Untersuchungen zur Cyclooxygenase-abhängigen Nephrogenese bei der Maus

Größe: px
Ab Seite anzeigen:

Download "Untersuchungen zur Cyclooxygenase-abhängigen Nephrogenese bei der Maus"


1 Aus dem Zentrum für Kinder- und Jugendmedizin Geschäftsführender Direktor: Prof. Dr. H.W. Seyberth Jetzt: Prof. Dr. R.F. Maier des Fachbereichs Medizin der Philipps-Universität Marburg AG Molekulare und Experimentelle Pharmakologie Leiter: Prof. Dr. R.M. Nüsing (jetzt: Klinische Pharmakologie, Johann Wolfgang Goethe-Universität Frankfurt) in Zusammenarbeit mit dem Universitätsklinikum Gießen und Marburg GmbH, Standort Marburg Untersuchungen zur Cyclooxygenase-abhängigen Nephrogenese bei der Maus Inaugural-Dissertation zur Erlangung des Doktorgrades der gesamten Humanmedizin dem Fachbereich Medizin der Philipps-Universität Marburg vorgelegt von Andreas Herud aus Offenbach am Main Marburg, 2008

2 Angenommen vom Fachbereich Medizin der Philipps-Universität Marburg am Gedruckt mit Genehmigung des Fachbereichs. Dekan: Prof. Dr. M. Rothmund Referent: Prof. Dr. R.M. Nüsing Korreferent: PD Dr. U. Kuhlmann

3 Inhaltsverzeichnis I Inhaltsverzeichnis I. Einleitung...1 I.1. Die physiologische Nierenentwicklung ÄÄÄÄÄÄ...1 I.2. Einfluss von NSAIDs auf die Nephrogenese ÄÄÄÄÄÄ..ÄÄ.8 I.3. Die Cyclooxygenase ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ...9 I.4. Das COX-2 -/- -Mausmodell.ÄÄÄÄÄÄÄÄÄÄÄÄÄÄ...13 I.5. Prostaglandin-Rezeptoren.ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ16 I.6. Ziel der Arbeit ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ19 II. Material und Methoden...20 II.1. Material ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ...20 II.1.1. Chemikalien ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ20 II.1.2. Medikamente ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ...20 II.1.3. Enzyme und Primer ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ.21 II.1.4. Instrumente und Apparaturen ÄÄÄÄÄÄÄÄÄÄÄ..21 II.1.5. Sonstige Materialien ÄÄÄÄÄÄÄÄÄÄÄÄÄÄ...22 II.1.6. Software ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ..22 II.1.7. Tiere ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ22 II.2. Methoden ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ23 II.2.1. Spritzschema ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ...23 II.2.2. Zusammensetzung der Medikamente ÄÄÄÄÄÄÄÄ.23 II ONO AE1-329 (EP-4-Agonist)...ÄÄ23 II ONO AE (EP-2-Agonist)...Ä...23 II ONO AE1-329 (EP-4-Agonist) plus ONO AE (EP-4-Agonist)...24 II NOC-12 (NO-Donator)...24 II Spermine NONOate (NO-Donator)...24 II Troglitazone (PPARÅ-Agonist)...25

4 Inhaltsverzeichnis II II ONO AE3-208 (EP-4-Antagonist)...25 II SC-236 (COX-2-Inhibitor)...26 II Parecoxib (COX-2-Inhibitor)...26 II GW (PPARd-Agonist)...26 II Rofecoxib (COX-2-Inhibitor) (Tränke) II SC-236 (COX-2-Inhibitor) (Tränke)...26 II Spermine NONOate (NO-Donator) (Tränke)...26 II.2.3. Verabreichen der Medikamente.27 II Spritzen der Mäuse 27 II Versuche über die Tränke...27 II.2.4. Genotypisierung.28 II Isolation der DNA II Polymerase-Kettenreaktion (PCR)...29 II Gelzubereitung...30 II Gelelektrophorese..30 II.2.5. Präparation der Mäuse 32 II.2.6. Fixieren der Organe 32 II.2.7. Parafineinbetten der Organe...33 II.2.8. Schneiden der Organe 34 II.2.9. Färben der Organe..34 II Mikroskopieren der Organe...36 II Statistische Auswertung.36 III. Ergebnisse.37 III.1. COX-2 -/-..37 III.1.1. Zusammenfassung der histomorphologischen Daten...39 III.2. COX-2-Inhibitoren III.2.1. Applikation von SC-236 über die Tränke

5 Inhaltsverzeichnis III III III Applikation von SC-236 intraperitoneal...43 Zusammenfassung der histomorphologischen Daten.45 III.2.2. Applikation von Parecoxib..45 III.2.3. Applikation von Rofecoxib.. 47 III.2.4. Zusammenfassung der histomorphologischen Daten..49 III.2.5. Vergleichende Zusammenstellung.49 III.3. PGE 2 -Rezeptoren...51 III.3.1. Applikation eines EP-2-Rezeptor-Agonisten 51 III Zusammenfassung der histomorphologischen Daten...54 III.3.2. Applikation eines EP-4-Rezeptor-Agonisten III Zusammenfassung der histomorphologischen Daten III.3.3. Applikation von EP-2- plus EP-4-Rezeptor-Agonisten..59 III Zusammenfassung der histomorphologischen Daten III.3.4. Applikation eines EP-4-Rezeptor-Antagonisten III Zusammenfassung der histomorphologischen Daten III.3.5. Vergleichende Zusammenstellung.63 III.4. NO Substanzen 65 III.4.1. Applikation von Spermine NONOate (NOC-22)...65 III Applikation von NOC-22 ab Tag E III Zusammenfassung der histomorphologischen

6 Inhaltsverzeichnis IV Daten ÄÄÄÄÄÄÄÄÄ..ÄÄÄÄÄÄ.70 III.4.2. Applikation von NOC-12 ÄÄÄ.ÄÄÄÄÄÄÄÄÄ..70 III Zusammenfassung der histomorphologischen Daten ÄÄÄÄÄÄÄÄÄÄÄ.ÄÄÄÄ..72 III.4.3. Vergleichende Zusammenstellung ÄÄÄÄÄÄÄÄÄ.72 III.5. PPAR-Agonisten..ÄÄÄÄÄ.ÄÄÄÄÄÄÄÄÄÄÄÄÄ.74 III.5.1. Applikation des PPARÅ-Agonisten Troglitazone ÄÄÄ...74 III.5.2. Applikation des PPARÇ-Agonisten GW Ä..Ä.Ä.75 III.5.3. Zusammenfassung der histomorphologischen Daten Ä.Ä77 III.5.4. Vergleichende Zusammenstellung ÄÄÄÄÄÄÄÄÄ.77 IV. Diskussion.79 IV.1. Einfluss von COX-2-Inhibitoren auf die Nephrogenese ÄÄÄ...80 IV.2. Einfluss von EP-Agonisten auf die Nephrogenese.ÄÄÄÄÄ...82 IV.3. Einfluss eines EP-4-Antagonisten auf die Nephrogenese ÄÄÄ.84 IV.4. Einfluss von NO-Substanzen auf die Nephrogenese ÄÄÄÄÄ.84 IV.5. Einfluss von PPAR-Agonisten auf die Nephrogenese ÄÄÄÄ..85 V. Zusammenfassung...88 VI. Literaturverzeichnis 90 VII. Abkürzungsverzeichnis VIII. Anhang...100

7 Inhaltsverzeichnis V VIII.1. Verzeichnis der akademischen Lehrer..100 VIII.2. Danksagung..100

8 Einleitung 1 I. Einleitung I.1. Die physiologische Nephrogenese Das Genital-, und auch das Harnsystem mit Niere, entwickeln sich aus dem intermediären Mesoderm. In der 4. Woche beginnt der Embryo sich abzufalten. Dabei wird das intermediäre Mesoderm nach ventral verlagert und in der Leistenregion entsteht durch eine längliche Vorwölbung die Nierenleiste, die, zusammen mit der Genitalleiste, die Urogenitalfalte bildet. Über ein Mesenterium, sind beide Leisten mit der dorsalen Leibeswand verbunden. Es entwickeln sich nun 3 Generationen von Nieren, die sich sowohl in ihrem lokalen und zeitlichen Auftreten als auch in ihrem Differenzierungsgrad voneinander unterscheiden. Es findet sich ein Wachstum in kraniokaudaler Richtung und ein Überschneiden in der zeitlichen Abfolge, wobei nie alle drei Generationen gleichzeitig angelegt sind. Dabei darf allerdings nicht der Eindruck entstehen, dass diese sich völlig unabhängig voneinander entwickeln. So haben beispielsweise alle drei einen einheitlichen Nierengang, der als Vornierengang entsteht, sich als Urnierengang bzw. Wolff-Gang fortsetzt, und aus dem die spätere Ureterknospe entspringt, gemeinsam. Im Einzelnen setzen sich die unterschiedlichen Nierengenerationen aus der Vorniere (Pronephros), die der Niere einiger primitiver Fische entspricht, der Urniere (Mesonephros), die ähnlich der Niere von Amphibien und Fischen ist, und der Nachniere (Metanephros) zusammen (s. Abb. 1). Vorniere (Pronephros). Diese wird beim menschlichen Embryo Anfang der 4. Woche im Zervikalbereich angelegt. Sie ist rudimentär und hat bei höheren Vertebraten keine Funktion. Es werden zwar 5 7 Tubuli und Glomeruli gebildet, am Ende der 4. Woche haben sich diese aber schon wieder zurückgebildet. Einzig der Vornierengang bleibt erhalten. Dieser entsteht aus dorsal gelegenen aussprossenden Mesenchymzellen des intermediären Mesoderms. Er wird epithelialisiert, bekommt ein Lumen und zieht nach kaudal. In Höhe der Urniere erhält er Anschluss an die Urnierenkanälchen und mündet um den 26. Tag in die Kloake. Dieser Gang wird nun als Wolff-Gang bezeichnet.

9 Einleitung 2 Abb. 1; Schema der drei embryonalen Nierengenerationen im Bereich der dorsalen Rumpfwand. H = Herzbeutel, L = Leberanlage, ZNS = Zentrales Nervensystem (nach Rohen, Lütjen- Drecol; Funktionelle Embryologie; Schattauer [2003]) Urniere (Mesonephros). Sie entsteht in direktem Anschluss an die Vorniere am Ende der 4. Woche im Thorakal- bzw. Lumbalbereich und wird dabei durch den Wolff-Gang induziert. Bei einigen Säugetieren erlangt die Urniere eine Funktion, beim Menschen dagegen wird eine Funktion von sehr geringem Ausmaß zwischen der 6. und 10. Woche angenommen. Durch Zellverdichtungen und Lumenbildung im mesonephrogenen Gewebe werden Urnierenbläschen gebildet, die zu S-förmigen Schläuchen, den Urnierenkanälchen, heranwachsen (s. Abb. 2a-c). Dabei wachsen sie soweit nach lateral vor, bis sie den Wolff-Gang erreichen und mit diesem verschmelzen. An ihrem medialen Ende bilden die Kanälchen bzw. Tubuli zweischichtige epitheliale Becher, die so genannte Bowman-Kapsel, in die sich Kapillarschlingen mesenchymaler Herkunft einstülpen (s. Abb. 2d-e). Die Entwicklung dieser Strukturen geschieht nacheinander von kranial nach kaudal. So kommt es dazu, dass sich lumbal gelegene Urnierenkanälchen gerade erst bilden, während thorakal gelegene bereits wieder degenerieren. Auf diese Weise gibt es nie mehr als 40 Tubuli zur gleichen Zeit. Mit Eintritt in die Fetalzeit ist meist schon die gesamte Urniere zurückgebildet. Beim Mann bildet der Wolff-Gang den ableitenden Samenweg.

10 Einleitung 3 Abb. 2; A: Querschnitt durch einen 5 Wochen alten Embryo zur Darstellung des mesonephrogenen Gewebes, aus dem sich die Urnierenkanälchen entwickeln. B-E: Querschnittschemata der verschiedenen Entwicklungsstadien der Urnierenkanälchen. (nach: Moore, Persaud; Embryologie - Lehrbuch und Atlas der Entwicklungsgeschichte des Menschen; Schattauer [1996]) Nachniere (Metanephros). Die Nachniere beginnt sich am Anfang der 5. Woche in Höhe des ersten Sakralsegments zu entwickeln. Dazu fängt die Ureterknospe kurz vor dem Übergang in die Kloake an, aus dem Wolff-Gang nach dorsokranial in das metanephrogene Blastem auszusprossen. Dieser Vorgang induziert die umliegenden Mesenchymzellen sich zu verdichten und sich wie eine Kappe über die Knospe zu legen. Dies wiederum induziert die Ureterknospe sich kontinuierlich dichotom zu teilen. In dessen Folge entstehen Ureter, Nierenbecken, Nierenkelche und aufeinander folgende Generationen von Sammelrohren. Dabei bilden die ersten drei bis vier Ge-

11 Einleitung 4 nerationen dieser Rohre, durch Vergrößerung und Konfluenz, die Calices maiores, und die zweiten vier die Calices minores (s. Abb. 3). Abb. 3; Vier aufeinander folgende Stadien der Nachnierenentwicklung. (nach: Moore, Persaud; Embryologie - Lehrbuch und Atlas der Entwicklungsgeschichte des Menschen; Schattauer [1996]) Alle weiteren Generationen bilden die definitiven Sammelrohre. Weiter induziert diese immer weiter fortschreitende dichotome Teilung am Ende der 6. Woche die mesenchymalen Zellverdichtungen, um das Ende der blind endenden Sammelrohre zu epithelialisieren und Bläschen zu bilden. Diese entwickeln sich dann zu sog. Comma-shaped bodies und anschließend zu S-shaped bodies weiter (s. Abb. 4). Dabei formt dieser, durch Eindringen von Endothel- und vermutlich von Mesangiumvorläufer-Zellen in den unteren Spalt des S-shaped body, das Glomerulum (s. Abb. 5). Anschließend kommt es bis zum Verschmelzen mit dem jeweiligen Sammelrohr um die 10. Woche, zu einem Längenwachstum dieses S-förmigen Tubulus, in dessen Verlauf proximaler Tubulus, Henle-Schleife und distaler Tubulus entstehen. In diesem Prozess entstehen Nephrone in der Nierenrinde von außen nach innen, ehe die Entwicklung in der 34. bzw. 35. Woche abgeschlossen ist.

12 Einleitung 5 Abb. 4; Schematische Präsentation der Nephrogenese. A: lockeres Mesenchym B: Kondensation; 1: Ureterepithel 2: Blutgefäße 3: undifferenziertes Epithel 4: in Epithel differenzierendes kondensiertes Mesenchym C: Comma-shape Tubulus D: S-shape Tubulus E: Tubulus Längenwachstum F: Podozytenfalten; Epithelial ureter bud: epithelialisierte Ureterknospe; Capsule: Kapsel (nach Gomez et al.; Recent advances in renal developement; Current Opinion in Pediatrics 11 [1999])

13 Einleitung 6 Abb. 5; Wichtige Schritte in der Vaskularisation eines Nephrons. UB: Ureterknospe; JG cell: Juxtaglomeruläre Vorläuferzelle; smooth muscle cell: Zelle glatter Muskulatur; endothelial cell: Endothelzelle; mesenchymal cell: Mesenchymzelle (nach Gomez et al.; Recent advances in renal developement; Current Opinion in Pediatrics 11 [1999])

14 Einleitung 7 In viele der oben beschriebenen Vorgänge scheinen unterschiedliche Gene involviert zu sein. Eine Auflistung bekannter Gene, die für eine reibungslose Nierenentwicklung in den einzelnen Differenzierungsstadien von Bedeutung zu sein scheinen und was bei einem Defekt zu beobachten ist, gibt Tabelle 1 und Abb. 6. Gen Gewebeexpression Defekt Proteoglykane und ihre biosynthetischen Enzyme Hs2st UK, MM Fehlende Nierenanlage durch fehlende UK-Teilung und mesenchymale Kondensation Gpc3 UK,MM Selektive Degeneration d. medullären Sammelrohre Transkriptionsfaktoren Emx2 UK, MM Fehlen von Niere, UK, Genitaltrakt Eya1 MM Fehlendes UK-Wachstum und MM-Induktion Foxc1 MM Zwei Nieren und doppelte UKs Foxd1 S Kleine Nieren mit wenigen Nephronen Pax2 UK, MM Fehlerhaftes UK-Wachstum, MM wird nicht induziert Rara, Rarb UK, S, MM Hypoplasie/Agenesie Sall1 MM Fehlerhaftes UK-Wachstum Wt1 MM MM begeht Apoptose Wachstumsfaktoren Bmp4 (het) MM Hypo-/Dysplastische Niere, Hydroureter, Doppelsammelrohre Bmp7 UK, MM Schwere Hypoplasie mit wenigen Nephronen und Sammelrohren Fgf7 S Kleine Nieren, wenig UK-Verzweigungen und Nephronen Gdnf MM Agenesie, da fehlerhaftes UK-Wachstum Wnt4 MM Fehlerhafte Tubulusformationen Wachstumsfaktoren/-rezeptoren Gfra1 UK, MM Agenesie, da fehlerhaftes UK-Wachstum Notch2 MM Glomeruläre Defekte Ret UK Fehlerhafte UK-Wachstum Tab. 1; MM: Metanephrogenes Mesenchym; S: Stromazellen; UK: Ureterknospe

15 Einleitung 8 Abb. 6; Schrittweise Differenzierung des Ureter und des Mesenchym in Abhängigkeit verschiedener Gene (nach Kuure et al.; Kidney morphogenesis: cellular and molecular regulation; Mechanism of development 92 [2000]) I.2. Einfluss von NSAIDs auf die Nephrogenese Im klinischen Alltag sind non steroidal anti-inflammatory drugs (NSAIDs) wie Acetylsalicylsäure (ASS) und Indomethacin häufig verwandte Arzneimittel. Dabei reicht die Indikation von einfachem Kopfschmerz, über Infarktprophylaxe in Herz und Gehirn, bis hin zur Tokolyse und Polyhydramnion-Therapie. Hieraus ergibt sich auch direkt das Problem, welches erstmals von Novy [1978] am Rhesusaffenfetus nach Indomethacineinnahme gezeigt wurde. Nimmt eine Schwangere Indomethacin für mehr als 48 h aus z.b. einem der oben genannten Gründe ein, kann hieraus in utero ein Oligohydramnion mit postnataler Anurie und im schlimmsten Fall der perinatale Tod resultieren [van der Heijden et al., 1994]. Hervorgerufen wird dies unter anderem durch eine Nierenfehlentwicklung mit folgender tubulärer Dysfunktion und Niereninsuffizienz, bis hin zum akuten Nierenversagen [Restaino et al., 1991; Niebyl und Witter, 1986; Simeoni et al., 1989; Heuden et al., 1988]. Dabei kann neben der glomerulären Filtrationsrate (GFR) auch der renale Blutfluss (RBF) reduziert sein [Kaplan et al., 1994]. Dies ist deutlich zu sehen am gestiegenen Serum-Kreatinin Wert [Norton et al., 1993]. Beim Erwachsenen deutet dies auf ein hä-

16 Einleitung 9 modynamisches Problem hin und ist gehäuft bei Patienten mit ohnehin geschwächter Nieren-, Herz- und Leberfunktion zu verzeichnen [Leone et al., 1999]. Bei mikroskopischer Betrachtung fällt auf, dass in der Frühphase der Nierenentwicklung die S-shaped bodies verformt und die sich entwickelnden Tubuli aufgerollt erscheinen. Im weiteren Verlauf stellen sich die Glomeruli als zu klein bzw. als multiple Anlage in dillatierten Bowman-Kapseln dar, denen sich atrophische Tubuli anschließen [van der Heijden et al., 1994]. Dabei sind die Glomeruli von kuboidalen oder zapfenförmigen Podozyten bedeckt [Kaplan et al., 1994]. Bei der Übersichtsbetrachtung der von van der Heijden [1994] als normal groß und von Novy [1978] als zu klein beschriebenen Nieren sind zahlreiche zystische und fibrotische Veränderungen zu sehen [Kaplan et al., 1994]. Durch den reduzierten renalen Blutfluss (RBF) sieht der tiefe Kortex ischämisch aus [van der Heijden et al., 1994]. Weitere beobachtete Nebenwirkungen unter NSAID-Einnahme sind der zu frühe Verschluss des Ductus arteriosus, der Hydrops fetalis, die Ileumperforation, diverse Blutungen, eine pulmonale Hypertonie, äußerstenfalls eine Totgeburt [Kaplan et al., 1994]. I.3. Die Cyclooxygenase NSAIDs wirken durch Hemmung des Enzyms Cyclooxygenase (COX). Prostaglandine sind das Produkt der Cyclooxygenase (Prostaglandinsynthase). Ausgangspunkt der Synthese ist die Arachidonsäure. Diese ist eine essentielle, mehrfach ungesättigte Fettsäure, die entweder erst aus anderen essentiellen, mehrfach ungesättigten Fettsäuren vom Körper gebildet oder mit der Nahrung zugeführt wird. Sie wird dann in Phospholipide der Plasmamembranen eingebaut, um dann bei Bedarf durch die Phospholipase A 2 wieder freigesetzt zu werden. Damit steht sie als essentielles Substrat der Synthese von Eicosanoiden zur Verfügung. Diese können auf zwei unterschiedlichen Wegen produziert werden. Zum einen über den Cyclooxygenaseweg, hier entstehen Prostacycline, Prostaglandine und Thromboxane, und zum anderen über den Lipoxygenaseweg, durch den Leukotriene produziert werden. Die COX ist ein membrangebundenes Haem- und Glycoprotein, das sowohl Bisoxygenase- als auch Peroxydaseaktivität besitzt. Aus Arachidonsäure synthetisiert sie

17 Einleitung 10 Éber PGG 2 das Endoperoxid PGH 2, welches seinerseits Substrat fér die Bildung der Prostaglandine (PGE 2, PGF 2Ñ, PGD 2 ), des Prostacyclins (PGI 2 ) und des Thromboxans (TXA 2 ) ist [Smith, Marnett, DeWitt, 1991] (s. Abb. 7). Diese gehören zusammen mit den Leukotrienen zur Gruppe der Eicosanoide, den so genannten Gewebshormonen. Sie können von fast allen KÖrperzellen synthetisiert werden und ihre Funktion ist vielfültig. Diese reichen von der Tonuskontrolle glatter Muskulatur (Blutdruck, Bronchien, Uterus), Éber die Beeinflussung der Zellwanderung und - aggregation (Leukozyten, Thrombozyten), bis hin zu wirkungsvollen Schmerzsignalen an Nociceptoren. Dabei entfalten sie ihre Wirkung in unmittelbarer NÜhe ihrer Entstehung sowohl auto- als auch parakrin. Jedoch werden sie innerhalb von Sekunden bis Minuten durch enzymatische Reduktion von Doppelbindungen und Dehydrierung von Hydroxygruppen oder spontaner Umsetzung wieder inaktiviert. Es gibt zwei Isoformen der Cyclooxygenase, COX-1 und COX-2, die in der Maus und auch beim Menschen durch zwei unterschiedliche Gene kodiert werden, Ptgs1 und Ptgs2. Die COX-1 stellt die konstitutive Form dar und wird in den meisten Geweben der SÜuger exprimiert, speziell jedoch in Magen, Thrombozyten und glatter GefÜámuskulatur. In der Niere findet man sie im GefÜáendothel, in medullüren Sammelrohren und in medullürem Interstitium [Smith und DeWitt, 1995; Crofford, 1997]. Damit ist die COX-1 fér die Prostaglandinversorgung im zellulüren Haushalt verantwortlich und Ébernimmt insbesondere Aufgaben in der Magenzytoprotektion, der vaskulüren Homeostase und der normalen Nierenversorgung mit weitgehend konstanter EnzymaktivitÜt [DeWitt et al., 1993; Smith und DeWitt, 1995] und wird daher auch als housekeeping enzyme bezeichnet. Dem gegenéber steht die COX-2, deren wesentlicher Unterschied zur COX-1 die gröáere Promotorregion am 5à-Ende des COX-2-Gens und das gehüufte Vorkommen der AU-InstabilitÜtssequenzen im nichtkodierenden 3à-Ende der mrna ist. Die Promoterregion enthült wichtige Kontrollelemente, an die Transkriptionsfaktoren binden und damit die Transkription steuern können. Dabei kann die Induktion von zahlreichen intra- und extrazellulüren Stimuli ausgehen: Cytokine (Interleukin-1â und -2, Tumornekrosefaktor-Ñ, Interferon-Å), Wachstumsfaktoren (Transforming growth factor-ñ und -â, Platelet derived growth factor, Epidermal growth factor), Gewebshormone (PlÜttchenaktivierender Faktor, Endothelin),

18 Einleitung 11 Hormone (Progesteron, FSH, LH, HCG), Tumorpromotoren (Phorbolester, Forskolin), Viren und Bakterienbestandteile (Lipopolysaccharide). Im Zuge der Induktion des COX-2-Proteins nimmt auch die Prostanoidproduktion zu [Williams und Du- Bois, 1996]. Aufgrund dieser vielfältigen Induzierbarkeit spricht man bei der COX-2 auch von der induzierbaren COX-Form. Phospholipide Phospholipase A Arachidonsäure Cyclooxygenase Lipoxygenase PGG 2 Leukotriene PGH 2 Prostaglandine (PGE 2, PGF 2a, PGD 2 ) Prostacyclin (PGI 2 ) Thromboxan A 2 (TXA 2 ) Abb. 7; Der Cyclooxygenaseweg Gehemmt wird die Induktion durch Glukokortikoide und Interleukin-10 [Mertz et al., 1994; Kujubu und Herschmann, 1992]. NSAID dagegen senken die Prostanoidproduktion durch Hemmung der Cyclooxygenaseaktivität. Das Bekannteste unter den NSAID, ASS, acetyliert eine Seringruppe an der Substratbindungsstelle und blockiert irreversibel die Substratverarbeitung [Meade et al., 1993].

19 Einleitung 12 Die COX-2 ist in den meisten Geweben nicht nachweisbar bzw. wird nicht konstant exprimiert [Smith und DeWitt, 1995; Kömhoff et al., 2000]. Sie kann aber, wie bereits erwähnt, durch diverse Stimuli induziert werden, sodass sie beim Erwachsenen besonders während des Zellwachstums und in der Entzündungsphase in Erscheinung tritt [O Banion et al., 1991; Masferrer et al., 1992; Mitchel et al., 1993]. Eine Ausnahme stellt dabei die Niere dar. In dieser wird sowohl im Fetus als auch im Erwachsenen bei allen Spezies COX-2 exprimiert [Harris et al., 1994; Kömhoff et al., 1997; Zhang et al., 1997; Khan et al., 1998]. Eine COX-2-mRNA Expression in der sich entwickelnden Mäuseniere konnte in den ersten epithelialen Strukturen des metanephritischen Mesenchyms, den renalen Bläschen, entdeckt werden [Dressler, 1995]. Darüber hinaus konnte die COX-2-mRNA Expression in den comma- und S-shaped bodies, besonders bzw. vorherrschend in den sich entwickelnden Tubulusepithelien nahe der Glomeruli gezeigt werden. Eine deutliche Expression an der juxtamedullären Macula densa ist ab dem Tag E14,5 zu beobachten. In der reifen Niere bleibt sie auf Zellen dieser Region beschränkt. Postnatal ist im Immunoblot ein Anstieg der COX-2-Protein Expression vom Tag P0 bis P4, wo es einen Peak erreicht, zu verzeichnen, der aber anschließend schnell wieder sinkt [Kömhoff et al., 2000]. Im Rattenmodell konnte ebenfalls eine entwicklungsabhängige COX-2 Expression gezeigt werden [Zhang et al., 1997]. So ist dessen Ausmaß am Tag P0 vergleichbar mit der einer erwachsenen Ratte. Dies ändert sich jedoch ab Tag P1, ab dem das Signal erst stärker und dann von Tag P3 bis P7 beträchtlich ansteigt. Von Tag P7 bis P14 hält es das Level, um danach wieder abzufallen (Nothern Analysis). Im Immunoblot ist bis zum Peak an P14 ebenfalls ein Anstieg zu beobachten. Eine erste diffuse cytoplasmatische COX-2-Expression zeigt sich ab Tag E16 in sich verzweigenden Sammelrohren und S-shaped bodies. Im weiteren Verlauf kann man im dicken aufsteigenden Schenkel der Henle-Schleife eine diffuse und in Zellen nahe der Macula densa eine starke COX-2-Expression feststellen. Die Macula bleibt jedoch COX-2 negativ. Dabei wandert die COX-2-Expression von juxtamedullär nach außen in den Kortex, wobei aber die COX-2-Zellzahl konstant bleibt. Dies deutet auf eine entwicklungsabhängige Hoch- und Runterregulation hin. In entwickelten Abschnitten wird die COX-2-Expression runterreguliert und umgekehrt in noch zu entwickelnden

20 Einleitung 13 hochreguliert. Interessant ist auch die fünffach höhere PGE 2 -Bindung in den ersten fünf Lebenstagen, verglichen mit den Nieren erwachsener Tiere [Zhang et al., 1997]. In der humanen fetalen Niere sieht das Bild sehr ähnlich aus. Auch hier zeigt sich eine starke COX-2-Expression im Bereich der Macula densa und den assoziierten dicken aufsteigenden Schenkeln der Henle-Schleife, am stärksten in den Nephronen des äußeren Kortex. Es findet sich auch hier eine progressive Abnahme der COX-2- Expression von den äußeren unentwickelten zu den inneren weiterentwickelten Nephronen. Einen Zusammenhang zwischen der Intensität der COX-2-Expression und dem Gestationsalter gibt es allerdings nicht bzw. konnte nicht gezeigt werden [Khan et al., 2001]. I.4. Das COX-2 -/- -Mausmodell Durch den selektiven Knockout des Cyclooxygenase-2-Gens in der Maus fallen zunächst einmal Phänomene auf, die die Vitalität dieser Tiere betreffen. Zu diesen Phänomenen findet man in der Literatur allerdings unterschiedliche Beobachtungen. So wurde zwar von einer erwarteten Anzahl an COX-2 -/- -Nachkommen berichtet, aber nur 60% überlebten bis zur Entwöhnung. Von diesen wiederum überlebten lediglich 75% das erste Lebensjahr [Langenbach et al., 1999]. Demgegenüber steht die Beobachtung, dass die Zucht nur ungefähr 35% der erwarteten Nachkommen brachte. Hierfür wird die neonatale Mortalität als essentiell angesehen [Dinchuk et al., 1995]. Die durchschnittliche Lebenserwartung einer COX-2 -/- -Maus beträgt 3,5 Monate [Dinchuk et al., 1995; Norwood et al., 2000], wobei nur wenige älter als 6 Monate werden [Dinchuk et al., 1995]. Ungefähr 20% der COX-2 -/- -Nachkommen versterben zwischen der 7. und 23. Woche [Norwood et al., 2000]. Dabei ist eine erhöhte Sterberate um die 8. Woche zu verzeichnen [Morham et al., 1995; Norwood et al., 2000]. Bei Versuchen mit COX-2 -/- -Weibchen stellte sich deren Infertilität heraus. Die Fertilität der Männchen bleibt davon unbeeinflusst [Dinchuk et al., 1995; Lim et al., 1997; Davis et al., 1999], sodass, um entsprechende Nachkommen zu erzeugen, heterozygote Weibchen mit homozygoten Männchen verpaart werden. Versuche zur Entzündungsreaktion zeigten keinen Unterschied in der Reaktion auf TPA (12-O-tetradecanoylphorbol-13-acetat) oder AA (Arachidonsäure) zwischen

21 Einleitung 14 COX-2 -/- und Wildtyp (WT) [Morham et al., 1995]. Des Weiteren belegten diese Versuche COX-2 als Hauptproduzent von Prostaglandinen in der frühen Entzündungsphase [Langenbach et al., 1999]. In der COX-2 -/- -Maus sind neben Veränderungen im Herz, wie diffuse myocardiale Fibrosen, und in den Ovarien, insbesondere Gewebeabnormalitäten in der Niere zu sehen. Dabei fällt die adulte COX-2 -/- -Maus durch chronisches Nierenversagen auf, zu erkennen am gestiegenen Serum-Kreatinin Spiegel und der Urämie, was auf eine reduzierte glomeruläre Filtrationsrate (GFR) schließen lässt. Natrium- und Wasserhaushalt bleiben dabei unberührt [Dinchuk et al., 1995; Norwood et al., 2000]. Sowohl bei makroskopischer als auch bei mikroskopischer Betrachtungsweise sind ab der 6. Woche zahlreiche signifikante und beständige genotypabhängige Veränderungen der Niere gegenüber dem WT zu beobachten. So fällt bei Betrachtung der zu klein geratenen Nieren mit dem bloßen Auge die blasse und granuläre Erscheinung der Kapseloberfläche auf. Unter dem Mikroskop bietet sich dem Betrachter das Bild eines multifokal subkapsulär abnormalen Parenchyms mit glomerulärer Hypoplasie des äußeren Kortex. Dabei finden sich sowohl Tubulusatrophien als auch diffuse tubulärer Dilatationen. Im inneren Kortex erscheint das einzelne Nephron hypertrophiert. Zusätzlich ist in dem teilweise dünnen Kortex häufig auch die Anzahl der Glomeruli reduziert. Periglomerulär stellen sich vielfach sklerotische Veränderungen dar [Morham et al., 1995; Norwood et al., 2000]. Es wird vermutet, dass durch die Reduktion der Glomerulizahl, die angelegten Glomeruli ihre Arbeitsleistung erhöhen und dass dadurch die beschriebene Hypertrophie und Sklerose erklärt werden kann [Brenner, 1985]. Bei Betrachtung des Interstitiums sind dort diffuse fibrotische und zystische Veränderungen zu erkennen [Morham et al., 1995; Norwood et al., 2000]. Doch all diese Veränderungen sind nicht etwa schon in utero oder direkt nach der Geburt zu beobachten. Es hat sich vielmehr gezeigt, dass die Nieren am Tag E14 völlig normal aussehen und am Tag P3 nicht vom Wildtyp (WT) zu unterscheiden sind. Selbst am Tag P7 gelingt dies nicht [Langenbach et al., 1999; Morham et al., 1995; Norwood et al., 2000]. Erst am Tag P10 sind in einigen Nieren zystische Veränderungen und zusammengedrängte, kleine, subkapsulär gelegene Glomeruli zu beobachten, jedoch nicht bei allen Nieren. Gleichzeitig lässt sich dieses gehemmte Nierenwachstum auch am Nierengewicht ablesen. Ab P10 ist nämlich auch das Verhält-

22 Einleitung 15 nis von Nierengewicht zu Körpergewicht im Vergleich zum WT nachhaltig gesenkt. Beim Körpergewicht gibt es allerdings keine Differenzen. Ab P14 lassen sich alle COX-2 -/- -Nieren vom WT abgrenzen. Im einzelnen bedeutet dies, dass nun in allen COX-2 -/- -Nieren progressive Dysplasien des äußeren Kortex mit zystischen subkapsulären Glomeruli unter dem Mikroskop zu sehen sind. Weiterhin zeigen sich jetzt Tubulusatrophien und zystische Formationen des Interstitiums. Hypertrophien juxtamedulärer Glomeruli wurden erst ab P28, also nach 4 Wochen, gesehen [Norwood et al., 2000]. COX-2 +/- -Mäuse unterscheiden sich nicht vom WT [Morham et al., 1995]. Bei pharmakologischen Untersuchungen mit dem selektiven COX-2-Inhibitor SC-236 haben sich keine quantitativen Unterschiede in der Glomerulumgröße zum COX-2 -/- ergeben. So zeigte sich nach Gabe des SC-236 ab Tag E0,5 sowohl ein deutlich reduziertes kortikales Volumen an Tag P21 als auch ein deutlich reduzierter glomerulärer Durchmesser von 29,35 ± 0,42 µm im Vergleich zu 47,01 ± 0,41µm beim Kontrolltier. An P0 gab es jedoch keinen Unterschied. Der glomeruläre Durchmesser eines COX-2 -/- -Tieres beträgt hier 29,35 ± 0,68 µm. In der gleichen Versuchsreihe wurden dichter stehende glomeruläre Zellen und cuboidal geformte Podozyten beobachtet. Bei Gabe des SC-236 erst ab P0 bis P21 fällt der Effekt nicht ganz so deutlich aus. So betrug der gemessene Durchmesser nunmehr 37,31 ± 0,68 µm im Vergleich zu 47,01 ± 0,41 µm beim Kontrolltier. Jedoch gab es auch in diesem Modell keine Veränderung vor P8. Auf das erwachsene Tier hatte SC-236 keinen wesentlichen Effekt. Indiz dafür, dass der COX-2 Hemmer auch diaplazentar ü- bertragen wird, ist zum Einen die deutliche Hochregulation des COX-2 Proteins am Tag P0, die durch SC-236 hervorgerufen wird, und sind zum Anderen die deutlich besseren Ergebnisse im Zeitraum von E0,5 bis P21, als von P0 bis P21 [Kömhoff et al., 2000] All die bis hierher beschriebenen Phänomene ergeben das Bild einer COX-2 korrelierten Nephrogenese.

23 Einleitung 16 I.5. Prostaglandin-Rezeptoren Prostaglandin-Rezeptoren sind eine Gruppe von Plasmamembranrezeptoren, deren Wirkungen über G-Proteine vermittelt werden. Jedem Metaboliten des Arachidonsäurestoffwechsels, der über die Cyclooxygenase synthetisiert wird, ist dabei ein spezifischer Rezeptor zuzuordnen. Für den Prostaglandin E 2 -Rezeptor unterscheidet man zudem vier Subtypen, EP-1 - EP-4, deren Expression von Morath et al. [1999] an verschiedenen Stellen der Niere nachgewiesen werden konnte: EP-1: - in Verbindungsstücken - in kortikalen und medullären Sammelrohren - in der Media der Arterien, Vasa recta und peritubulärer Kapillare - in Zellen der Vas afferens und efferens - in den Glomeruli EP-2: - in der Media der Arterien und glomerulärer Arteriolen - im kortikalen und medullären Interstitium EP-3: - im spät distalen Tubuluskonvolut - in Verbindungsstücken - in kortikalen und medullären Sammelrohren - im distalen Tubulus - in der Media und im Endothel der Arterien, Vasa recta und peritubulärer Kapillare - in juxtaglomerulären afferenten Arteriolen - in den Glomeruli EP-4: - in der Media der Arterien und Vasa recta - in den Glomeruli Neben den endogenen Liganden, der Prostaglandine, sind auch einige exogene Liganden bekannt. Während Sulproston als PGE 2 -Derivat eher unspezifisch an die einzelnen EP-Rezeptoren bindet, weisen die Substanzen aus der ONO-Gruppe eine höhere Spezifität auf. So ist ONO-8713 für den EP-1-Rezeptor, ONO-AE1-259 für den EP-2-Rezeptor, ONO-AE-248 für den EP-3-Rezeptor und ONO-AE-329 für den EP- 4-Rezeptor ein spezifischer Ligand [Narumiya et al., 2001]. Durch die Bindung der einzelnen Liganden an ihre Rezeptoren, werden verschiedene intrazelluläre Trans-

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila 01.-04.03.04 Joachim Marhold, Regine Garcia Boy, Natascha Kunert, Cora Mund, Frank Lyko Programm 01.03.04: Präparation genomischer


Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran


F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in


Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf


GEBRAUCHSANLEITUNG. Glutatione Agarose Resin

GEBRAUCHSANLEITUNG. Glutatione Agarose Resin GEBRAUCHSANLEITUNG Glutatione Agarose Resin Agarose zur Affinitätsreinigung von GST-Tag-Fusionsproteinen und anderen Glutathion-Bindungsproteinen (Kat.-Nr. 42172) SERVA Electrophoresis GmbH - Carl-Benz-Str.


Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1


Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Von: Andreas Tschammer, Fachhochschule Aalen-Hochschule f. Technik und Wirtschaft, Fachbereich Chemie, Schwerpunkt Molekulare Biotechnologie Material


SingleQuant Assay Kit

SingleQuant Assay Kit GEBRAUCHSANLEITUNG SingleQuant Assay Kit Kit für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39226) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010


Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert


Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar

Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Rejektion Hartono et al., 2009 Seite 2 Untersuchungsmaterial Nierengewebe


Was ist Wirkstoffdesign?

Was ist Wirkstoffdesign? Was ist Wirkstoffdesign? Eine Einführung für Nicht-Fachleute Arzneimittel hat vermutlich schon jeder von uns eingenommen. Vielleicht hat sich der eine oder andere dabei gefragt, was passiert eigentlich


Strahleninduzierte Apoptose bei ESRT im Mausmodell

Strahleninduzierte Apoptose bei ESRT im Mausmodell Strahleninduzierte Apoptose bei ESRT im Mausmodell Die Apoptose ist von vielen ineinandergreifenden Mechanismen abhängig, in deren Regulationsmittelpunkt die Caspasen als ausführende Cysteinproteasen stehen.


Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet


Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,


Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen


Nachweis von DNA im Wein

Nachweis von DNA im Wein Abschlussbericht über den Forschungsauftrag Nachweis von DNA im Wein Projektlaufzeit: 01.01.2001 bis 31.03.2003 Prof. Dr. Ralf Kaldenhoff Universität Würzburg Julius-von-Sachs-Institut für Biowissenschaften


DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2


Immunofluoreszenz-Markierung an kultivierten adhärenten Säugerzellen. Formaldehyd-Fixierung

Immunofluoreszenz-Markierung an kultivierten adhärenten Säugerzellen. Formaldehyd-Fixierung Immunofluoreszenz-Markierung an kultivierten adhärenten Säugerzellen Formaldehyd-Fixierung 2 Materialien Pinzetten Für das Handling der Zellen ist es empfehlenswert Pinzetten mit sehr feiner Spitze zu


Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen


Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen


aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT

aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1 aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1. Hinweise zu Membranen a. Nitrocellulose b. PVDF (alternativ) 2. Aufbau des Transfers a. Naßblot b. Semi-dry (alternativ) 3. Färben und Dokumentation


SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!!

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! aktualisiert, 08.03.2011, Wera Roth1 SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Anleitung für Minigele Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! Glasscheiben ordentlich


Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!


Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign


Bestimmung des Paracetamolgehalts in Vivimed von Natalie Rotermel und Katharina Juhasz-Dora

Bestimmung des Paracetamolgehalts in Vivimed von Natalie Rotermel und Katharina Juhasz-Dora Bestimmung des Paracetamolgehalts in Vivimed von Natalie Rotermel und Katharina Juhasz-Dora Inhalt 1. Allgemeine Information zu den Chemikalien und den Bestandteilen einer Vivimed Tablette (Name, Wirkungsweise,


Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis


Bradford Reagent, 5x

Bradford Reagent, 5x GEBRAUCHSANLEITUNG Bradford Reagent, 5x Reagenz für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39222) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 HeidelbergPhone +49-6221-138400, Fax +49-6221-1384010


Inaugural-Dissertation zur Erlangung der medizinischen Doktorwürde des Fachbereichs Humanmedizin der Freien Universität Berlin

Inaugural-Dissertation zur Erlangung der medizinischen Doktorwürde des Fachbereichs Humanmedizin der Freien Universität Berlin Aus dem Institut für Physiologie des Fachbereiches Humanmedizin der Freien Universität Berlin (Zentrum für Weltraummedizin Berlin) Direktor : Prof. Dr. med. Axel R. Pries Der Einfluß einer körperlichen


Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden Stammzellenmanipulation Hämatopoietische Stammzellen können gebraucht werden um kranke Zellen mit gesunden zu ersetzen (siehe experiment bestrahlte Maus) Epidermale Stammzellpopulationen können in Kultur


Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher


Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion


Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei


Produktinformation Saturn-2D REDOX Labeling Kit

Produktinformation Saturn-2D REDOX Labeling Kit Saturn-2D REDOX Labeling Kit Produktinformation Saturn-2D REDOX Labeling Kit Produkt-Nr. PR34, PR35 NH DyeAGNOSTICS GmbH Weinbergweg 23 D-06120 Halle Deutschland Technischer Support Fon: +49 (0) 345-2799


AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...


Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten


Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Im diesem Praktikumsteil sollen homöotische Mutanten von Arabidopsis untersucht werden. Abb 1, Aufbau einer Blüte einer


Haften ohne Klebstoff der Geckofuß

Haften ohne Klebstoff der Geckofuß Bodensee-Naturmuseum Konstanz Botanischer Garten Universität Konstanz Haften ohne Klebstoff der Geckofuß Der Gecko (z.b. der Taggecko, Phelsuma) zählt zu den interessantesten und gleichzeitig spektakulärsten


Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis


Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung In Zusammenarbeit mit Katharina Mumm, Alexander Prange Gewinnung des Hefe - Bakterienisolates


Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt



Abbildungsverzeichnis I INHALTSVERZEICHNIS Abkürzungen VI Abbildungsverzeichnis VIII I. Einleitung 1. Neurone und Axonwachstum 1 2. Oligodendrozyten und Myelin 3 3. Das Proteolipid Protein (PLP) 6 4. Mutationen im PLP-Gen und


SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit

SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit GEBRAUCHSANLEITUNG SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit (Kat.-Nr. 42586) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010


Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt. Rekombinante Wirkstoffe Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.de Empfohlene Literatur Rekombinante Wirkstoffe Der legale


1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli


Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u


GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR)

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) GVO-Screening Kit Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) I. Einführung Die Gentechnik stellt die Landwirtschaft vor neue Herausforderungen. Einerseits eröffnet


APP-GFP/Fluoreszenzmikroskop. Aufnahmen neuronaler Zellen, mit freund. Genehmigung von Prof. Stefan Kins, TU Kaiserslautern

APP-GFP/Fluoreszenzmikroskop. Aufnahmen neuronaler Zellen, mit freund. Genehmigung von Prof. Stefan Kins, TU Kaiserslautern Über die Herkunft von Aβ42 und Amyloid-Plaques Heute ist sicher belegt, dass sich die amyloiden Plaques aus einer Vielzahl an Abbaufragmenten des Amyloid-Vorläufer-Proteins (amyloid-precursor-protein,


Schlussbericht zur Studienwoche Biologie und Medizin vom 17. 23. März 2013

Schlussbericht zur Studienwoche Biologie und Medizin vom 17. 23. März 2013 Schlussbericht zur Studienwoche Biologie und Medizin vom 17. 23. März 2013 Projekt: Zellbiologie: Expression und Reinigung der onkogenen Kinase Abl an der Ecole Polytechnique Fédérale de Lausanne, EPFL


Experiment Isolierung, Aktivität und Hemmung der Carboanhydrase

Experiment Isolierung, Aktivität und Hemmung der Carboanhydrase Experiment Isolierung, Aktivität und emmung der Carboanhydrase 1 Aufgabe: Partnerarbeit Bilden ie selbständig Zweiergruppen. tudieren ie zuerst die Einleitung. Legen ie das Material bereit. Bereiten ie


Meisterwurz. Imperatoriae Radix. Radix Imperatoriae

Meisterwurz. Imperatoriae Radix. Radix Imperatoriae ÖAB xxxx/xxx Meisterwurz Imperatoriae Radix Radix Imperatoriae Definition Das ganze oder geschnittene, getrocknete Rhizom und die Wurzel von Peucedanum ostruthium (L.) KCH. Gehalt: mindestens 0,40 Prozent


Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe

Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe Features: - Extraktion von RNA, DNA und Proteinen aus der gleichen Probe - Für kleine und große Mengen von Probe - Gleichzeitiges


Satellitensymposium: AT1-Rezeptorblocker Gegenwart und Zukunft - 74. Jahrestagung der Deutschen

Satellitensymposium: AT1-Rezeptorblocker Gegenwart und Zukunft - 74. Jahrestagung der Deutschen Satellitensymposium: AT1-Rezeptorblocker Gegenwart und Zukunft - 74. Jahrestagung der Deutschen Gesellschaft für Kardiologie am 27. März 2008 in Mannheim MORE Mehr Gefäßschutz durch Olmesartan Mannheim


Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl

Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl Arbeitsgruppe D 6 Clara Dees Susanne Duncker Anja Hartmann Kristin Hofmann Kurs 3: Proteinanalysen Im heutigen Kurs extrahierten wir zum einen Proteine aus verschiedenen Geweben eines Kaninchens und führten


Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -


Epigenetik. Bernd Eiben Institut für Labormedizin und Klinische Genetik Rhein Ruhr amedes-group Willy Brandt Platz 4 45127 Essen. Mittwoch, 29.

Epigenetik. Bernd Eiben Institut für Labormedizin und Klinische Genetik Rhein Ruhr amedes-group Willy Brandt Platz 4 45127 Essen. Mittwoch, 29. Epigenetik Bernd Eiben Institut für Labormedizin und Klinische Genetik Rhein Ruhr amedes-group Willy Brandt Platz 4 45127 Essen Umwelt oder Gene was bestimmt unser Sein? in den 60er/ 70er Jahren: Umwelt


Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt.

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. - 22-4 Ergebnisse 4.1 RT-PCR Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. 4.1.1 Struma nodosa Histologie Fas Fas CD 97


Stammzellenforschung Karina Köppl LK Biologie

Stammzellenforschung Karina Köppl LK Biologie Stammzellenforschung Karina Köppl LK Biologie 1.Was sind Stammzellen? Reparaturreserve des Körpers undifferenzierte Zellen von Menschen und Tieren Stammzellen sind in der Lage, sich zu teilen und neue


Inhalte unseres Vortrages

Inhalte unseres Vortrages Inhalte unseres Vortrages Vorstellung der beiden paper: Germ line transmission of a disrupted ß2 mirkroglobulin gene produced by homologous recombination in embryonic stem cells ß2 Mikroglobulin deficient


Zelldifferenzierung und Morphogenese

Zelldifferenzierung und Morphogenese Zelldifferenzierung und Morphogenese Fragestellung: Wie ist es möglich, daß sich aus einer einzigen Zelle ein hochkomplexes Lebewesen mit hohem Differenzierungsgrad entwickeln kann? weniger gut verstanden


Hämostase - Blutgerinnung

Hämostase - Blutgerinnung Hämostase - Blutgerinnung 1 Überblick zur Blutgerinnung Schritte Primäre Hämostase (vorläufige Blutstillung) Sekundäre Hämostase (endgültige Blutstillung, Blutgerinnung) Dauer Sekunden bis wenige Minuten


Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint RFLP als Modell für einen DNA-Fingerprint Teil 1: Restriktionsverdau 1.1: Thermoblock / Wasserbad auf 37 C vorheizen 1.2: Puffer Y+/Tango auftauen und auf Eis stellen 1.3: 4 Proben, RSA I und H 2 O demin.


Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945


HER2-Diagnostik. Ein Leitfaden für Brustkrebs-Patientinnen

HER2-Diagnostik. Ein Leitfaden für Brustkrebs-Patientinnen HER2-Diagnostik Ein Leitfaden für Brustkrebs-Patientinnen Was ist HER2? HER2 vielfach auch als erbb2 oder HER2/neu bezeichnet ist ein Eiweiß bzw. Proteinbaustein an der Oberfläche von Zellen (Rezeptor).


Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen


Allgemeine Pharmakologie

Allgemeine Pharmakologie Allgemeine Pharmakologie Pharmakologie Arzneistoff: Wirkstoff, der zur Vorbeugung, Linderung, Heilung oder Erkennung von Erkrankungen dient Pharmakon: biologisch Wirksame Substanz Lehre von den Wirkungen


Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme


Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005

Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 F1 Molekulare Zoologie Teil II: Expressionsanalyse Proteinexpressionsanalyse


Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3


4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch


Probenvorbereitung für die REM- und AFM-Analyse

Probenvorbereitung für die REM- und AFM-Analyse Probenvorbereitung für die REM- und AFM-Analyse Einleitung Entscheidend für die Abbildung und Analyse biologischer Strukturen ist die Methode, mit der die Probe für die Untersuchung im Rasterelektronenmikroskop


Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1


Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch (Fotos vom 6. März 2013 Molekularbiologisches Praktikum 12 G-Kurs Biologie Herr Korne - am KOMM Homburg/Saar unter Anleitung von Frau Dr. Amoroso)


Die Bewertung von erhöhten Troponin- Werten bei terminaler Niereninsuffizienz

Die Bewertung von erhöhten Troponin- Werten bei terminaler Niereninsuffizienz Die Bewertung von erhöhten Troponin- Werten bei terminaler Niereninsuffizienz Fallvorstellung Station 84 - Nephrologie 18.11.08 Dr. med. Ferruh Artunc 1 Der Fall 61-jährige Dialysepatientin stellt sich


Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.


Anhang III. Ergänzungen der relevanten Abschnitte der Zusammenfassung der Merkmale des Arzneimittels und der Packungsbeilage

Anhang III. Ergänzungen der relevanten Abschnitte der Zusammenfassung der Merkmale des Arzneimittels und der Packungsbeilage Anhang III Ergänzungen der relevanten Abschnitte der Zusammenfassung der Merkmale des Arzneimittels und der Packungsbeilage 20 ZUSAMMENFASSUNG DER MERKMALE DES ARZNEIMITTELS [Der unten genannte Wortlaut


peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben.

peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. Best.-Nr. 30-2110 100 ml 30-2120 200 ml 30-2130 500 ml Lagerung: Lichtgeschützt bei 4 C für


AdnaTest EMT-2/StemCell Add-on ProstateDetect

AdnaTest EMT-2/StemCell Add-on ProstateDetect AdnaTest EMT-2/StemCell Add-on ProstateDetect RT-PCR-Nachweis von Prostatakrebs-assoziierter Genexpression in angereicherten Tumorzellen Nur für Forschungszwecke Gebrauchsanweisung T-1-537-PP Inhaltsverzeichnis


Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983


Wie funktioniert ein Heißluftballon? Einen Mini-Heißluftballon aufsteigen lassen

Wie funktioniert ein Heißluftballon? Einen Mini-Heißluftballon aufsteigen lassen Wie funktioniert ein Heißluftballon? Einen Mini-Heißluftballon aufsteigen lassen In aller Kürze Hast du schon mal einen Heißluftballon am Himmel beobachtet? Wie kommt es eigentlich, dass er fliegen kann?


Inhaltsverzeichnis. 1 Einleitung... 1

Inhaltsverzeichnis. 1 Einleitung... 1 Inhaltsverzeichnis 1 Einleitung... 1 1.1 G-Protein-gekoppelte Rezeptoren... 3 1.1.1 Klassifizierung und Struktur von G-Protein-gekoppelten Rezeptoren... 6 1.1.2 Purinerge Rezeptoren... 12 1.1.3 Pharmazeutische


Typische Fragen für den Gehschul-Teil: Typ 1: Mengen und Konzentrationen:

Typische Fragen für den Gehschul-Teil: Typ 1: Mengen und Konzentrationen: Die Gehschule ist ein Teil der Biochemischen Übungen für das Bakkalaureat LMBT. Aus organisatorischen Gründen wird dieser Test gleichzeitig mit der Prüfung aus Grundlagen der Biochemie angeboten. Das Abschneiden


Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin


Praktikum an der Monash University in Melbourne

Praktikum an der Monash University in Melbourne Praktikum an der Monash University in Melbourne Thema: Experimentelle Validierung eines Computermodells zur Simulation des Blutflusses in der Niere Sabine Donner, Wintersemester 2006 Hauptabschnitte meiner


9 Praxis: Proteinbestimmung und proteolytischer Verdau von Bacteriorhodopsin

9 Praxis: Proteinbestimmung und proteolytischer Verdau von Bacteriorhodopsin 9 Praxis: Prteinbestimmung und prtelytischer Verdau vn Bacterirhdpsin 9.1 Quantitative Prteinbestimmung Meistens erflgen die Prteinbestimmungen in Küvetten. Generell gilt hierbei, dass die Küvette im Referenzstrahlengang


Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC

Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC Wolferner Analytik GmbH Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC 1 Veröffentlichung 15.12.2004, Studie Zusammenfassung: Im Auftrag der ASTRA GmbH, einer Vorgesellschaft der


Anleitung zur Handhabung von Durchstechflasche und Einmalspritze (für Patienten, Ärzte, Diabetesberater und Apotheker)

Anleitung zur Handhabung von Durchstechflasche und Einmalspritze (für Patienten, Ärzte, Diabetesberater und Apotheker) Anleitung zur Handhabung von Durchstechflasche und Einmalspritze (für Patienten, Ärzte, Diabetesberater und Apotheker) EIN LEITFADEN ZUR ERSTEN VERWENDUNG VON APIDRA in 10ml- DURCHSTECHFLASCHEN Apidra


Einführung Aufgaben der Niere

Einführung Aufgaben der Niere Die Niere Einführung Aufgaben der Niere Die Nieren haben verschiedene Aufgaben : 1. Ausscheidung von Stoffwechselprodukten und stoffwechselfremden Substanzen 2. Regulation des Elektrolythaushaltes 3. Regulation


IV. Gastrointestinales System. 1. Bestimmung des ph-wertes des Speichels

IV. Gastrointestinales System. 1. Bestimmung des ph-wertes des Speichels IV. Gastrointestinales System 1. Bestimmung des ph-wertes des Speichels Man sammelt frischen Speichel in einem Reagenzglas, taucht Universal-Indikatorpapier in die Flüssigkeit ein, und liest den ph-wert


Psoriasin is a major Escherichia coli-cidal factor of the female genital tract

Psoriasin is a major Escherichia coli-cidal factor of the female genital tract Psoriasin is a major Escherichia coli-cidal factor of the female genital tract Mildner M, Stichenwirth M, Abtin A, Eckhart L, Sam C, Gläser R, Schröder JM, Gmeiner R, Mlitz V, Pammer J, Geusau A, Tschachler


Zusammenfassung der Merkmale des Arzneimittels. Die vollständige Auflistung der sonstigen Bestandteile siehe Abschnitt 6.1.

Zusammenfassung der Merkmale des Arzneimittels. Die vollständige Auflistung der sonstigen Bestandteile siehe Abschnitt 6.1. Zusammenfassung der Merkmale des Arzneimittels 1. Bezeichnung des Arzneimittels Virupos 30 mg/g Augensalbe 2. Qualitative und quantitative Zusammensetzung Wirkstoff: 1 g Salbe enthält Aciclovir 30 mg Die


merken!!! 29,22 g NaCl abwiegen, in einem Becher mit etwa 800 ml Wasser lösen, dann im Messzylinder auf 1000 ml auffüllen.

merken!!! 29,22 g NaCl abwiegen, in einem Becher mit etwa 800 ml Wasser lösen, dann im Messzylinder auf 1000 ml auffüllen. Das ABC der Stöchiometrie Lösungen aus Feststoffen Molare Lösungen herstellen (m = M c V) Beispiel 1: 1 L einer 500 mm NaCl-Lösung herstellen. Masse: Volumen: Stoffmenge: Dichte: m (kg) V (L) n (mol) (kg/l)


Plasmid DNA purification

Plasmid DNA purification Plasmid DNA purification Excerpt from user manual - Deutsch - NucleoBond Xtra NucleoBond Xtra NucleoBond Xtra Plus NucleoBond Xtra Plus January 2013 / Rev. 11 Plasmid DNA Purification Deutsch Einleitung


Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,


Reagenzien für die Mikroskopie

Reagenzien für die Mikroskopie Reagenzien für die Mikroskopie Chemikalien A-Z siehe ab Seite 6 Lösungen nach Anwendungsgruppen - unfixierte Präparate Physiologische Kochsalzlösung 610241000 1 l 0,9% NaCl 610242500 2,5 l 610245000 5


Versuch Oberflächenmanagement

Versuch Oberflächenmanagement Versuch Oberflächenmanagement Zielstellung: Einstellung der Benetzungs- und Bindungseigenschaften von Kanal- und Reaktoroberflächen Aufgabenstellung: 1) Bestimmung des Benetzungsverhaltens von Reaktormaterialien


Protokoll zum Versuch Keramographie

Protokoll zum Versuch Keramographie Protokoll zum Versuch Keramographie Datum: 12.05.2009 Verfasser: Dimitrij Fiz Gruppe: 12 Betreuer: Maren Lepple 1. Einleitung Ziel des Versuchs ist die Präparation und Analyse von Zirkoniumoxidkeramiken.


Übungsaufgaben Physikalische Chemie

Übungsaufgaben Physikalische Chemie Übungsaufgaben Physikalische Chemie A1. Welchen Druck übt gasförmiger Stickstoff mit einer Masse von 2,045 g bei 21 C in einem Gefäß mit einem Volumen von 2,00 l aus? A2. In Haushaltgeräten zur Erzeugung


Eicosanoide. 1. Arachidonsäure. 2. Phospholipase A 2. 3. Cyclooxygenase und ihre Produkte

Eicosanoide. 1. Arachidonsäure. 2. Phospholipase A 2. 3. Cyclooxygenase und ihre Produkte Eicosanoide 1. Arachidonsäure 2. Phospholipase A 2 3. Cyclooxygenase und ihre Produkte 3.1 Isoformen 3.2 Hemmstoffe der Cyclooxygenase 3.3 Prostaglandine und Thromboxane 4. Lipoxygenasen und ihre Produkte


Wasserdichtes ph-messgerät phscan30

Wasserdichtes ph-messgerät phscan30 Wasserdichtes ph-messgerät phscan30 Vielen Dank für den Erwerb dieses Messgeräts. Vor dem Gebrauch empfehlen wir Ihnen, die folgenden Anweisungen aufmerksam zu lesen. Das hilft Ihnen, das Messgerät korrekt


Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese

Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese Station 1 Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese 1 I. Vorinformationen An der GSI wurde eine weltweit neuartige Krebstherapie mit Ionenstrahlen entwickelt. Dazu werden in
