Vorlesung LV-Nr Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007

Save this PDF as:

Größe: px
Ab Seite anzeigen:

Download "Vorlesung LV-Nr. 954.104. Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007"


1 Vorlesung LV-Nr Molekularbiologie für Agrarwissenschaften J. Glößl, SS 2007 Thematik: Molekularbiologische Methoden Teil 1 Die ppt Folien wurden freundlicherweise von Prof. Florian Rüker aus der Vorlesung Einführung in die Molekularbiologie, LV , bereitgestellt Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 1

2 Biotechnologie vs. Gentechnik In der Biotechnologie werden (Mikro)organismen selektiert und genutzt, die in der Lage sind, ein bestimmtes Produkt mit guter Effizienz zu synthetisieren. Stammverbesserung erfolgt durch Selektion bzw. Screening. Oft werden die Organismen einer mutagenen Behandlung unterworfen (chemisch, Bestrahlung). Die Herstellung der Produkte erfolgt meist durch Fermentation Produktbeispiele: Alkohol, Antibiotika, Vitamine, Aminosäuren, Enzyme,... In der Gentechnik werden Veränderungen an isolierter DNA vorgenommen. Die neukombinierte oder mutierte DNA wird in eine Zelle eingebracht, die so mit neuen Eigenschaften ausgestattet wird. Der Austausch der genetischen Information ist möglich über Artgrenzen hinweg, zwischen Pflanzen- und Tierreich, zwischen Pro- und Eukaryonten Produktbeispiele: Expression menschlicher genetischer Information in Bakterien, Hefen, Pflanzen, etc., z.b. Insulin, Wachstumshormon, Interferone, Interleukine, Antikörper, Erythropoietin, etc.. Zur Produktion werden in der Regel biotechnische Verfahren (Fermentation) eingesetzt Gentechnik und Molekularbiologie werden oft synonym verwendet. Meist handelt es sich um eine Kombination gentechnischer, biotechnischer, biochemischer, mikrobiologischer und genetischer Verfahren Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 2

3 Eine einfache Klonierung Viele Fragen: Warum will ich etwas klonieren? Was mache ich mit dem klonierten Gen? Woher kommt die "Fremd-DNA"? Was ist ein Vektor und wozu brauche ich ihn? Was für Vektoren habe ich zur Auswahl? Wie bringe ich den Vektor in die Zellen hinein? Wie finde ich den "richtigen" Klon? Was mache ich dann damit? Wie führe ich die einzelnen Schritte durch? Was sind Restriktionsenzyme? Was ist Ligase? Brauche ich noch andere Enzyme? Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 3

4 Welche einzelnen Schritte muß ich bei einer Klonierung durchführen? Gewinnung der "Fremd"-DNA ("Insert") Auswahl eines geeigneten Vektors Präparation des Vektors (meist aus E. coli) Restriktionsverdau von Vektor und Insert Behandlung des Vektors mit Alkalischer Phosphatase Analyse der DNA mittels Agarose-Gelelektrophorese Ligation Transformation Selektion Screening Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 4

5 Warum will ich etwas klonieren? um einen (Mikro)organismus besser zu charakterisieren um (Mikro)organismen untereinander zu vergleichen um ein neues Gen zu finden um ein Protein herzustellen (= zu exprimieren) Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 5

6 Was mache ich mit dem klonierten Gen? sequenzieren, um die Basenabfolge analysieren zu können (regulatorische Regionen, codierende Regionen,...) mit anderen Genen vergleichen in einen anderen (Mikro)organismus einbringen, um dessen Eigenschaften zu veränden ausschalten, um die Bedeutung des Gens für den (Mikro)organismus zu untersuchen exprimieren, um das entsprechende Protein zu gewinnen verändern (= mutieren), um die Eigenschaften des mutierten Proteins zu untersuchen Query: 1 agcttttctcttctgtcaaccccacacgcctttggcaca 39 Sbjct: 1 agcttttctcttatgtcaaccccacacgcctttggcaca 39 Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 6

7 Restriktionsenzyme Die Entdeckung und Nutzbarmachung der Restriktionsendonukleasen (kurz Restriktionsenzyme) und der Ligasen waren die Meilensteine, die die Entwicklung der Gentechnik möglich machten. Die Restriktionsenzyme wurden entdeckt, als man untersuchte, wie sich Bakterien gegen Viren (Phagen) schützen. Sie zerschneiden die eindringende DNA der Viren. Ihre eigene DNA ist durch Methylierung an entsprechenden Stellen der DNA geschützt. Dafür besitzen die Bakterien ein entsprechendes Modifikationsenzym, das DNA an den Stellen methyliert, an denen das eigene Restriktionsenzym die DNA schneiden würde. Mit den Restriktionsenzymen lassen sich DNA-Stücke gezielt an bestimmten Stellen spalten. Ligasen sind Enzyme, die die zerschnittene DNA wieder zusammenfügen können. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 7

8 Beispiele für Restriktionsenzyme Hpa I stammt von Haemophilus parainfluenza. Es schneidet die 6 bp lange palindromische DNA-Sequenz in der Mitte glatt (blunt) durch. Eco RI stammt von Escherichia coli und schneidet eine 6 bp lange DNA-Sequenz überlappend durch, wobei klebrige Enden entstehen. Klebrig heißt hier, dass komplementäre Sequenzen mit dem herausragenden Ende hybridisieren können. Hier handelt es sich um 5 Überhänge. Hind III stammt von Haemophilus influenza und schneidet eine 6 bp lange DNA-Sequenz überlappend durch. Es entstehen 5 Überhänge. Pst I stammt von Providencia stuartii und schneidet ebenfalls überlappend. Es entstehen 3 Überhänge. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 8

9 Restriktionsenzyme Nutzung der klebrigen Enden: Zwei DNA-Sequenzen werden beide mit Eco RI geschnitten, wodurch die gezeigten überhängenden Enden entstanden. Sie passen genau zueinander. Der Spalt, der nach dem Verbinden (annealing) entstanden ist, kann durch Ligasen geschlossen werden. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 9

10 Typ II Restriktionsenzyme Restriktionsenzyme Schneide- und Methylierungsaktivität auf getrennten Proteinen binden an der Restriktionsstelle und schneiden auch dort (die meisten) benötigen kein ATP beliebt in der Gentechnik Typ I und III Restriktionsenzyme ein und dasselbe Enzym methyliert und schneidet die DNA binden an der Restriktionsstelle und schneiden woanders benötigen ATP als Energiequelle beschränkter Nutzen in der Gentechnik Laufrichtung DNA des Bakteriophagen λ, geschnitten mit EcoRI und HindIII Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 10

11 Prokaryotische Methylasen Methyltransferasen (Methylasen) erkennen spezifische DNA Sequenzen und übertragen eine Methylgruppe vom Cofaktor S-Adenosyl-L-Methionin (AdoMet) auf die Base der DNA. Methyltransferasen haben Bedeutung beim Schutz der Bakterien vor ihren eigenen Restriktionsenzymen, da entsprechend methylierte DNA gegen die Restriktionsaktivität unempfindlich ist. Auch beim mismatch repair System der Prokaryonten hat die Methylierung der DNA große Bedeutung. Zu jedem Restriktionsenzym gehört eine entsprechende Methyltransferase. Gewisse Methylasen, wie z.b. die dam Methylase, sind in vielen Bakterienstämmen verbreitet. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 11

12 Prokaryotische Methylasen Methylierung muß die Aktivität eines Restriktionsenzyms nicht unbedingt verhindern! Spezifität der dam-methylierung: GATC Erkennungssequenzen der Restriktionsenzyme sind kursiv und grün, dam-sequenz unterstrichen Enzyme die bei dam-methylierung nicht schneiden: ClaI ATCGATC NruI TCGCGATC TaqI TCGATC XbaI TCTAGATC Enzyme die trotz dam-methylierung schneiden: BamHI GGATCC BglII AGATCT PvuI CGATCG Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 12

13 DNA-Ligation DNA Ligase Reaktion. DNA Ligase katalysiert die Verbindung eines DNA-Stranges mit einer freien 3 - Hydroxylgruppe mit der freien 5 -Phosphatgruppe eines anderen Stranges. In Eukaryoten und Archea wird dabei ATP zu AMP und PPi gespalten. In Bakterien wird NAD+ zu AMP und Nicotinamide-mononucleotide (NMN) gespalten. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 13

14 Alkalische Phosphatase Ziel: zu verhindern, daß der Vektor ohne Insert ligiert P Insert OH OH P P OH Unbehandelter Vektor kann ohne Insert rezirkularisieren, was zu hohem Hintergrund an nichtrekombinantem Vektor führt. OH P OH OH OH OH Dephosphorylierter Vektor kann ohne Insert nicht rezirkularisieren 5' OH 3' OH 3' OH 5' OH Insert Ligation eines Inserts in dephosphorylierten Vektor. Die gaps werden nach der Transformation in der Zelle repariert. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 14

15 Agarose-Gel-Elektrophorese Vertikal Horizontal Gelmaterial: Agarose oder Polyacrylamid DNA wandert zur Anode auf Grund der stark negativen Ladung der Phosphatgruppen Siebeffekt des Gels lässt große Moleküle langsamer wandern als kleine Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 15

16 Agarose-Gel-Elektrophorese Konformation der DNA entscheidend für Wanderungseigenschaften: Plasmid-DNA kann in superhelicaler, entspannter oder linearer Form vorliegen. nur lineare Form nützlich zur Abschätzung der Größe eines DNA Fragments. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 16

17 Woher kommt das Insert (die "Fremd-DNA")? genomische (chromosomale) DNA enthält u.u. Introns kann direkt aus Zellen isoliert und kloniert werden kann auch mittels PCR vervielfältigt werden cdna (copy DNA) frei von Introns hergestellt mit Reverser Transkriptase, meist mit PCR vervielfältigt chemisch synthetisierte DNA jede beliebige Sequenz herstellbar Optimierung der verwendeten Codons Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 17

18 Isolierung von DNA aus Zellen Lyse der Zellen erste Barriere ist (meistens) die Zellwand Bakterien : Murein : Lysozym (meist aus Hühnereiweiß) Hefe : Glucane, Mannane, Chitin : Lyticase (aus Pilzen gewonnen) Pflanzen : Hauptbestandteil Zellulose : Zellulase allgemein: zermahlen (Kugelmühle), Hochdruck (French Press) zweite Barriere ist die Cytoplasmamembran Hitze SDS und andere Detergentien mechanische Belastung (Zermahlen, Pipettieren, Schütteln, Ultraschall) nächstes Problem sind Enzyme in der Zelle, v.a. DNasen Inaktivierung durch Hitze oder Proteasen (z.b. Proteinase K) Reinigung Fällung (Ethanol) Dialyse Chromatographie Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 18

19 Präparation eines Inserts aus genomischer DNA Das "Problem" ist es, die DNA in Stücke geeigneter Größe zu zerkleinern Verdau mit Restriktionsenzymen Zerkleinerung durch mechanische Kräfte, z.b. Scherkräfte oder Ultraschall partieller Verdau mit Restriktionsenzymen ist oft besser als kompletter Verdau, besonders dann, wenn man die Sequenz des Gens noch nicht kennt. Genom Vollständige Restriktion das ist das Gen, das wir klonieren wollen: zerschneidet unser Gen: partieller Verdau erzeugt eine große Zahl überlappender Fragmente Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 19

20 Was ist ein "partieller Verdau" und wie macht man ihn? ganz einfach: weniger Restriktionsenzym nehmen kürzer inkubieren partieller Verdau erzeugt eine große Zahl überlappender Fragmente Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 20

21 Einige Genom-Größen Organismus Genom-Größe ORFs Klassifikation Mycoplasma genitalium 580, Bacteria (not free living) Methanococcus jannaschii 1,664,974 1,738 Archaaea Haemophilus influenzae 1,830,137 1,727 Bacteria Escherichia coli 4,639,221 3,574 Bacteria Saccharomyces cerevisiae 12,067,280 5,800 Eukarya (fungus) Arabidopsis thaliana 115,400,000 25,498 Eukarya (angiosperm) Caenorhabditis elegans 97,000,000 19,099 Eukarya (nematode) Drosophila melanogaster 116,000,000 13,601 Eukarya (insect) Homo sapiens > 2,693,000,000 ~39,114 Eukarya (mammal) Zea mays ~5,000,000,000? Eukarya (angiosperm) Pinus resinosa ~68,000,000,000? Eukarya (pine tree) Amoeba dubia ~670,000,000,000? Eukarya (alveolate) ORF: open reading frame, d.h. längerer Abschnitt der für ein Protein codiert, begrenzt von Start- und Stopcodon Für Hintergrundinformation: Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 21

22 Präparation des Inserts mit Hilfe von Polymerase Chain Reaction (PCR) PCR Produkt Primer genomische DNA Buch von Kary Mullis (Nobelpreis Chemie 1993) Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 22

23 Präparation des Inserts in Form von cdna Problem: Expression eines eukaryontischen Gens, welches aus Introns und Exons aufgebaut ist, in einem prokaryontischen Expressionssystem. Bakterien können Introns nicht entfernen, d.h. sie können nicht splicen! Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 23

24 Präparation des Inserts in Form von cdna cdna = copy DNA (in DNA kopierte mrna) Wie bringe ich die Introns raus, um nur mehr die codierenden Abschnitte des Gens zu haben? Erkennung der reifen, gesplicten mrna: reife mrnas in Eukaryonten haben am 3'-Ende einen "poly-a-schwanz" mit Adenin-Resten, der erst nach dem Splicen von einem eigenen Enzym angehängt wird. 1. Reinigung der mrna durch chemische Extraktion und Affinitätschromatographie mit oligo-dt (Basenpaarung mit dem poly-a- Schwanz!!!). 2. Synthese des ersten Stranges der cdna mit Hilfe von Reverser Transkriptase. Als Primer kann z.b. oligo-dt oder auch ein spezifischer Primer eingesetzt werden. 3. Synthese des zweiten Stranges und Amplifikation der cdna mit Taq Polymerase und PCR Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 24

25 Isolierung von polya + mrna RNA in Puffer mit hoher Salzkonzentration Hitzedenaturierung, rasches Abkühlen Bindung an oligo-dt Zellulose Elution der polya + RNA in Puffer mit niedriger Salzkonzentration gesamt RNA polya - RNA polya + RNA Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 25

26 Synthese von cdna oligo dt Primer Reverse Transcriptase dntps RNA zerstören durch Behandlung mit NaOH oder einfacher: Hitzedenaturierung Primer (meist Zufallshexamere) DNA Polymerase (meist Taq Polymerase dntps Gemisch einzelner cdna Klone kann z.b. mit Gen-spezifischer Probe gescreent werden gewünschte cdna mit Gen-spezifischem Primer amplifizieren Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 26

27 Präparation des Inserts durch chemische DNA Synthese Es kann vorkommen, daß ein Gen bzw. eine cdna mit den bis jetzt beschriebenen Methoden nicht oder nur schwer zu erhalten ist, weil z.b. kein geeignetes Gewebe zur Verfügung steht, oder weil die mrna in ganz geringer Konzentration im Gewebe vorliegt. In so einem Fall bietet es sich an, das Gen durch chemische Synthese herzustellen. Ein weiterer Vorteil synthetischer Gene ist, daß man die Codons für die einzelnen Aminosäuren frei wählen kann. Es bestehen nämlich große Unterschiede in der "Vorliebe" der verschiedenen Lebewesen für einzelne Codons. Entsprechend exprimieren z.b. humane Gene in E. coli oft besser, wenn man anstatt der natürlichen, humanen cdna ein synthetisches Gen mit den von E. coli bevorzugten Codons verwendet. Synthetische Gene werden heute durch eine Kombination aus organischchemischer Synthese (Oligonukleotide) und enzymatischem Assembly und Amplifikation (PCR) hergestellt. Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 27

28 Zusammenfassung Biotechnologie und Gentechnik - Begriffe, Anwendungen Einfache Klonierung - Prinzip Fragen, die sich stellen wie und warum kloniert man ein Gen Woher kommt das Gen (das Insert) beim Klonieren genomische DNA cdna chemisch synthetisierte DNA Molekularbiologie für AW, VO , SS 2007 J. Glößl, Teil 1 28

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?


Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem


Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige


Molekularbiologische / gentechnische Methoden

Molekularbiologische / gentechnische Methoden Molekularbiologische / gentechnische Methoden MPM 1 Wie lässt sich ein spezifisches Gen/Genprodukt molekular analysieren? Fundamentales Problem: Komplexität biologischer Systeme MPM 2 Ein Ausschnitt aus



MOLEKULARBIOLOGISCHE METHODEN 45 MOLEKULARBIOLOGISCHE METHODEN Die Technik der DNA-Rekombination, auch als Gentechnik bezeichnet, erlaubt die Isolierung von DNA-Abschnitten (genomische oder cdna), deren Sequenzbestimmung, Modifikation


6. Übung. a) Meiose. b) Reverse TranskripEon. 1) λ- Phage f. c) Prokaryont. d) KonjugaEon. e) Mitochondrien. 4) A. thaliana a, e, g.

6. Übung. a) Meiose. b) Reverse TranskripEon. 1) λ- Phage f. c) Prokaryont. d) KonjugaEon. e) Mitochondrien. 4) A. thaliana a, e, g. 6. Übung 1) Ordnen Sie die unten gelisteten Modellsysteme den Begriffen zu. Anmerkung: Mehrfachzuordnungen sind möglich und einer der Begriffe passt zu keinem der genannten Modellsysteme a) Meiose 1) λ-


Antibiotika sind oft Inhibitoren der Genexpression

Antibiotika sind oft Inhibitoren der Genexpression Antibiotika sind oft Inhibitoren der Genexpression Inhibitoren der Transkription: Rifampicin, Actinomycin α-amanitin Inhibitoren der Translation: Puromycin, Streptomycin, Tetracycline, Chloramphenicol


Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese


PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen


Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................


Prüfungsfragenkatalog für für Grundlagen der Gentechnik und Biotechnologie (Prof. Prof. Rudolf Bauer und Prof. Karin Ardjomand-Wölkart)

Prüfungsfragenkatalog für für Grundlagen der Gentechnik und Biotechnologie (Prof. Prof. Rudolf Bauer und Prof. Karin Ardjomand-Wölkart) Prüfungsfragenkatalog für für Grundlagen der Gentechnik und Biotechnologie (Prof. Prof. Rudolf Bauer und Prof. Karin Ardjomand-Wölkart) Stand: September 2014 Termin: 29.09.2014 1. Was ist Western Blot?


3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark


Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei


DNA- Rekombinationstechnik. Gentechnik

DNA- Rekombinationstechnik. Gentechnik DNA- Rekombinationstechnik Gentechnik 1 Verwendung von Plasmiden in der Gentechnik Campbell 19.1 2 Die wichtigsten Schritte bei der DNA-Klonierung (Plasmid) Transformation 3 Durch Klonierung kann man DNA-Fragmente


1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli


Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn


Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung


2) Veröffentlichungsnummer: PATENTANMELDUNG

2) Veröffentlichungsnummer: PATENTANMELDUNG Europäisches Patentamt European Patent Office Dffice europeen des brevets 2) Veröffentlichungsnummer: 0 368 342 A2 EUROPAISCHE PATENTANMELDUNG 2) Anmeldenummer: 89120894.4 ) Anmeldetag: 10.11.89 it) Int.


Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid


Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?


Restriktion und Gentechnik

Restriktion und Gentechnik Restriktion und Gentechnik Einteilung 1.) Restriktion - Restriktionsenzyme - Southern Blotting 2.)Gentechnik - sticky ends - blunt ends Restriktion Grundwerkzeuge der Gentechnik - Restriktionsenzymanalyse


Forschungszentrum Karlsruhe

Forschungszentrum Karlsruhe Forschungszentrum Karlsruhe in der Helmholtz-Gemelnschaft Wissenschaftliche Berichte FZKA7106 Biochemische Charakterisierung der Isoprensynthase aus der Graupappel (Populus x canescens (Ait.) Sm.) und


Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.


Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1

Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1 Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1 1 Extremophile Organismen... 1 2 Halophile Mikroorganismen... 2 2.1 Lebensräume und


7 Prinzipien und Methoden der DNA-Klonierung

7 Prinzipien und Methoden der DNA-Klonierung 7 Prinzipien und Methoden der DNA-Klonierung Das Klonieren von DNA-Molekülen seien es DNA-Fragmente, komplette Gene oder sogar das ganze Genom eines Organismus stellt im Grunde genommen den Kern gentechnischer


Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,


Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)


DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2


Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII

Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII I INHALTSVERZEICHNIS Inhaltsverzeichnis... I Ein Vorwort... VII Synopse der Arbeit... IX Synopsis of the thesis... XIII A. Untersuchungen über die Stereoselektivität bakterieller, Pyruvat-abhängiger Aldolasen...


RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase


Inhaltsverzeichnis. 1 Einleitung... 1

Inhaltsverzeichnis. 1 Einleitung... 1 Inhaltsverzeichnis 1 Einleitung... 1 1.1 G-Protein-gekoppelte Rezeptoren... 3 1.1.1 Klassifizierung und Struktur von G-Protein-gekoppelten Rezeptoren... 6 1.1.2 Purinerge Rezeptoren... 12 1.1.3 Pharmazeutische


1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive...

1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive... Inhaltsverzeichnis 1 Einleitung... 13 1.1 Staphylokokken... 13 1.2 Koagulase-negative Staphylokokken... 13 1.3 Staphylococcus saprophyticus... 14 1.4 MSCRAMM-Proteine... 16 1.5 LPXTG-Motive... 16 1.6 Oberflächenassoziierte


27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der


Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983


3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA 3 Ergebnisse 3.1 Isolierung von leukozytärer Gesamt-RNA Um Ausgangsmaterial zur Isolierung von CD44-RNA zu erhalten, wurde aus einem Buffy coat (siehe Abschnitt Materialen und Methoden ) der Leukozytenanteil


"Gentechnik III - Rekombination und Transfer" (Biologie Sek. II)

Gentechnik III - Rekombination und Transfer (Biologie Sek. II) Inhalt und Einsatz im Unterricht "Gentechnik III - Rekombination und Transfer" (Biologie Sek. II) Diese DVD behandelt das Unterrichtsthema "Gentechnik" für die Sekundarstufe II. Das DVD-Hauptmenü bietet


4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur


Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese


Vorlesung LV-Nr Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007

Vorlesung LV-Nr Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007 Vorlesung LV-Nr. 954.104 Molekularbiologie für Agrarwissenschaften J. Glößl, SS 2007 Thematik: Molekularbiologische Methoden Teil 2 Die ppt Folien wurden freundlicherweise von Prof. Florian Rüker aus der


Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...


Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der


Techniken der. Nukleinsäure- und. Protein-Biochemie

Techniken der. Nukleinsäure- und. Protein-Biochemie Techniken der Nukleinsäure- und Protein-Biochemie Techniken der Nukleinsäure-Biochemie (Primer-) Synthese Restriktion, Analyse Ligation Expression PCR Klonierung in einen Expressions- Vektor Transformation


Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich


AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig Restriktionsenzyme Füllen Sie den Lückentext aus. PCR 1a Mit dem folgenden Quiz können Sie Ihr Wissen zum Thema PCR überprüfen. Klicken Sie jeweils die richtige Antwort an. PCR 1b Mit dem folgenden Quiz


Molekulargenetische Experimente IV: Plasmidpräparation

Molekulargenetische Experimente IV: Plasmidpräparation Molekulargenetische Experimente IV: Plasmidpräparation Plasmide sind kleine, ringförmige DNA-Moleküle in Bakterien, die in der Lage sind, sich selbst mit Hilfe von Enzymen zu replizieren. Gene, die auf


1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 Molekulare Struktur von NCAM S.


Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt USERGUIDE Seite 1 No. 201 Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt Temperierbereich: (RT 13 C) bis 99 C [MTPs: (RT 10 C) bis 70 C], Minimal


Vorbereitung. 4) Durchführungshinweise: 4.1 Prinzip erklären: Ablauf mit Zeitplanung und Gerätschaften 4.2 Pipettieren üben mit Aqua dest.!

Vorbereitung. 4) Durchführungshinweise: 4.1 Prinzip erklären: Ablauf mit Zeitplanung und Gerätschaften 4.2 Pipettieren üben mit Aqua dest.! Vorbereitung 1) am Vortag o.ä.: (wie Versuch 4) 1.1 Arbeitsblätter kopieren / bereitlegen. fertiges (Ergebnis-)Gel überprüfen Vorratslösungen überprüfen: Elektrophorese-Puffer, Aqua dest., Färbelösung


2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)


Mach-mit-Labor. Biochemie Prof. Rita Bernhardt

Mach-mit-Labor. Biochemie Prof. Rita Bernhardt Mach-mit-Labor Biochemie Prof. Rita Bernhardt Das Mach-mit-Labor Das Mach-mit-Labor (Betreiberin Prof. Dr. R. Bernhardt) bietet seit 2002 naturwissenschaftlich interessierten SchülerInnen die Möglichkeit,


DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die


Gentechnische Methoden

Gentechnische Methoden Desmond S. T. Nicholl Gentechnische Methoden 2. Auflage Aus dem Englischen übersetzt von Renate FitzRoy und Kurt Beginnen Spektrum Akademischer Verlag Heidelberg Berlin Inhalt Vorwort XI 1. 1.1 1.2 1.3


1971: Manipulation eines Viren-Genoms mit Restriktionsenzymen. 1973: Erstes gentechnisch verändertes Bakterium - Geburt der "Gentechnik"

1971: Manipulation eines Viren-Genoms mit Restriktionsenzymen. 1973: Erstes gentechnisch verändertes Bakterium - Geburt der Gentechnik Geschichte der Gentechnik Ein kleiner Überblick: 1970-1983 1/28 1966: Entschlüsselung des genetischen Codes 1970: Entdeckung der Restriktionsenzyme in Bakterien. 1971: Manipulation eines Viren-Genoms mit


Molekulare Klonierung Praktikum

Molekulare Klonierung Praktikum Molekulare Klonierung Praktikum 2013 Praktikumsaufgabe Ligation 1. Zusammensetzung des Ligationsreaktions-ansatzes : 1 l Vektor DNA 1 l Insert DNA 2 l 10X Ligase Puffer 15 l destillertes Wasser 1 l Ligase


Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes


Versuchsanleitung. Inhaltsverzeichnis. Restriktionsenzyme. Von Magnus Mauer. VAD_Biologie_Restriktionsenzyme.doc

Versuchsanleitung. Inhaltsverzeichnis. Restriktionsenzyme. Von Magnus Mauer. VAD_Biologie_Restriktionsenzyme.doc Restriktionsenzyme Von Magnus Mauer Inhaltsverzeichnis II Zielsetzung. Seite 02 III Hintergrundinformationen Seite 02 IV Restriktionsenzyme in der Gentechnik (Kopiervorlage für Schüler).... Seite 06 IV


Gentechnologie für Einsteiger

Gentechnologie für Einsteiger T. A. Brown Gentechnologie für Einsteiger 3. Auflage Aus dem Englischen übersetzt von Sebastian Vogel Spektrum Akademischer Verlag Heidelberg Berlin Vorwort Vorwort zur dritten englischen Auflage Vorwort


Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise


11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese

11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11.1 Einführung in die Problemstellung 11.1.1 Plasmid-DNA In der Gentechnik spielen Plasmide als Vektoren eine herausragende Rolle


Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -


Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Bernhard Strigel Gymnasium Kollegstufe/ Jahrgang: 2007/ 2009 Memmingen Leistungskurs: Biologie Kollegiat: Stefanie Funk Facharbeit Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Abgegeben


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können


Vorlesungsthemen Mikrobiologie

Vorlesungsthemen Mikrobiologie Vorlesungsthemen Mikrobiologie 1. Einführung in die Mikrobiologie B. Bukau 2. Zellaufbau von Prokaryoten B. Bukau 3. Bakterielles Wachstum und Differenzierung B. Bukau 4. Bakterielle Genetik und Evolution


Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Kolonie-PCR Polymerase


KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation


Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................


Identifizierung positiver Klone aus einer λ-phagenbibliothek

Identifizierung positiver Klone aus einer λ-phagenbibliothek Identifizierung positiver Klone aus einer λ-phagenbibliothek Betreuer: Elke Muth-Köhne und Nora Cavara Beginn des Versuchs: 9.00 Uhr im Praktikumssaal NBCF 04 Nord 1. Theoretischer Hintergrund 1.1 Screening



DNA-KLONIERUNG. DNA-KLONIERUNG http://openpcr.org/use-it/ DNA- KLONIERUNG: Vervielvältigung eines DNA-Moleküls In vitro - PCR In vivo in unterschiedlichen Wirtszellen POLYMERASE- KETTENREAKTION (Polymerase Chain Reaction,


Klonierung und Sequenzierung von DNA

Klonierung und Sequenzierung von DNA Klonierung und Sequenzierung von DNA Heike Mitternacht ( 10.08.2001 ) Inhalt Klonierung von DNA 1. Allgemeines 1.1. Klonierungsvektoren 1.1.1. Plasmidvektoren 1.1.2. Phagenvektoren 1.1.3. Cosmide, Phasmide


Genklonierung. Die Schritte der Genklonierung. Die Schritte der Genklonierung im Ueberblick:

Genklonierung. Die Schritte der Genklonierung. Die Schritte der Genklonierung im Ueberblick: Genklonierung Hinweis: Im Atelier finden Sie die CD "Gentechnik, interaktiv experimentieren". Sie betreten (vituell) das Biozentrum Basel und führen dort ein Klonierungsexperiment durch. Die Schritte der


Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien


Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine


Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)


F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in


Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt


Medizinische Fakultät Auswertestrategien von Microarrays Einführung

Medizinische Fakultät Auswertestrategien von Microarrays Einführung Medizinische Fakultät Auswertestrategien von Microarrays Einführung PD Dr. Knut Krohn IZKF Leipzig Dr. Markus Eszlinger Med. Klinik III Forschungslabor DNA RNA Hintergrund Charakteristisches Muster der


Grundlagen der Klonierung. Analytische Methoden der Biologie SS09 7 Klonierung und Gentechnik. Modul

Grundlagen der Klonierung. Analytische Methoden der Biologie SS09 7 Klonierung und Gentechnik. Modul Restriktion und Ligation: Restriktion und Ligation: Grundlagen der Klonierung Modul 2303-021 1 Restriktion und Ligation Verknüpfung von Fragmenten unterschiedlicher DNA Herkunft Restriktion und Ligation



NUKLEINSÄUREN UND GENTECHNOLOGIE NUKLEINSÄUREN UND GENTECHNOLOGIE Beispiele für Stoffinhalte aus der Chemie als Grundlage für das Verständnis dieses Teiles: nicht-kovalente chemische Bindungen, Koordinationsbindungen, funktionelle Gruppen


Alexandra Ribarits Institut für Saat- und Pflanzgut, Pflanzenschutzdienst und Bienen

Alexandra Ribarits Institut für Saat- und Pflanzgut, Pflanzenschutzdienst und Bienen Neue Techniken der Pflanzenzüchtung Cisgenetik, Intragenetik, Zink-Finger-Nukleasen (ZFN), Oligonukleotid-gerichtete Mutagenese (ODM), Agroinfiltration, RNA-abhängige DNA Methylierung (RdDM), Umkehrzüchtung


Stammzüchtung. Selektion von natürlichen Varianten. Ungerichtete genetische Veränderungen zufallsverteilte induzierte Mutagenese

Stammzüchtung. Selektion von natürlichen Varianten. Ungerichtete genetische Veränderungen zufallsverteilte induzierte Mutagenese Stammzüchtung Selektion von natürlichen Varianten Ungerichtete genetische Veränderungen zufallsverteilte induzierte Mutagenese Kreuzungen genetische Rekombination Sexuelle Kreuzungen Induzierte Zellfusion


Es gibt derzeit über 300 kommerziell erhältliche Restriktionsenzyme, die die DNA entweder glatt (blunt) oder überhängend (sticky) spalten.

Es gibt derzeit über 300 kommerziell erhältliche Restriktionsenzyme, die die DNA entweder glatt (blunt) oder überhängend (sticky) spalten. 4.3 Gentechnologie Bakteriophagen sind Viren, die prokaryontische Zellen befallen. Hierzu dockt der Phage an der bakteriellen Zellmembran an und injiziert sein Genom in das Cytoplasma. Das virale Genom


Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt. Rekombinante Wirkstoffe Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.de Praktische Definitionen Gentechnik Unmittelbare neukombination


PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen


Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses


MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Vorbereitung: Start des Serial Cloners ( unter Laufwerk K: im Ordner Win_SerialCloner2-5 Programm direkt im Ordner starten) K:\Win_SerialCloner2-5 (oder 2-6


DNA versus RNA. RNA Instabilität

DNA versus RNA. RNA Instabilität DNA versus RNA DNA stellt den eigentlichen Speicher genetischer Information dar, während RNA als Informationsüberträger und katalytisch in der Proteinbiosynthese agiert. Warum dient DNA und nicht RNA als


Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat


Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht


Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm)

Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Naturwissenschaft Daniel Knobeloch Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Diplomarbeit Bibliografische Information der Deutschen Nationalbibliothek:


Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen


1.2 Genomanalyse und Gendiagnostik

1.2 Genomanalyse und Gendiagnostik 1.2 Genomanalyse und Gendiagnostik Jens Hanke, Sabina Solinas-Toldo und Jörg Hoheisel 1.2.1 Einführung Eine Revolution ist im Gang, eine Revolution auf dem Gebiet der Medizin. Neuere Entwicklungen in der


Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die Regulation der enterobakteriellen Kapselbiosynthese Inaugural-Dissertation zur Erlangung der Doktorwürde vorgelegt


DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet


Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende


DNA: Aufbau, Struktur und Replikation

DNA: Aufbau, Struktur und Replikation DNA: Aufbau, Struktur und Replikation Biochemie Die DNA als Träger der Erbinformation Im Genom sind sämtliche Informationen in Form von DNA gespeichert. Die Information des Genoms ist statisch, d. h. in


Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck


2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 IV. Ergebnisse 90 2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 Die Konstruktion einer isogenen Toxinmutante des Stx2-produzierenden EHEC- Stamm O157:H7 86-24


MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest


1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?
