Michael Schmidt. Anti- HBc-Bestimmung: Sinn oder Unsinn. Blood donor screening for anti-hbc sense or nonsense?

Transkript

1 Anti- HBc-Bestimmung: Sinn oder Unsinn Blood donor screening for anti-hbc sense or nonsense? Michael Schmidt German Red Cross Blood Donor Service Baden-Wuerttemberg-Hessen and Johann Wolfgang Goethe University Frankfurt / Main, Germany Institute for Transfusion Medicine and Immunohematology

2 2 Transfusion transmitted hepatitis B virus infections in Germany Chudy et al. Hepatology 2006

3 3 3 Platelet and 4 Plasma Pheresis Donations Positive in Indiv. Donation PCR (ID-NAT) 9000 Apheresis Platelets Donations Follow-up x Plasma Pheresis Follow-up samples Pool-PCR positive (Geq/ml) ID-PCR Look-Back Days Chudy et al. Hepatology 2006

4 4 Mutation in the primer probe binding region AP160501: HBV G-Type Stuyver et al. 2000, J Gen Virol; 81:67-74 Start Precore Stop Codon gcgcaccagcaccatgtaactttttcacctctgcctaatcatctcttgttcatgtcctac Stop Codon 28 Start Core Insert 36 bp 1861 tgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc T Mismatch in Sense Primer Insert 36 bp 1921 atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagtt 1981 gctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttc 2041 agctttgtaccgggaatccttagagtcctctgatcattgttcgcctcaccatacagcact T C Mismatch in Antisense Primer 2101 caggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa Chudy et al. Hepatology 2006

5 5 Recipient related look back examinations with 22 invloved erythrocytes Date Anti-HBc Anti-HBc IgM Anti-HBs HBsAg HBV-ID-NAT HBV transmission Pos Neg 17IU/l Neg 2,3 IU/ml no* Pos Neg Neg Neg 5,3 IU/ml Confirmed Pos Neg N.t. Neg Neg No Pos Neg Neg Neg 4,7 IU/ml Possible Pos n. t. Neg n. t. Neg No Pos n. t. Neg n. t. 11,6 IU/ml Possible Pos n. t. Neg n. t. 9,1 IU/ml no* Pos n. t. Neg n. t. 2,4 IU/ml No Pos n. t. Neg n. t. 6,7 IU/ml No Pos n. t. Neg n. t. 3,7 IU/ml Possible Pos n. t. Neg n. t. 10,6 IU/ml No Pos n. t. Neg n. t. 7,7 IU/ml not transfused * death cause of primiary disease Gubbe et al. DGTI

6 Diagnostic windows for HBV 6 1. diag. window 2. diag. window DNA concentration HBsAg detection level anti HBc LOD NAT DNA Anti-HBc detection level HBsAg EIA EIA s/co Weeks after infection Years after infektion

7 7 Overwiev of TTID for HBV, HCV and HIV-1 in Germany 14 Einführung HCV PCR Einführung HIV-1 PCR Numbers of TTID per year (N) Einführung Anti-HBc HBV HCV HIV Mutation in primer/ probe binding region Time (years) Virus concentration (app. 10IU/ml) Funk, Haemovigilance report 2008

8 8 First description of a new molecular detection method 95 C 95 C 72 C 60 C 60 C Denaturation Annealing Elongation Denaturation Annealing Karry Banks Mullis Nobel prize chemistry 1993

9 Schmidt et al. V ox Sang. 2010;98:37-46 Blood donor screening for anti-hbc - sense or nonsense? 9 Roche s201 MPX v1.0 or v2.0 and DPX v1.0 Pools of 6, 24, 48 or 96 samples

10 Wuesten et al. Transfusion. 2011;51: Blood donor screening for anti-hbc - sense or nonsense? 10 Novartis Tigris Ultrio Plus ID-NAT or Pools of 8 or 16 samples

11 Blood donor screening for anti-hbc - sense or nonsense? Introduction anti-hbc screening German Red Cross, Zelos x100 MP-NAT pools of 96 samples anti-hbc studies HBV strategies 11

12 Comparison of three automated NAT systems 12 Parameter Roche s201 Novartis GRC, FFM MPX assay Tigris Ultrio Plus Zelos x100 (IU/ml) (IU/ml) (IU/ml) HAV 1.06 in development 0.8 HBV HCV HIV HIV ND 1.2 PB in development 9.7

13 Comparison of automated NAT systems 13 Pathogene DRK Zelos x100 Roche s201 MPX/ DPX Novartis Tigris ultrio plus HAV YES YES Projected HBV YES YES YES HCV YES YES YES HIV-1 YES YES YES HIV-1 dual targeting YES Projected YES HIV-2 Projected YES No PB19 YES YES Projected Bacteria Bakterienstrains Projected No No

14 Blood donor screening strategy at the German Red Cross 14 Serological HBsAg (1975) TPHA (1970s/1984) Anti-HIV 1/2 (1985) Anti-HCV (1992) CMV (1995) Anti-HBc (2006) HIV Combo (2008) MP-Pool PCR HBV (1997) HCV (1997) HIV-1 (1997) HAV (2000) Parvo B19 (2000) HIV-2 * * HIV-2 is currently tested in a validation study

15 15

16 16

17 17

18 18

19 19

20 20

21 21

22 22

23 23

24 24

25 25

26 Schmidt et al. V ox Sang. 2006;91: Blood donor screening for anti-hbc - sense or nonsense? 26

27 Hourfar et al. Int J Lab Hematol. 2009;31: Blood donor screening for anti-hbc - sense or nonsense? 27

28 28

29 29 Case control study results donors

30 30 Case control study results recipients

31 31 Case control study results recipients subgroups

32 32

33 33 3,475,605 donations 697 HBsAg RR 687/697 anti-hbc 540/697 MP-NAT 612/697 ID-NAT Screening by HBV MP-NAT and anti-hbc missed no HBV infective donation out of 3.4 million donations 2 MP-NAT/ ID-NAT only pos

34 34 Residual transfusion transmitted infection risk Bacterial risks NAT onlies Viral risks Contaminated platelets 1:1.428 Septic reactions 1: HBV HCV HIV 1 : (CI: million) 1 : million ( million) 1 : 4.3 million ( million) Schrezenmeier H. Transfusion. 2007; 47: Hourfar KM Transfusion 2008;48:

35 Blood donor screening in Europe 35 provided by JP Allain

36 Blood donor screening by NAT world wide 36 HCV HIV HBV INT F. NAT Vox Sanguinis 2011

37 NAT only blood donations world wide 37 Region/ country Virus Number of tested donations NAT only positive Rate/ donations HIV-1 2,202, Africa HCV 2,202, HBV 2,202, HIV-1 71,458, Asia/ Pacific HCV 71,458, HBV 50,679, HIV-1 110,860, Europe HCV 139,474, HBV 56,352, HIV-1 87,652, North America HCV 89,652, HBV 5,062, HIV-1 347, South America HCV 408, HBV Not done Not done HIV-1 272,520, Total HCV 303,196, HBV 114,286,214 1, INT F. NAT Vox Sanguinis 2011

38 38 Testing strategy Acute infections Chronic infections Mini-pool NAT HBsAg Mini-pool NAT Anti-HBc

39 RKI Epidem. Bulletin 2011 Blood donor screening for anti-hbc - sense or nonsense? Juli 2011 Epidemiologisches Bulletin Nr. 29 Robert Koch-Institut 263 Erkr. pro Einw IfSG, nicht Referenzdefinition IfSG, Referenzdefinition BSeuchG Meldejahr Abb. 1: An das RKI übermittelte Hepatitis-B-Fälle pro Einwohner nach Meldejahr, Deutschland, (in den Säulen: Anzahl der Fälle absolut)

40 RKI Epidem. Bulletin 2011 Blood donor screening for anti-hbc - sense or nonsense? 40 Anteil Geimpfter in % vollständig begonnen ,2 90,5 90, ,4 3, Abb. 6: Anteil gegen Hepatitis B geimpfter Kinder bei Einschulung, , Daten der Schuleingangsuntersuchungen (Stand: April 2011) Jahr

41 Conclusions 41 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: for HCV, HIV-1 and HBV, respectively

42 Conclusions 42 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B)

43 Conclusions 43 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app %

44 Conclusions 44 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app % Re-entry strategies based on HBV ID-NAT and anti-hbs screening are safe and able to reduce the lost of unspecific reactive blood donors

45 Conclusions 45 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app % Re-entry strategies based on HBV ID-NAT and anti-hbs screening are safe and able to reduce the lost of unspecific reactive blood donors More specific confirmation tests are still necessary for anti- HBc only reactive blood donations

46 Conclusions 46 Residual risk of transfusion transmitted infections is 1:11 million, 1:5 million and 1: for HCV, HIV-1 and HBV, respectively The higher risk for HBV can be explained by low level chronic infected HBV carrier (donors with occult hepatitis B) Introduction of anti-hbc is able to reduce the second diagnostic window period, but reactive screening results were unspecific in app % Re-entry strategies based on HBV ID-NAT and anti-hbs screening are safe and able to reduce the lost of unspecific reactive blood donors More specific confirmation tests are still necessary for anti- HBc only reactive blood donations No transfusion transmitted HBV infections after introduction of anti-hbc in 2006 in our blood donor service

47 Acknowledgement 47 E. Seifried W. Sireis M.K. Hourfar B. Rüster K. Gubbe G. Capalbo H. Klüter H. Schrezenmeier K. Janetzko U. Mayr-Wohlfart