad Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/erbgutanalyse-mitwachsendem-automatisierungsgrad/ Erbgutanalyse mit wachsendem Automatisierungsgrad Mit einer eigens

Mehr

Bioinformatik: Schnittstelle zwischen Informatik und Life-Science

Bioinformatik: Schnittstelle zwischen Informatik und Life-Science Bioinformatik: Schnittstelle zwischen Informatik und Life-Science Andreas Zendler (PD Dr.rer.nat.Dr.phil.) GI / GChACM 12. ovember 2001 Inhaltsübersicht I. Einführung II. Bioinformatik III. Industrial

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Vorbesprechung Seminar Biomedical Informatics

Vorbesprechung Seminar Biomedical Informatics Vorbesprechung Martin Dugas und Xiaoyi Jiang Institut für Informatik Sommersemester 2016 Organisation Vorlage: Englischsprachige Publikation Vortrag: ca. 30min + 15min Diskussion, Blockseminar Anfang/Mitte

Mehr

Raspberry Pi. Foto und Video mit. - E. F. Engelhardt - von Juri Tafferner

Raspberry Pi. Foto und Video mit. - E. F. Engelhardt - von Juri Tafferner Universität zu Köln Institut für Historisch Kulturelle Informationsverarbeitung Am1 Hauptseminar Re-usable Content in 3D und Simulationssystemen Dozent: Prof. Dr. Thaller Foto und Video mit Raspberry Pi

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Bioinformatik

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Algorithmische

Mehr

Algorithmen und Programmieren II Einführung in Python

Algorithmen und Programmieren II Einführung in Python Algorithmen und Programmieren II Einführung in Python SS 2012 Prof. Dr. Margarita Esponda 1 Was ist Python? eine Skript-Sprache Anfang der 90er Jahre entwickelt. Erfinder: Guido van Rossum an der Universität

Mehr

Python Programmieren. Variablen, Ausdrücke und Anweisungen

Python Programmieren. Variablen, Ausdrücke und Anweisungen Python Programmieren Funktionen Module und Namensräume Datentypen in Python Was noch zu sagen bleibt... richard rascher-friesenhausen Programmierung SS 12 Daten: Wert und Typ Variablen Variablennamen und

Mehr

Linux Tutorium. 12. Shellprogrammierung. Version vom 02.07.2008 13:38:56

Linux Tutorium. 12. Shellprogrammierung. Version vom 02.07.2008 13:38:56 Linux Tutorium 12. Shellprogrammierung Version vom 02.07.2008 13:38:56 im Grunde ist ein Shell-Skript nichts anderes als eine Textdatei, welche Befehlsfolgen enthält Shell-Skripte werden im Wesentlichen

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Bioinformatik für Biochemiker

Bioinformatik für Biochemiker Bioinformatik für Biochemiker Oliver Kohlbacher, Steffen Schmidt SS 2010 3. Strings, Sequenzen und Python Abt. Simulation biologischer Systeme WSI/ZBIT, Eberhard Karls Universität Tübingen Übersicht Strings

Mehr

Was ist Bioinformatik?

Was ist Bioinformatik? 9. Kurstag: Bioinformatik Der Begriff "Bioinformatik" wurde 1989 erstmals von D.R. Masys im JOURNAL OF RESEARCH OF THE NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY erwähnt. Was ist Bioinformatik? Die

Mehr

Ergebnisse der Untersuchung zur Eignung einer Programmiersprache für die schnelle Softwareentwicklung kann der Informatikunterricht davon profitieren?

Ergebnisse der Untersuchung zur Eignung einer Programmiersprache für die schnelle Softwareentwicklung kann der Informatikunterricht davon profitieren? Ergebnisse der Untersuchung zur Eignung einer Programmiersprache für die schnelle Softwareentwicklung kann der Informatikunterricht davon profitieren? Zur Diplomarbeit: Eignet sich die Skriptsprache Python

Mehr

Linux Prinzipien und Programmierung

Linux Prinzipien und Programmierung Linux Prinzipien und Programmierung Dr. Klaus Höppner Hochschule Darmstadt Sommersemester 2014 1 / 25 2 / 25 Pipes Die Bash kennt drei Standard-Dateideskriptoren: Standard In (stdin) Standard-Eingabe,

Mehr

Sequenzen-Alignierung in der Bioinformatik

Sequenzen-Alignierung in der Bioinformatik Sequenzen-Alignierung in der Bioinformatik VO Algorithm Engineering Professor Dr. Petra Mutzel Lehrstuhl für Algorithm Engineering, LS 22. VO 23..26 Literatur für diese VO Volker Heun: Skriptum zur Vorlesung

Mehr

Genetik Was ist ein Gen - Der Code des Lebens

Genetik Was ist ein Gen - Der Code des Lebens Genetik Was ist ein Gen - Der Code des Lebens A) Teilungsvorgänge 1. Körperzellen Unser Körper besteht aus ca 3 Billionen Zellen, die alle die gleiche Erbsubstanz haben. Nur wirken die Erbanlagen nicht

Mehr

Schnelles Prototyping (Rapid Application Development, RAD)

Schnelles Prototyping (Rapid Application Development, RAD) Schnelles Prototyping (Rapid Application Development, RAD) Prof. Dr. rer. nat. habil. Uwe Aßmann Lehrstuhl Softwaretechnologie Fakultät für Informatik TU Dresden Softwaretechnologie, Prof. Uwe Aßmann 2

Mehr

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen 9.1 Welche Funktionen haben Sinneszellen und Sinnesorgan? Sinneszellen nehmen die Reize auf und wandeln die Information in elektrische Signale um. Die Sinnesorgane dienen unter anderem dazu. Beispiel Auge

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Netzwerksicherheit Musterlösung Übungsblatt 4: Viren

Netzwerksicherheit Musterlösung Übungsblatt 4: Viren Institut für Informatik Alina Barendt und Philipp Hagemeister Netzwerksicherheit Musterlösung Übungsblatt 4: Viren 1 Vorbereitung msg db "Virus" mov ah, 40h mov bx, 1 mov cx, $5 mov dx, msg int 21h ; Write

Mehr

Frankfurt am Main. Dortmund. Stuttgart. Düsseldorf

Frankfurt am Main. Dortmund. Stuttgart. Düsseldorf Aufgabenstellung Ein Handlungsreisender will seine Produkte in den zehn größten Städten Deutschlands verkaufen. Er startet in Berlin und will seine Reise dort beenden. Die zehn einwohnerreichsten Städte

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

GENETIK UND GENTECHNIK IM ALLTAG

GENETIK UND GENTECHNIK IM ALLTAG Benötigte Arbeitszeit: 10 Minuten GENETIK UND GENTECHNIK IM ALLTAG Konzept: Die Grundlagen der Vererbung und deren Anwendungsmöglichkeiten sollen in Hinblick auf gesellschaftliche und ethische Fragen behandelbar

Mehr

Projekt. Java-Anwendung für die Sequenzanalyse (Metagenomik und Transkriptomik)

Projekt. Java-Anwendung für die Sequenzanalyse (Metagenomik und Transkriptomik) Projekt Java-Anwendung für die Sequenzanalyse (Metagenomik und Transkriptomik) MHH Prof. Tümmler, Dr. Davenport FH Prof. Sprengel, Prof. Ahlers C. Davenport colindavengmail.com Version 27.09.2010 Spezifikation

Mehr

Eine Analyse des Effektes von Lernen auf Populationsfitness und Diversität in einer NK-Fitnesslandschaft. Lars Melchior

Eine Analyse des Effektes von Lernen auf Populationsfitness und Diversität in einer NK-Fitnesslandschaft. Lars Melchior Eine Analyse des Effektes von Lernen auf Populationsfitness und Diversität in einer NK-Fitnesslandschaft Lars Melchior Theoretische Grundlagen Theoretische Grundlagen Genetik Genetische Algorithmen NK

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie Grundwissenkarten Gymnasium Vilsbisburg 9. Klasse Biologie Es sind insgesamt 10 Karten für die 9. Klasse erarbeitet. davon : Karten ausschneiden : Es ist auf der linken Blattseite die Vorderseite mit Frage/Aufgabe,

Mehr

Algorithmen auf Sequenzen 12.04.2010

Algorithmen auf Sequenzen 12.04.2010 Algorithmen auf Sequenzen 12.04.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Dipl.-Inform Tobias Marschall (Skript) Zeit Mo 8:30-10; Übungen Mi 8:30-10 ca. alle 2 Wochen (Plan!) Ort OH14,

Mehr

Funktionen Häufig müssen bestimmte Operationen in einem Programm mehrmals ausgeführt werden. Schlechte Lösung: Gute Lösung:

Funktionen Häufig müssen bestimmte Operationen in einem Programm mehrmals ausgeführt werden. Schlechte Lösung: Gute Lösung: Funktionen Häufig müssen bestimmte Operationen in einem Programm mehrmals ausgeführt werden. Schlechte Lösung: Der Sourcecode wird an den entsprechenden Stellen im Programm wiederholt Programm wird lang

Mehr

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Lorette Weidel Agenda Hintergrund Aufgabenstellung Material & Methoden Ergebnisse Diskussion

Mehr

MATHEMATIK PROGRAMMIEREN MIT PYTHON

MATHEMATIK PROGRAMMIEREN MIT PYTHON MATHEMATIK PROGRAMMIEREN MIT PYTHON Univ. Prof. Dr. Stefan Müller-Stach AG Zahlentheorie 27. September 2006 PYTHON: Möglichkeiten einer Programmiersprache PYTHON: Objektorientierte Sprache von Guido van

Mehr

Einführung in die Programmierung

Einführung in die Programmierung : Inhalt Einführung in die Programmierung Wintersemester 2008/09 Prof. Dr. Günter Rudolph Lehrstuhl für Algorithm Engineering Fakultät für Informatik TU Dortmund - mit / ohne Parameter - mit / ohne Rückgabewerte

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Gentechnik: Dem genetischen Fingerabdruck auf der Spur Das komplette Material finden Sie hier: School-Scout.de 8.-11. Schuljahr Dipl.-Bio.

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Programmiersprachen in der Bioinformatik

Programmiersprachen in der Bioinformatik Programmiersprachen in der Bioinformatik Bioinformatik In der Biologie immer größere Datenmengen (z.b. Genome, Proteinsequenzen) Sequenzanalyse, Strukturvorhersage Informationen in Datenbanken abrufbar

Mehr

Programmiersprachen Einführung in C. Unser erstes C-Programm. Unser erstes C-Programm. Unser erstes C-Programm. Unser erstes C-Programm

Programmiersprachen Einführung in C. Unser erstes C-Programm. Unser erstes C-Programm. Unser erstes C-Programm. Unser erstes C-Programm Programmiersprachen Einführung in C Teil 2: Prof. Dr. int main (int argc, char *argv[]) int sum = 0; for (i = 0; i

Mehr

Luis Kornblueh. May 22, 2014

Luis Kornblueh. May 22, 2014 Einführung in die Bash Luis Kornblueh KlosterCluster Team 2013/2014, Klosterschule May 22, 2014 1 / 17 Inhaltsverzeichnis Einführung in das Scripting Einfache Beispiele Kommandos ersetzen Bedingungen Tests

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Erster Bug: eine Motte

Erster Bug: eine Motte SOFTWAREFEHLER Der erste Bug Erster Bug: eine Motte Der Begriff Bug (deutsch: Motte) stammt aus dem Jahre 1945, als Ingenieure in einem Schaltrelais eines Computers (Harvard Mark II-System) eine Motte

Mehr

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Babeș-Bolyai Universität Cluj Napoca Fakultät für Mathematik und Informatik Grundlagen der Programmierung MLG5005. Modulare Programmierung

Babeș-Bolyai Universität Cluj Napoca Fakultät für Mathematik und Informatik Grundlagen der Programmierung MLG5005. Modulare Programmierung Babeș-Bolyai Universität Cluj Napoca Fakultät für Mathematik und Informatik Grundlagen der Programmierung MLG5005 Modulare Programmierung Test Driven Development Refactoring Modular programmierung der

Mehr

Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck

Mehr

IT-Basics 2. DI Gerhard Fließ

IT-Basics 2. DI Gerhard Fließ IT-Basics 2 DI Gerhard Fließ Wer bin ich? DI Gerhard Fließ Telematik Studium an der TU Graz Softwareentwickler XiTrust www.xitrust.com www.tugraz.at Worum geht es? Objektorientierte Programmierung Konzepte

Mehr

Grundlagen von Python

Grundlagen von Python Einführung in Python Grundlagen von Python Felix Döring, Felix Wittwer November 17, 2015 Scriptcharakter Programmierparadigmen Imperatives Programmieren Das Scoping Problem Objektorientiertes Programmieren

Mehr

Einführung in Python. Gliederung

Einführung in Python. Gliederung Einführung in Python Stefan Dziwok Universität Paderborn 1. Februar 2007 Referenzen Python has been an important part of Google since the beginning, and remains so as the system grows and evolves. Today

Mehr

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Karl Heinimann, MD PhD Medizinische Genetik Universitätskinderspital beider Basel karl.heinimann@unibas.ch 14. Internationales Seminar DESO St.

Mehr

Grundlagen der Vererbung beim Hund

Grundlagen der Vererbung beim Hund Grundlagen der Vererbung beim Hund Züchterstammtisch: 10. August 2013 Referentin: Diana Ringpfeil Tätigkeit: Tierärztin Mail: Ringpfeil@arcor.de Referent: Kay Rostalski Diana Ringpfeil, Tierärztin, Kay

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

Die freie Programmiersprache Python mit Beispielen für ihren praktischen Einsatz. Python User Group Köln www.pycologne.de

Die freie Programmiersprache Python mit Beispielen für ihren praktischen Einsatz. Python User Group Köln www.pycologne.de Die freie Programmiersprache Python mit Beispielen für ihren praktischen Einsatz Python User Group Köln www.pycologne.de Übersicht Python pycologne Anwendungsbeispiele Python Klar strukturierte Allzweck-

Mehr

Grundlagen und Basisalgorithmus

Grundlagen und Basisalgorithmus Grundlagen und Basisalgorithmus Proseminar -Genetische Programmierung- Dezember 2001 David König Quelle: Kinnebrock W.: Optimierung mit genetischen und selektiven Algorithmen. München, Wien: Oldenbourg

Mehr

Seminar Visual Analytics im Wintersemester 2007/2008 bei Steffen Oeltze Fakultät für Informatik der O.v.G Universität Magdeburg

Seminar Visual Analytics im Wintersemester 2007/2008 bei Steffen Oeltze Fakultät für Informatik der O.v.G Universität Magdeburg Ausarbeitung zu dem Vortrag von Wolf Geisler über das Paper Hawkeye: An interactive visual analytics tool for genome assemblies von Schatz, Shneiderman et al. Seminar Visual Analytics im Wintersemester

Mehr

Projekt Systementwicklung

Projekt Systementwicklung Projekt Systementwicklung Effiziente Codierung: Laufzeitoptimierung Prof. Dr. Nikolaus Wulff Effiziente Codierung Der Wunsch effizienten Code zu schreiben entstammt mehreren Quellen: Zielplattformen mit

Mehr

Software und Visualisierungen. Erich Schubert, Dr. Arthur Zimek. 2013-0X-XX KDD Übung

Software und Visualisierungen. Erich Schubert, Dr. Arthur Zimek. 2013-0X-XX KDD Übung Software und Visualisierungen Erich Schubert, Dr. Arthur Zimek Ludwig-Maximilians-Universität München 2013-0X-XX KDD Übung Ein recht einfacher Datensatz, online unter: http://aima.cs.berkeley.edu/data/iris.csv

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp?

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp? Inhalt des Vortrags o genetische Grundlagen Was ist ein Haplotyp? o Wie findet man Erbfehler? basierend auf Phänotypen: Zwergwuchs basierend auf Genotypen: Braunvieh Haplotyp II o Zusammenfassung einige

Mehr

4.Grundsätzliche Programmentwicklungsmethoden

4.Grundsätzliche Programmentwicklungsmethoden 4.Grundsätzliche Programmentwicklungsmethoden 1.1 Grundlage strukturierter und objektorientierter Programmierung Begriff Software Engineering - umfaßt den gezielten Einsatz von Beschreibungsmitteln, Methoden

Mehr

Einstieg in die Informatik mit Java

Einstieg in die Informatik mit Java 1 / 32 Einstieg in die Informatik mit Java Effizienz Gerd Bohlender Institut für Angewandte und Numerische Mathematik Gliederung 2 / 32 1 Überblick: was ist Effizienz? 2 Landau-Symbole 3 Eier im Korb 4

Mehr

Java für C++ Programmierer

Java für C++ Programmierer Java für C++ Programmierer Alexander Bernauer bernauer@inf.ethz.ch Einführung in die Übungen zu Informatik II (D ITET) FS2010 ETH Zürich Ziel Allgemeiner Überblick Kennenlernen der Suchbegriffe Warum Java?

Mehr

Center for Biotechnology, Bielefeld

Center for Biotechnology, Bielefeld Andreas Albersmeier CeBiTec Bielefeld 3. Life Science Conference Analytik Jena Jena 14.05.2014 Center for Biotechnology, Bielefeld sketchup.google.com Genomik Transkriptomik Proteomics Metabolomics Genom

Mehr

Statistische Methoden in der Bioinformatik

Statistische Methoden in der Bioinformatik Statistische Methoden in der Bioinformatik Prof. Dr. Jörg Rahnenführer Raum 720 Email: rahnenfuehrer@statistik. tu-.de Voraussetzungen: Vordiplom in Statistik, Mathematik, Datenanalyse, Informatik Zeiten

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Der Bauplan des Lebens - unsere Erbanlagen (Klasse 9/10) Materialien im PDF-Format Das komplette Material finden Sie hier: School-Scout.de

Mehr

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette

Mehr

Programmierkurs Java

Programmierkurs Java Programmierkurs Java Konstruktor, Statische Methoden Packages Prof. Dr. Stefan Fischer Institut für Telematik, Universität zu Lübeck http://www.itm.uni-luebeck.de/people/fischer Initialisierung von Datenstrukturen

Mehr

Shell-Scripting Linux-Kurs der Unix-AG

Shell-Scripting Linux-Kurs der Unix-AG Shell-Scripting Linux-Kurs der Unix-AG Andreas Teuchert 8. Juli 2014 Was ist ein Shell-Script? Aneinanderreihung von Befehlen, die ausgeführt werden Bedingte und wiederholende Ausführung möglich Nützlich

Mehr

Klausur C-Programmierung / 15.02.2014 / Klingebiel / 60 Minuten / 60 Punkte

Klausur C-Programmierung / 15.02.2014 / Klingebiel / 60 Minuten / 60 Punkte Klausur C-Programmierung / 15.02.2014 / Klingebiel / 60 Minuten / 60 Punkte Musterlösung 1. Aufgabe (5 Punkte) Im folgenden Programmcode sind einige Fehler enthalten. Finden und markieren Sie mindestens

Mehr

Präzisions-Gentherapie

Präzisions-Gentherapie Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Gentherapie trifft auf erfolgreiche Stammzelltherapie bei Lebererkrankung

Mehr

Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas

Mehr

Programmieren mit Python

Programmieren mit Python Programmieren mit Python Programmieren heisst: Dem Computer sagen, was er tun soll. Die Befehle muss man übrigens in einer Sprache geben, die der Computer versteht. Darum sind verschiedene Programmiersprachen

Mehr

DNA-Sequenzierung. Martina Krause

DNA-Sequenzierung. Martina Krause DNA-Sequenzierung Martina Krause Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Internetanbindung von Datenbanken

Internetanbindung von Datenbanken Internetanbindung von Datenbanken Python und CGI CGI und Perl-1 Gliederung Die Programmiersprache Python CGI in Python Datenbankanbindung Umsetzungskonzepte Zusammenfassung Realisierung Python und CGI-2

Mehr

THE GO PROGRAMMING LANGUAGE. Michael Karnutsch & Marko Sulejic

THE GO PROGRAMMING LANGUAGE. Michael Karnutsch & Marko Sulejic THE GO PROGRAMMING LANGUAGE Part 1: Michael Karnutsch & Marko Sulejic Gliederung Geschichte / Motivation Compiler Formatierung, Semikolons Variablen, eigene Typen Kontrollstrukturen Funktionen, Methoden

Mehr

Schleifenprogrammierung in C/C++, Fortran und Pascal

Schleifenprogrammierung in C/C++, Fortran und Pascal Schleifenprogrammierung in C/C++, Fortran und Pascal Stefan Ackermann Mathematisches Institut der Universität Leipzig 8. April 2009 1 Die kopfgesteuerte Schleife Bei der kopfgesteuerten Schleife steht

Mehr

Stefan Rensing erforscht evolutionären Übergang von Algen zu Landpflanzen

Stefan Rensing erforscht evolutionären Übergang von Algen zu Landpflanzen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/stefan-rensing-erforschtevolutionaeren-bergang-von-algen-zu-landpflanzen/ Stefan Rensing erforscht evolutionären

Mehr

Java Application 1 Java Application 2. JDBC DriverManager. JDBC-ODBC Br idge. ODBC Driver Manager. Dr iver C. Dr iver D.

Java Application 1 Java Application 2. JDBC DriverManager. JDBC-ODBC Br idge. ODBC Driver Manager. Dr iver C. Dr iver D. 1 Copyright 1996-1997 by Axel T. Schreiner. All Rights Reserved. 7 Datenbankzugriff Prinzip Dieser Abschnitt beschäftigt sich mit dem Paket java.sql, das eine SQL-Schnittstelle für Java verkapselt. Java-Programme

Mehr

Grundlagen der Programmierung

Grundlagen der Programmierung Grundlagen der Programmierung Dr. Tom Kamphans 1. Vorlesung 12.10.2016 1 Organisatorisches Vorlesung: Mittwochs 14:00 15:30, Raum F 201 Übung: Mittwochs 15:45 19:00, Raum F 225 Übung: alle zwei Wochen

Mehr

Grundlagen der biologischen Evolution

Grundlagen der biologischen Evolution Ausgewählte Grundlagen der biologischen Evolution Grundlagen der biologischen Evolution Chromosome und Gene Genotyp und Phänotyp Evolutionsfaktoren Epigenetik und was wir sonst noch nicht verstanden haben

Mehr

Programmierung I Einführung in Python, Beyond the Basics

Programmierung I Einführung in Python, Beyond the Basics Höhere Datenstrukturen Programmierung I Einführung in Python, Beyond the Basics G. Zachmann Clausthal University, Germany zach@in.tu-clausthal.de Eines der Features, das Python so mächtig macht (VHLL)

Mehr

Programmieren I. Die Programmiersprache Java. www.kit.edu. Institut für Angewandte Informatik

Programmieren I. Die Programmiersprache Java. www.kit.edu. Institut für Angewandte Informatik Programmieren I Die Programmiersprache Java KIT Universität des Landes Baden-Württemberg und nationales Großforschungszentrum in der Helmholtz-Gemeinschaft www.kit.edu Eigenschaften von Java Java ist eine

Mehr

Informatik für Schüler, Foliensatz 21 Objektorientierte Programmierung

Informatik für Schüler, Foliensatz 21 Objektorientierte Programmierung rof. G. Kemnitz Institut für Informatik, Technische Universität Clausthal 23. April 2009 1/14 Informatik für Schüler, Foliensatz 21 Objektorientierte Programmierung Prof. G. Kemnitz Institut für Informatik,

Mehr

Warum sehen Kinder ihre Eltern ähnlich?

Warum sehen Kinder ihre Eltern ähnlich? Warum sehen Kinder ihre Eltern ähnlich? Du siehst aber deiner Mutter ähnlich! Sieh mal, er hat die Haare wie sein Vater! Du hast wirklich die Augen wie Mama und Oma! Diese oder ähnliche Sätze hat sicherlich

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

In memoriam Lisa. und aller Kinder, die nur viel zu kurz das Licht dieser Welt erblicken durften. Matthias Bloechle

In memoriam Lisa. und aller Kinder, die nur viel zu kurz das Licht dieser Welt erblicken durften. Matthias Bloechle In memoriam Lisa und aller Kinder, die nur viel zu kurz das Licht dieser Welt erblicken durften Matthias Bloechle 1 Mit Gentest zum Wunschkind? Prof. Dr. rer. nat. Wolfgang Schumann Institut für Genetik

Mehr

SOFTWARE ENGINEERING 3 TESTVORBEREITUNGEN UND UNIT-TEST

SOFTWARE ENGINEERING 3 TESTVORBEREITUNGEN UND UNIT-TEST SOFTWARE ENGINEERING 3 TESTVORBEREITUNGEN UND UNIT-TEST Gliederung 2 0. 1. 2. 3. Vorstellung Testvorbereitungen Planungsphase Definitionsphase Implementierungs-, Abnahme-und Einführungsphase Testphasen

Mehr

Flexibles E-Assessment auf Basis einer Service-orientierten Architektur

Flexibles E-Assessment auf Basis einer Service-orientierten Architektur auf Basis einer Service-orientierten Architektur Konzepte, Implementierung und Praxiserfahrungen Mario Amelung Katrin Krieger Dietmar Rösner Otto-von-Guericke-Universität Magdeburg Wissensbasierte Systeme

Mehr

VNUML Projektpraktikum

VNUML Projektpraktikum VNUML Projektpraktikum Michael Monreal, Tomasz Oliwa 14. Juni 2006 Abstract Entstanden im Projektpraktikum Simulationen mit User Mode Linux, der vnuml Multiinstaller und VOToN, das VNUML-Old-To-New Programm

Mehr

Assertions (Zusicherungen)

Assertions (Zusicherungen) April 10, 2005 Oberseminar Software-Entwicklung Inhalt 1. Einführung (Motivation, Tony Hoare, Programmverifikation) 2. Design by Contract (Idee, Eiffel) 3. Praxis: Programming by Contract for Python 4.

Mehr

Neuer Gentest für erbliche Augenerkrankung

Neuer Gentest für erbliche Augenerkrankung Gesellschaft zur Förderung Kynologischer Forschung Abschlussbericht Neuer Gentest für erbliche Augenerkrankung aus der gkf-info 34 Dezember 2011 Info 33 Dezember 2011 Grußwort Abschlussbericht Neuer Gentest

Mehr

6 Ein- und Ausgabe. Bisher war unsere (Bildschirm-) Ausgabe leichtflüchtig (

6 Ein- und Ausgabe. Bisher war unsere (Bildschirm-) Ausgabe leichtflüchtig ( 6 Ein- und Ausgabe Bisher war unsere (Bildschirm-) Ausgabe leichtflüchtig ( Drucken war hoffnungslos übertrieben); heute lernen wir, wie wir die Ergebnisse unserer Programme abspeichern können, um sie

Mehr