Untersuchungen zum Vorkommen der Fledermaustollwut in Deutschland

Transkript

1 Untersuchungen zum Vorkommen der Fledermaustollwut in Deutschland I n a u g u r a l d i s s e r t a t i o n zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Ernst-Moritz-Arndt-Universität Greifswald vorgelegt von Juliane Schatz geboren am in Halle/ Saale Greifswald,

2 Dekan: Prof. Dr. Klaus Fesser 1. Gutachter: Prof. Dr. Dr. h.c. Thomas C. Mettenleiter 2. Gutachter: Prof. Dr. Christian Drosten Tag der Promotion:

3

4 Inhaltsverzeichnis 1 Einleitung Fledertiere Biologie der Fledertiere Fledertiere in Europa und Deutschland Gefährdung und Schutz von Fledertieren Infektionserreger bei Fledertieren Lyssaviren Morphologie, Genomstruktur und Taxonomie der Lyssaviren Vorkommen, Verbreitung und Reservoire der Lyssaviren Ausscheidung und Übertragung von Lyssaviren Surveillance und Diagnostik von Lyssaviren Literaturverzeichnis Abkürzungsverzeichnis Zielsetzung Zusammenfassende Darstellung & Diskussion der Ergebnisse Publikationen Bat Rabies Surveillance in Europe Enhanced Passive Bat Rabies Surveillance in Indigenous Bat Species from Germany - A Retrospective Study Twenty Years of Active Bat Rabies Surveillance in Germany: A Detailed Analysis and Future Perspectives Lyssavirus Distribution in Naturally Infected Bats from Germany Eigenanteil der Publikationen

5 7 Anhang Zusammenfassung der Dissertation Untersuchungen zum Vorkommen der Fledermaustollwut in Deutschland Summary of the dissertation Investigation of the occurrence of bat rabies in Germany Publikationsverzeichnis Tagungsbeiträge

6 1 1 Einleitung 1.1 Fledertiere Biologie der Fledertiere Die Fledertiere (Chiroptera) gehören mit etwa 1230 verschiedenen Arten zu der zweitartenreichsten Ordnung der Säugetiere (Mammalia) (Kunz et al., 2011). Die ältesten fossilen Funde stammen aus dem frühen Eozän (~50 Millionen Jahre), wobei sich die Fledertiere vermutlich bereits Ende der Kreidezeit entwickelt haben und somit zu den ältesten Säugetieren gehören (Teeling et al., 2005; Dietz et al., 2007). Die unter den Säugetieren einzigartige Fähigkeit des aktiven Fluges und die damit verbundene Besiedelung unterschiedlichster ökologischer Nischen ist Grundlage für den entwicklungsgeschichtlichen Erfolg der Fledertiere (Kunz & Racey, 1998). Der aktive Flug wird durch die Ausbildung von Flughäuten gewährleistet, die sich zwischen Körper, Extremitäten und Schwanz aufspannen (Dietz et al., 2007; Vaughan et al., 2011). Die Fledertiere wurden bisher in die zwei Großgruppen Microchiroptera (Fledermäuse) und Megachiroptera (Flughunde) unterteilt (Kulzer et al., 2005). Jüngeren Studien zufolge, welche unter anderem die genetischen Diversität und Fähigkeit zur Echoorientierung untersuchen, lassen eine Einteilung der 19 verschiedenen Fledertierfamilien in die Unterordnungen Vespertilioniformes (Yangochiroptera) und Pteropodiformes (Yinpterochiroptera) zu (Springer et al., 2001; Simmons, 2005; Hutcheon & Kirsch, 2006; Agnarsson et al., 2011). Die vor allem in den tropischen und subtropischen Regionen Afrikas aber auch im südlichen Asien, Australien und westlichen Ozeanien verbreiteten Flughunde (Pteropodidae) ernähren sich von Blättern, Blüten, Pollen, Nektar und Früchten. Durch das Verschleppen von Samen und die Übertragungen von Pollen (Haftung von Pollen im Fell) übernehmen Flughunde in Hinblick auf die Samenverbreitung und Bestäubung zahlreicher tropischer Pflanzen eine ökologisch bedeutsame Funktion (Kulzer et al., 2005). Die vormals als Microchiroptera (Fledermäuse) bezeichneten übrigen 18 Familien sind, mit Ausnahme der Polargebiete und kleiner, isolierter ozeanischer Inseln, weltweit verbreitet. Bei diesen Arten lässt sich ein globaler Diversitätsgradient beobachten, wobei die Artenvielfalt in den Tropen am höchsten ist (Dietz et al., 2007). Fledertiere sind mit Ausnahme von

7 Einleitung 2 einigen Spitzmausarten (Soricidae) die einzigen Landsäugetiere, welche die Fähigkeit zur Echoorientierung besitzen (Vaughan et al., 2011). Über den Kehlkopf erzeugte Ultraschalllaute werden über das Maul oder die Nase (Hufeisennasen: Rhinolophidae) ausgestoßen und ermöglichen den dämmerungs- und nachtaktiven Tieren die räumliche Orientierung und das Detektieren, Erkennen, Lokalisieren und Erbeuten von Nahrung in absoluter Dunkelheit (Dietz et al., 2007). Somit können diese Arten eine ökologische Nische besetzten, die tagsüber von bestimmten insektenfressenden Vogelarten besetzt wird (Vaughan et al., 2011). Ein Großteil der Fledermäuse ernährt sich ausschließlich von Insekten und anderen kleinen Gliederfüßern (Arthropoden). Sie sind damit ein wichtiger Bestandteil der natürlichen Schädlingsbekämpfung in Forst- und Landwirtschaft (Dietz et al., 2007; Boyles et al., 2011; Kunz et al., 2011). Nur wenige Arten ernähren sich von kleinen Säugetieren, Reptilien, Amphibien, Vögeln oder Fischen. Die in Mittel- und Südamerika beheimateten drei Arten der Vampirfledermaus (Desmodontinae) sind die einzigen Säugetiere, deren Ernährung auf Blut von Vögeln oder Großsäugern basiert (Mildenstein & Jong, 2011). Die dort ebenfalls beheimateten Blumenfledermäuse haben sich auf Nektar spezialisiert, welcher im Schwirrflug den Blüten der sogenannten Fledermausblumen entnommen wird (Kulzer et al., 2005). In Abhängigkeit von der jahreszeitlich bedingten Nahrungsverfügbarkeit und geographischen Verbreitung führen Fledertiere saisonale Migrationen durch, die Entfernungen von 1000 km überschreiten können. Die Migration der Flughunde wird durch die Fruchtzeiten der Nahrungsbäume (Reife der Früchte) gesteuert, wobei die Populationsdichte und Konkurrenz um verfügbare Nahrung ebenfalls auslösende Faktoren darstellen. Einige insektivore Fledermausarten der gemäßigten Breiten ziehen saisonal über weite Strecken, um die kalte und nahrungsarme Jahreszeit zu überdauern (Lindhe Norberg et al., 2002; Fleming & Eby, 2003). Durch die Methode der Beringung konnten in Europa Wanderungen von bis zu 1600 km bei Nyctalus noctula (Großer Abendsegler), 1787 km bei Vespertilio murinus (Zweifarbfledermaus) und 1905 km bei Pipistrellus nathusii (Rauhautfledermaus) dokumentiert werden (Hutterer et al., 2005). Im Gegensatz zu diesen Langstreckenwanderern ziehen die meisten Arten in möglichst frostfreie

8 Einleitung 3 Quartiere, um dort den Winterschlaf zu halten. Als Winterquartiere werden natürliche Fels- oder Baumhöhlen sowie Stollen, Tunnel und Keller genutzt, welche mehrere hundert Kilometer von den Sommerquartieren (Baumhöhlen, Bretterverschalungen oder Dachböden verschiedener Gebäude, Fledermauskästen) entfernt liegen können (Dietz et al., 2007). Der eigentliche Winterschlaf (Form des Torpors) ist ein lethargischer Zustand, welcher durch das aktive Senken der Stoffwechselrate und Körpertemperatur zum Zwecke der Energieersparnis erfolgt und durch den periodischen Wechsel des Tag-Nacht- Verhältnisses und durch das Absinken der Umgebungstemperatur ausgelöst wird (Gattermann et al., 2006; Dietz et al., 2007). Überwinternde Fledermäuse können bis zu 75 Tage in diesem torpiden Zustand verbleiben, wobei die meisten Tiere in Abständen von 2 bis 15 Tagen periodisch erwachen (Speakman & Thomas, 2003). Das Erwachen der Tiere ist ein energetisch kostspieliger Prozess, für den das in den Herbstmonaten aufgebaute und zwischen den Schulterblättern akkumulierte braune Fettgewebe genutzt wird. Der Zeitraum des Winterschlafes hängt von den lokalen Witterungsbedingungen ab und erstreckt sich in der Regel von Oktober bis März (Kulzer et al., 2005). Während in den Winterquartieren beide Geschlechter vorzufinden sind, bilden die Weibchen von Mai bis August Kolonien (Wochenstuben), in denen sie die Jungtiere gebären und aufziehen. Obwohl die Paarung der Fledermäuse vorrangig in den Herbstmonaten stattfindet, erfolgt die Ovulation und Befruchtung mit den über den Winter gespeicherten Spermien erst im Frühjahr. Diese fortpflanzungsbezogene Anpassung an die Winterbedingungen ermöglicht die Geburt und Jungenaufzucht in der Jahreszeit, in der ausreichend Nahrung zur Verfügung steht (Kulzer et al., 2005; Dietz et al., 2007). Höhlenquartiere werden von einigen Fledertieren ganzjährig genutzt und bieten Kolonien von bis zu mehreren Millionen Individuen Schutz. Die weltweit größte Dichte an Säugetier-Individuen auf begrenztem Raum erreichen die Kolonien der Mexikanischen Bulldoggfledermaus (Tadarida brasiliensis), bei der in einer einzigen Höhle bis zu 20 Millionen Individuen leben. Innerhalb der Höhlenquartiere existieren auch Vergesellschaftungen verschiedener Arten mit teilweise artübergreifender Clusterbildung (Calisher et al., 2006; Dietz et al., 2007). In solchen individuenreichen Höhlen bildet sich aus den Exkrementen und Nahrungsresten (Flügeldecken von Insekten) stickstoffreicher Fledermausguano (Chiropterit), welcher in einigen Ländern (Italien, Spanien, USA) wirtschaftlich

9 Einleitung 4 abgebaut und zur Herstellung von Seifen, Brennstoff, Antibiotika oder als Düngemittel in der Landwirtschaft genutzt wird (Calisher et al., 2006; Mildenstein & Jong, 2011) Fledertiere in Europa und Deutschland In Europa kommen 51 Fledermausarten aus den Familien Molossidae (Bulldogfledermäuse), Vespertilionidae (Glattnasen), Rhinolophidae (Hufeisennasen) und Emballonuridae (Sackflügelfledermäuse) sowie der Nilflughund (Rousettus aegyptiacus) aus der Familie Pteropodidae vor (Niethammer & Krapp, 2011; EUROBATS, 2013). Aus den Familien Vespertilionidae und Rhinolophidae leben 23 insektivore Fledermausarten in Deutschland (Tabelle 1) (BfN, 2011; NABU, 2014). Andere europäische Arten wie zum Beispiel der Riesenabendsegler (Nyctalus lasiopterus), die Langflügelfledermaus (Miniopterus schreibersii) oder das kleine Mausohr (Myotis blythii) können ebenfalls nachgewiesen werden, wobei es sich in der Regel um Einzelindividuen handelt (Dietz et al., 2007). Für die Große Hufeisennase (R. ferrumequinum), die Wimper- (M. emarginatus) und die Weißrandfledermaus (P. kuhlii) stellt Deutschland den Randbereich ihres europäischen Verbreitungsgebietes dar und entsprechend sind nur wenige Kolonien bekannt. Andere Arten dagegen, wie beispielweise die Teich- (M. dasycneme) oder Mopsfledermaus (B. barbastellus), kommen bis auf größere Bereiche in Süd- oder Norddeutschland flächendeckend vor. Ein bundesweites Vorkommen ist für den Großen Abendsegler (N. noctula), die Wasser- (M. daubentonii), Zwerg- (P. pipistrellus) und Breitflügelfledermaus (E. serotinus) beschrieben, wobei regionale Unterschiede in der Abundanz zu verzeichnen sind (BfN, 2011). So wird zum Beispiel die Breitflügelfledermaus in der norddeutschen Tiefebene deutlich häufiger erfasst als in anderen Teilen Deutschlands (Dietz et al., 2007). Zudem ist diese Fledermaus eine stark synanthrope Art, die eine große Abhängigkeit von Gebäuden zeigt und daher zahlreich in Großstädten vorzufinden ist (Niethammer & Krapp, 2011). Die Zwergfledermaus ist ebenfalls eine gebäudebewohnende Art, welche in Deutschland am häufigsten nachgewiesen wird. Durch die Auflösung der Wochenstuben, die einsetzende Paarungszeit und auf der Suche nach Winterquartieren, kommt es im Spätsommer häufig zu invasionsartigen Einflügen von Zwergfledermäusen in menschliche Behausungen (Dietz et al., 2007; Niethammer & Krapp, 2011). Im Gegensatz dazu sind Bechstein- (M.

10 Einleitung 5 bechsteinii), Fransen- (M. nattereri) und Wasserfledermaus waldbewohnende Arten, welche im Sommer vorrangig Baumhöhlen beziehen und daher selten in Kontakt zum Menschen geraten (Niethammer & Krapp, 2011). Die einheimischen Arten unterscheiden sich auch in ihrem Migrationsverhalten. Der Kleine und Große Abendsegler (N. leisleri, N. noctula), die Rauhaut- (P. nathusii) und Zweifarbfledermaus (V. murinus) migrieren saisonal über große Distanzen von bis zu 1000 km, die Wasser-, Teich- und Zwergfledermaus hingegen migrieren fakultativ über Distanzen von nur wenigen hundert Kilometern. Die Fransenfledermaus, das Braune Langohr (Pl. auritus) und die Kleine Hufeisennase (R. hipposideros) werden als ortstreu beschrieben. Diese Arten migrieren im Vergleich zu den anderen Arten nur wenige Kilometer. In Abhängigkeit vom Vorhandensein geeigneter Quartiere wird die Breitflügelfledermaus als sesshaft oder fakultativ migrierende Art beschrieben (Hutterer et al., 2005). Tabelle 1. Systematische Einordnung der in Deutschland vorkommenden, sich reproduzierenden Fledermausarten (NABU, 2014). Familie Gattung Spezies (wiss. Bezeichnung) Spezies (deutsche Bezeichnung) Vespertilionidae Barbastella B. barbastellus Mopsfledermaus (Glattnasen) Eptesicus E. nilssonii E. serotinus Nordfledermaus Breitflügelfledermaus Myotis M. alcathoe M. bechsteinii M. brandtii M. dasycneme M. daubentonii M. emarginatus M. myotis M. mystacinus M. nattereri Nymphenfledermaus Bechsteinfledermaus Große Bartfledermaus Teichfledermaus Wasserfledermaus Wimperfledermaus Großes Mausohr Kleine Bartfledermaus Fransenfledermaus Nyctalus N. leisleri N. noctula Kleiner Abendsegler Großer Abendsegler Rhinolophidae (Hufeisennasen) Pipistrellus Plecotus P. kuhlii P. nathusii P. pipistrellus P. pygmaeus Pl. auritus Pl. austriacus Weißrandfledermaus Rauhautfledermaus Zwergfledermaus Mückenfledermaus Braunes Langohr Graues Langohr Vespertilio V. murinus Zweifarbfledermaus Rhinolophus R. ferrumequinum Große Hufeisennase R. hipposideros Kleine Hufeisennase

11 Einleitung Gefährdung und Schutz von Fledertieren Trotz der großen ökologischen und wirtschaftlichen Bedeutung von Fledermäusen und Flughunden werden die Bestände anthropogen so beeinflusst, dass mittlerweile 20% aller beschriebenen Arten vom Aussterben bedroht sind (IUCN, 2011). Die natürlichen Lebensräume werden durch den weltweiten Bevölkerungszuwachs und dem damit einhergehenden Ausbau von Land- und Forstwirtschaft zerstört (Mickleburgh et al., 2002). Der resultierende Mangel an geeigneten Jagdgebieten und Nahrung wird zudem durch den Einsatz von Pestiziden gefördert. Des Weiteren werden durch Abholzungen bzw. Abriss- und Sanierungsarbeiten die Quartiere waldbewohnender bzw. gebäudebewohnender Fledermausarten zerstört (IUCN, 2011; EUROBATS, 2013). Mythen, die Unwissenheit über die ökologische Bedeutung sowie die Angst vor fledermausassoziierten Infektionskrankheiten (Abschnitt 1.1.4) sind zudem Faktoren, die Bestandsrückgänge zur Folge haben (Mickleburgh et al., 2002; Dietz et al., 2007; EUROBATS, 2013). Der Schutz europäischer Fledertiere und ihrer natürlichen Lebensräume wird durch internationale Abkommen (Berner Konvention, Bonner Konvention, Abkommen zur Erhaltung der europäischen Fledermauspopulationen) und nationale Gesetze (Fauna-Flora-Habitat Richtlinien, Bundesnaturschutzgesetz der Bundesrepublik Deutschland u.a.) geregelt (Dietz et al., 2007; EUROBATS, 2013). Durch Bestandserfassungen und -kontrollen soll der Gefährdungsstatus einzelner Arten erfasst werden, um konkrete Schutzmaßnahmen zu veranlassen. Zu diesen Maßnahmen gehören unter anderem die Optimierung oder Neuschaffung von Quartieren sowie der Erhalt von großräumigen, natürlichen Waldgebieten und unzerschnittenen Landschaftselementen. Mit Hilfe der Öffentlichkeitsarbeit soll das Bewusstsein und Wissen über Fledertiere im Wesentlichen erweitert werden (Dietz et al., 2007).

12 Einleitung Infektionserreger bei Fledertieren Fledertiere stehen zunehmend im Fokus wissenschaftlichen Interesses, da sie unter anderem Reservoirwirte für Viren sind, die nicht nur innerhalb der eigenen Spezies sondern auch auf andere Wildtiere, Haustiere und den Menschen übertragen werden können (Calisher et al., 2006; Poel et al., 2006; Wong et al., 2007; Luis et al., 2013). Bis zum Jahr 2011 sind nach einer Literaturstudie insgesamt 137 verschiedene Virusspezies bei Fledertieren nachgewiesen worden, wobei 61 davon ein zoonotisches Potential besitzen. Diese Zahl wird nur von der Ordnung der Nagetiere (Rodentia) übertroffen, wobei die Anzahl der Viren pro Spezies bei den Fledertieren deutlich höher liegt (Luis et al., 2013). Gerade der Einsatz moderner Next Generation Sequencing Technologien zur Untersuchung des Viroms wird die Nachweise viraler Infektionserreger sowohl bei Fledertieren als auch bei anderen Tieren noch stark erweitern (Tse et al., 2012). Die enorme Artenvielfalt der Fledertiere und einige ihrer einzigartigen biologischen und ökologischen Besonderheiten scheinen dies zu begünstigen. So könnte die evolutionsgeschichtlich frühe Entwicklung der Fledertiere die genetische Adaptation von Erreger und Wirt im Laufe der Ko-Evolution ermöglicht haben (Calisher et al., 2006; Wong et al., 2007). Kolonien mit bis zu mehreren Millionen Individuen, das außerordentliche Sozialverhalten, die Langlebigkeit sowie die Flug- und Migrationsfähigkeit erlauben zudem die Aufrechterhaltung, Übertragung und Verbreitung von Viren ganz unterschiedlicher Familien (Calisher et al., 2006; Wong et al., 2007; Luis et al., 2013). Auch die Überlappung von Lebensräumen und die Möglichkeiten der Inter-Speziesübertragung scheinen die enorme Zahl von Virusnachweisen zu begünstigen (Luis et al., 2013). Bei den meisten der beschriebenen Viren konnte bisher keine Übertragung von den Fledertieren auf andere Tiere oder den Menschen festgestellt werden (Calisher et al., 2006). Im Gegensatz dazu stellen einige Flughund- und Fledermausarten natürliche Reservoire von verschiedenen Zoonoseerregern dar, welche beim Menschen tödliche Erkrankungen hervorrufen können und daher eine Gefahr für die öffentliche Gesundheit darstellen. Große Aufmerksamkeit erregten dabei RNA-Viren der Familien Paramyxoviridae (Henipaviren), Coronaviridae (SARS-Coronavirus, MERS-Coronavirus), Filoviridae (Marburgvirus, Ebolavirus), Orthomyxoviridae (Influenzavirus A) und Rhabdoviridae (Lyssaviren) (Leroy et al.,

13 Einleitung ; Field, 2009; Towner et al., 2009; Kuzmin et al., 2011; Negredo et al., 2011; Shirato et al., 2012; Woo et al., 2012). Insbesondere die Paramyxo- und Coronaviridae zeigen, welche Auswirkungen fledermausassoziierte Virusepidemien in den vergangenen Jahren hatten. Bereits in den sechziger Jahren des 20. Jahrhunderts wurden Viren der Familie Paramyxoviridae bei Fledertieren in Indien nachgewiesen (Pavri et al., 1971), allerdings damals ohne Anzeichen humaner Infektionen (Wong et al., 2007). Im Jahr 1994 wurde in Australien das Hendravirus (HeV) erstmalig bei einem Ausbruch einer tödlich verlaufenden respiratorischen Erkrankung bei 21 Pferden und zwei Pferdehaltern festgestellt (Murray et al., 1995; Smith et al., 2011). Das naheverwandte Nipahvirus (NiV) wurde 1998 in Malaysia entdeckt. Es verursacht respiratorische Erkrankungen bei Schweinen und Enzephalitiden beim Menschen, jeweils mit sehr hohen Mortalitätsraten (Clayton et al., 2013). Weitere Ausbrüche waren in Singapur, Bangladesch und Indien zu verzeichnen. Durch phylogenetische Unterschiede und biologische Besonderheiten wurden das Hendraund Nipahvirus in die neue Ordnung Henipavirus innerhalb der Familie Paramyxoviridae eingeordnet (ICTV, 2013). HeV und NiV sowie virusneutralisierende Antikörper (VNA) wurden auf der Suche nach der eigentlichen Reservoirspezies bei verschiedenen Flughundarten der Gattung Pteropus nachgewiesen (Field et al., 2001). Die weltweite Intensivierung der Erforschung fledertierassoziierter Erreger, besonders Viren, führte dazu, dass auch bei afrikanischen Flughundarten direkte (RNA) oder indirekte (VNA) Nachweise der Zirkulation von Henipaviren oder Henipavirus-ähnliche Viren gefunden wurden (Clayton et al., 2013). Das Auftreten der Nipahvirus-Epidemie scheint durch die Abholzung von Nahrungsbäumen und der damit verbundenen Lebensraumzerstörung oder auch durch andauernde Dürreperioden begünstigt zu sein. So werden Flughunde in landwirtschaftliche Gebiete getrieben, in denen sie auf Obstplantagen entsprechende Nahrung finden. Die Nähe dieser Plantagen zu Schweinezuchtund Mastanlagen und den Menschen begünstigen die Infektionen mit dem Erreger, welcher über Speichel und Urin ausgeschieden wird (Poel et al., 2006; Field, 2009). Neben den Henipaviren scheinen Fledertiere Reservoir für weitere relevante Paramyxoviren zu sein (Drexler et al., 2012; Kurth et al., 2012).

14 Einleitung 9 Das SARS-Coronavirus (SARS-CoV) aus der Familie der Coronaviridae wurde während eines Ausbruchs des Schweren Akuten Respiratorischen Syndroms (Severe Acute Respiratory Syndrome, SARS) im Jahr 2002/2003 entdeckt (Ksiazek et al., 2003). Der Krankheitserreger wurde durch Tröpfcheninfektion von Mensch zu Mensch übertragen und hatte nahezu 1000 humane Erkrankungsfälle zur Folge. In sogenannten wild game meat markets, in denen lebende Wildtiere zum Verkauf und Verzehr angeboten werden, haben sich Einkäufer mit dem Virus infiziert. Der Erreger konnte bei einer Schleichkatzenart (Paguma larvata), einer chinesischen Unterart des Marderhundes (Nyctereutes procyonoides) und einem chinesischen Sonnendachs (Melogale moschata) nachgewiesen werden (Wong et al., 2007). Bei der erweiterten Suche nach der Reservoirspezies wurde ein dem SARS-CoV sehr ähnliches Virus (bat-sars-cov) und andere Coronaviren bei verschiedenen Arten von Fledermäusen entdeckt (Li et al., 2005). Hohe Seroprävalenzen und Virus- sowie RNA-Nachweise bei verschiedenen Fledertieren bekräftigen die Annahme, dass Fledermäuse und Flughunde die Reservoirspezies für SARS-Coronaviren darstellen (Li et al., 2005; Calisher et al., 2006; Anthony et al., 2013; Drexler et al., 2014). Bei einer jüngsten Häufung von Erkrankungs- und Todesfällen beim Menschen im arabischen Raum wurde das Middle East Respiratory Syndrome verursachende Coronavirus (MERS-CoV) isoliert (Zaki et al., 2012). Das Reservoir für diese Viren ist noch nicht zweifelsfrei identifiziert, aber interessanterweise wurden genetisch sehr ähnliche Coronaviren in verschiedenen Fledertierfamilien in Afrika, Amerika, Asien und Europa gefunden. Nicht zuletzt der Nachweis von Virusgenom in einer Fledermausart in Saudi-Arabien mit 100% Übereinstimmung mit dem humanen Indexfall deutet darauf hin, dass Fledertiere eine Rolle in der Epidemiologie dieser Krankheit spielen (Memish et al., 2013). Virusnachweise und die Demonstration neutralisierender Antikörper in Dromedaren deuten jedoch darauf hin, dass auch andere Tierarten als Reservoir oder Zwischenwirt fungieren können (Haagmans et al., 2014). Die älteste bekannte und nahezu weltweit vorkommende fledermausassoziierte Zoonose ist jedoch die durch verschiedene Lyssaviren hervorgerufene Tollwut. Im folgenden Abschnitt werden die Lyssaviren im Zusammenhang mit ihren Reservoirspezies und ihrer Verbreitung vorgestellt.

15 Einleitung Lyssaviren Morphologie, Genomstruktur und Taxonomie der Lyssaviren Lyssaviren sind Einzelstrang-RNA-Viren, welche durch ihre neurotropen Eigenschaften bei Säugetieren und dem Menschen eine akute, progressiv verlaufende und unheilbare Erkrankung des zentralen Nervensystems (Meningoenzephalitis) hervorrufen. Ein Lyssavirus-Virion besitzt eine geschossförmige Morphologie und ist aus fünf unterschiedlichen Strukturproteinen aufgebaut (Abbildung 1). Der Kern des Virus-Partikels wird von dem Ribonukleoproteinkomplex (RNP) gebildet und umfasst die genomische RNA negativer Polarität, welche vom Nukleokapsidprotein (N), der viralen RNA- Polymerase (L) und dem Phosphoprotein (P) umhüllt ist. Der RNP-Kern ist mit dem Matrixprotein (M) assoziiert, welches die typische geschossförmige Struktur der Virionen formt. Die RNP-M-Struktur wird von einer der Wirtszellmembran entstammende Lipiddoppelschicht (Membran) umgeben, in der das spikesbildende, trimere Oberflächenprotein, das Glykoprotein (G) verankert ist. Das Genom der Lyssaviren (~12 kb) umfasst fünf Gene, die in einer festen Reihenfolge (3 -N-P-M-G-L-5 ) angeordnet sind und die Strukturproteine der Virionen kodieren (Schnell et al., 2010; Wunner & Conzelmann, 2013).

16 Einleitung 11 Abbildung 1. Schematische Darstellung eines Lyssavirus-Virions, welches sich aus dem Glykoprotein (G), Matrixprotein (M) und dem Ribonukleoproteinkomplex (RNP), bestehend aus negativer, einzelsträngiger RNA, Phosphoprotein (P), Nukleokapsidprotein (N) und RNA-Polymerase (L), zusammensetzt (Wunner & Conzelmann, 2013). Innerhalb der Ordnung Mononegavirales werden Lyssaviren zusammen mit zehn weiteren Genera (Cytorhabdovirus, Ephemerovirus, Novirhabdovirus, Nucleorhabdovirus, Perhabdovirus, Sigmavirus, Sprivivirus, Tibrovirus, Tupavirus und Vesiculovirus) der Familie Rhabdoviridae zugeordnet (Dietzgen et al., 2012; ICTV, 2013). Entsprechend dem International Committee on Taxonomy of Viruses (ICTV) werden innerhalb der Lyssaviren derzeit 12 Spezies unterschieden: Rabies virus (RABV), European bat lyssavirus 1 (EBLV-1) European bat lyssavirus 2 (EBLV-2), Australian bat lyssavirus (ABLV), Duvenhage virus (DUVV), Lagos bat virus (LBV), Aravan virus (ARAV), Khujand virus (KHUV), Irkut virus (IRKV), West Caucasian bat virus (WCBV), Mokola virus (MOKV) und Shimoni bat lyssavirus (SHIBV) (Tabelle 2). Zwei weitere jüngst entdeckte Lyssaviren, Ikoma virus (IKOV) (Marston et al., 2012) und Bokeloh bat lyssavirus (BBLV) (Freuling et al., 2011), sind anerkannt, aber noch nicht final ratifiziert (ICTV, 2013). Von einer weiteren Spezies, dem Lleida bat lyssavirus (LLEBV), ist bisher nur genomisches Material nachgewiesen worden (Tabelle 2) (Ceballos et al., 2013). Aufgrund ihrer phylogenetischen, antigenen und immunologischen Unterschiede werden die

17 Einleitung 12 Lyssaviren in Phylogruppen eingeteilt (Tabelle 2, Abbildung 2) (Banyard et al., 2013a). In der Phylogruppe I werden neun Lyssavirusspezies zusammengefasst (RABV, EBLV-1, EBLV-2, BBLV, ABLV, KHUV, ARAV, DUVV, IRKV). Inaktivierte humane Tollwutimpfstoffe, welche auf Basis des klassischen Tollwutvirus (RABV) hergestellt werden, induzieren einen gewissen Kreuzschutz gegenüber allen zu dieser Phylogruppe gehörenden Lyssaviren (Brookes et al., 2005; Hanlon et al., 2005; Malerczyk et al., 2009; Liu et al., 2013a). Diese Antikörper bewirken jedoch keine effektive Neutralisation von Lyssaviren der Phylogruppe II (SHIBV, LBV, MOKV) sowie von WCBV und IKOV (Banyard et al., 2013a). Da auch zwischen WCBV und IKOV keine kreuzneutralisierenden Eigenschaften bestehen (Horton et al., 2014), kann von mindestens zwei weiteren Phylogruppen ausgegangen werden. Die phylogenetische Rekonstruktion anhand einer Nucleoprotein- Gensequenz hat gezeigt, dass die vermutlich neue Lyssavirusspezies LLEBV nahe verwandt mit WCBV und IKOV ist, so dass ein adäquater Impfschutz ebenfalls nicht zu erwarten ist (Ceballos et al., 2013).

18 Einleitung 13 Abbildung 2. Phylogenetischer Stammbaum der Familie Rhabdoviridae basierend auf partiellen N N-Gen Gen-Sequenzen Sequenzen mit der Neighbor-Joining-Methode Neighbor Methode (MEGA 5, Kimura Kimura-2Parameter). Bootstrap Values >70 >70 (1000 Wiederholungen) sind angegeben (NCBI, (NCBI 2013; ICTV, 2013).

19 Einleitung 14 Tabelle 2. Vorkommen, Verbreitung und Reservoire der Lyssaviren (verändert nach Hanlon & Childs, 2013). Lyssavirus RABV I LBV II DUVV I MOKV II Verbreitung/ Nachweis Nahezu weltweit (exklusive Antarktika & Australien) Afrika Äthiopien Guinea Kenia Nigeria Senegal Südafrika Zentralafrikanische Republik Zimbabwe Afrika Südafrika Afrika Äthiopien Kamerun Nigeria Südafrika Zentralafrikanische Republik Zimbabwe Reservoirspezies Carnivora Fledermäuse (ausschließlich Amerika) Flughunde Palmenflughund (Eidolon helvum) Nilflughund (Rousettus aegyptiacus) Insektivore Fledermäuse? Langflügelfledermaus (Miniopterus sp.) Ägyptische Schlitznase (Nycteris thebaica) Fledertiere? Spitzmäuse? Phylogruppe spill-over- Infektion Haustier Mensch Nutztier Wildtier Fledertiere Hund Katze Manguste Referenzen (Viruserstnachweis) Carini, 1911 Scatterday, 1954 WHO, 2013 Boulger & Porterfield, 1958 Mensch Meredith et al., 1971 Hund Katze Mensch Ratte Shope et al., 1970

20 Einleitung 15 Fortsetzung von Tabelle 2. Vorkommen, Verbreitung und Reservoire der Lyssaviren (verändert nach Hanlon & Childs, 2013). Lyssavirus SHIBV II IKOV IV? ABLV I Verbreitung/ Nachweis Afrika Kenya Afrika Tanzania Reservoirspezies Phylogruppe spill-over- Infektion Referenzen (Viruserstnachweis) Insektivore Fledermäuse? Kuzmin et al., 2010 Rundblattnase (Hipposideros sp.) Fledertiere? Zibetkatze Marston et al., 2012 Australien Flughunde Schwarzer Flughund (Pteropus alecto) Brillenflughund (Pteropus conspicillatus) Graukopf Flughund (Pteropus poliocephalus) Kleiner Roter Flughund (Pteropus scapulatus) Insektivore Fledermaus Gelbe Kurzschwanzmantelfledermaus (Saccolaimus flaviventris) Mensch Pferd Fraser et al., 1996 Hooper et al., 1997 ARAV I KHUV I IRKV I Asien Kirgisistan Asien Tadschikistan Asien Jilin -Provinz Ostsibirien Primorje - Region Insektivore Fledermäuse? Kleines Mausohr (Myotis blythi) Insektivore Fledermäuse? Kleine Bartfledermaus (Myotis mystacinus) Insektivore Fledermäuse? Große Röhrennasenfledermaus (Murina leucogaster) Kuzmin et al., 1992 Kuzmin et al., 2003 Mensch Botvinkin et al., 2003

21 Einleitung 16 Fortsetzung von Tabelle 2. Vorkommen, Verbreitung und Reservoire der Lyssaviren (verändert nach Hanlon & Childs, 2013). Lyssavirus EBLV-1 I EBLV-2 I BBLV I WCBV III? LLEBV*? Verbreitung/ Nachweis Europa Dänemark Deutschland Frankreich Niederlande Polen Spanien u.a. Europa Deutschland England Finnland Niederlande Schottland Schweiz Europa Deutschland Frankreich Europa Kaukasus Europa Spanien Reservoirspezies Insektivore Fledermäuse Breitflügelfledermaus (Eptesicus serotinus) Isabellfledermaus (Eptesicus isabellinus) Insektivore Fledermäuse Teichfledermaus (Myotis dasycneme) Wasserfledermaus (Myotis daubentonii) Insektivore Fledermaus Fransenfledermaus (Myotis nattereri) Insektivore Fledermäuse? Langflügelfledermaus (Miniopterus schreibersii) Insektivore Fledermäuse? Langflügelfledermaus (Miniopterus schreibersii) Phylogruppe spill-over- Infektion Fledertiere Katze Mensch Schaf Steinmarder Referenzen (Viruserstnachweis) Mohr, 1957 Mensch Lumio et al., 1986 Freuling et al., 2011 Botvinkin et al., 2003 Ceballos et al., 2013 *Lyssavirus noch nicht durch das ICTV [Stand: Juli 2013] als Spezies anerkannt.

22 Einleitung Vorkommen, Verbreitung und Reservoire der Lyssaviren Amerika Das Rabies virus (RABV), der Erreger der klassischen Tollwut, kommt nahezu weltweit vor und hat sein Reservoir in unterschiedlichen Spezies der Ordnung Carnivora (z.b. Hund, Fuchs, Waschbär, Skunk, Marderhund und Manguste). Laut Weltgesundheitsorganisation (WHO) sterben jährlich weltweit ca Menschen an einer durch RABV hervorgerufenen Tollwuterkrankung, wobei der Infektionserreger häufig durch den Biss infizierter Hunde übertragen wird (WHO, 2013). RABV ist zudem die erste Lyssavirusspezies, welche bei Arten der Ordnung Chiroptera festgestellt wurde. Einzig auf dem amerikanischen Kontinent zirkuliert RABV auch in Fledermäusen. Bereits zu Beginn des 19. Jahrhunderts wurden im Süden Brasiliens Krankheitsausbrüche in Rinderhaltungen in den Zusammenhang mit den in Zentral- und Südamerika verbreiteten, sich haematophag ernährenden Vampirfledermäusen (Desmodontinae) gebracht (Carini, 1911). Die Vermutung, dass diese Fledermausarten RABV übertragen, wurde erst 1931 während einer Epidemie auf der Insel Trinidad bestätigt, bei der 75 humane Tollwutfälle und tausende Infektionen in der Tierhaltung zu verzeichnen waren (Pawan, 1936; Waterman, 1959). Nach wie vor stellt die Tollwutübertragung durch Vampirfledermäuse besonders in den entlegenen Regionen Amazoniens ein großes humanmedizinisches Problem dar (Gilbert et al., 2012). Es entstehen zudem hohe wirtschaftliche Schäden durch die Übertragung von RABV auf Weiderinder (Hanlon & Childs, 2013). Das Vorkommen von RABV bei insektivoren Fledermäusen ist erst seit den fünfziger Jahren des 20. Jahrhunderts belegt (Scatterday, 1954). In den Vereinigten Staaten von Amerika (USA) wurden seither Individuen von fast jeder der 41 einheimische Fledermausarten Tollwut-positiv getestet, wobei RABV- Infektionen am häufigsten bei Eptesicus fuscus (Große Braune Fledermaus), Myotis lucifugus (Kleine Braune Fledermaus), Tadarida brasiliensis (Mexikanische Bulldoggfledermaus) und Lasiurus borealis (Rote Fledermaus) zu verzeichnen sind (Messenger et al., 2002; Blanton et al., 2012; Patyk et al., 2012). Mindestens acht verschiedene RABV-Linien, welche mit bestimmten Fledermaustaxa (Reservoirspezies) assoziiert sind, lassen sich phylogenetisch unterscheiden und

23 Einleitung 18 erlauben Rückschlüsse auf evolutionsgeschichtliche Wirtswechsel, welche allem Anschein nach in erster Linie bei naheverwandten Fledermausarten mit ähnlicher Sozialstruktur und überlappendem Verbreitungsgebiet erfolgten (Intra-Spezies- Übertragung) (Kuzmin & Rupprecht, 2007; Streicker et al., 2010). Phylogenetische Rekonstruktionen deuten zudem darauf hin, dass Fledertiere die eigentlichen Reservoire für Lyssaviren sind. RABV bei terrestrischen Carnivoren ist somit allem Anschein nach das Resultat von spill-over-infektionen (Inter-Spezies-Übertragung) verbunden mit einer genetischen Adaptation, die eine Aufrechterhaltung, Ausscheidung und weitere Übertragung von RABV im neuen Wirt ermöglichte (Badrane & Tordo, 2001). Spill-over-Infektionen von Lyssaviren von Fledermäusen auf andere Säugetiere sind generell selten und führen mehrheitlich zu dead-end- Infektionen. In Nordamerika sind jedoch etablierte Wirtswechsel von Myotis lucifugus- bzw. Eptesicus fuscus- spezifischen RABV-Linien bei Rotfüchsen (Vulpes vulpes) und Streifenskunks (Mephitis mephitis) durch phylogenetische Studien nachgewiesen (Daoust et al., 1996; Leslie et al., 2006; Kuzmin et al., 2012). Afrika Die Diversität der Lyssaviren ist mit sechs verschiedenen Spezies (RABV, LBV, DUVV, MOKV, SHIBV, IKOV) nach derzeitigen Erkenntnissen in Afrika am höchsten. Im Jahr 1956 wurde auf Lagos Island (Nigeria) erstmals das Lagos bat virus (LBV) aus Gehirnmaterial von Eidolon helvum (Palmenflughund) isoliert (Boulger & Porterfield, 1958). Weitere Isolate stammen aus den Flughundarten Rousettus aegyptiacus (Nilflughund), Micropteropus pusillus (Zwerg- Epaulettenflughund) und Epomophorus wahlbergi (Wahlberg-Epaulettenflughund) sowie der insektivoren Fledermausart Nycteris gambiensis (Gambia Schlitznase). Nachweise für LBV-spill-over-Infektionen existieren für Haustiere und eine afrikanische Sumpfmanguste (Atilax paludinosus), jedoch nicht für den Menschen (Tabelle 2) (Markotter et al., 2006; Kuzmin et al., 2008a). Im Gegensatz dazu sind drei humane Infektionen aus den Jahren 1970, 2006 und 2007 mit dem Duvenhage virus (DUVV) in Folge einer Exposition mit unspezifizierten afrikanischen Fledermäusen bekannt (Meredith et al., 1971; Paweska et al., 2006; Thiel et al., 2008). Es existieren zudem zwei Einzelnachweise von DUVV aus Miniopterus sp. (Mi. schreibersii / Mi. natalensis)

24 Einleitung 19 (1981,Südafrika) und Nycteris thebaica (1986, Simbabwe), so dass derzeit das Reservoir in insektivoren Fledermausarten vermutet wird (Tabelle 2) (Banyard et al., 2013a). Das Mokola virus (MOKV) wurde erstmals im Jahr 1968/1969 aus Organproben von afrikanischen Spitzmäusen (Crocidura flavescens manni) aus Ibadan, Nigeria isoliert (Shope et al., 1970). Derzeit gibt es insgesamt 23 MOKV-Isolate und einen MOKV-RNA Nachweis aus insgesamt sechs afrikanischen Staaten (Tabelle 2) (Sabeta & Phahladira, 2013). MOKV-Infektionen wurden bisher im Menschen, in Haustieren und Wildtieren, jedoch noch nie in Fledertieren festgestellt (Kgaladi et al., 2013). Virus-neutralisierende Antikörper, welche aufgrund der Kreuzneutralisationen innerhalb der gleichen Phylogruppe II sowohl LBV als auch MOKV neutralisieren, wurden in Rousettus aegyptiacus und Eidolon helvum detektiert (Kuzmin et al., 2008a; Dzikwi et al., 2010; Wright et al., 2010). Ob andere Spezies der Ordnung Chiroptera oder sogar Spitzmäuse das eigentliche Reservoir für MOKV darstellen, muss durch intensivierte Surveillance-Studien untersucht werden (Kgaladi et al., 2013). Ein bisher einmaliger Nachweis des Shimoni bat lyssavirus (SHIBV) gelang im Jahr 2009 in Kenia. Im Rahmen einer aktiven Surveillance wurden auch Fledermaus-Totfunde aus Höhlenquartieren auf humanpathogene Erreger hin untersucht. Das Virus-Isolat stammt aus einer tot aufgefundenen Hipposideros vittatus (Gestreifte Blattnasenfledermaus), welche ursprünglich als H. commersonii (Commerson-Rundblattnase) beschrieben wurde (Kuzmin et al., 2010). Die Höhle, aus der das infizierte Tier stammt, wird zudem von acht weiteren Fledertierarten in Form von großen Kolonien bewohnt. Neben SHIBV konnte dort bereits zuvor LBV aus R. aegyptiacus isoliert sowie lyssavirus-neutralisierende Aktivität von Seren gegenüber WCBV beobachtet werden (Kuzmin et al., 2008a, b). Durch diese Ko- Zirkulation von verschiedenen Lyssaviren in dieser Mischkolonie lässt sich die Möglichkeit einer spill-over-infektion bei H. vittatus nicht ausschließen (Kuzmin et al., 2010). Die Entdeckung einer weiteren neuen Lyssavirusspezies, des Ikoma virus (IKOV), erfolgte im Jahr 2009 im Serengeti Nationalpark während einer RABV- Routineuntersuchung einer afrikanischen Zibetkatze (Civettictis civetta) (Marston et al., 2012). Außerhalb des Nationalparks sind nur RABV-Infektionen bei

25 Einleitung 20 terrestrischen Carnivoren bekannt, so dass diese IKOV-Infektion vermutlich ausgehend von Fledertieren das Resultat einer Inter-Spezies-Übertragung zu sein scheint. Im Gegensatz zu den anderen in Afrika vorkommenden Lyssaviren, kann IKOV aufgrund der erheblichen genetischen Distanz nicht in die Phylogruppen I (RABV, DUVV) oder II (MOKV, SHIBV, LBV) eingeordnet werden (Abbildung 2) (Horton et al., 2014). Die sporadische Detektion der hier aufgeführten Lyssaviren ist vermutlich einer unzureichenden Surveillance oder limitierter Diagnostikfähigkeiten (z.b. Typisierung / Sequenzierung von Isolaten) geschuldet (Banyard et al., 2013b), so dass die wahre Diversität und Verbreitung der Lyssaviren in Afrika vermutlich viel größer ist, als derzeit angenommen. Australien Australien galt lange Zeit als frei von RABV und anderen fledermausassoziierten Lyssaviren. Im Jahr 1996 wurde jedoch bei der Untersuchung eines flugunfähigen Schwarzen Flughundes (Pteropus alecto) das Australian bat lyssavirus (ABLV) isoliert (Fraser et al., 1996; Hooper et al., 1997; Gould et al., 1998). Durch intensive Surveillance-Studien wurde ABLV auch in den übrigen einheimischen Pteropus-Arten (Pt. poliocephalus, Pt. scapulatus, Pt. conspicillatus) und in der insektivoren Fledermausart Saccolaimus flaviventris nachgewiesen (Tabelle 2). Anhand von Sequenzanalysen werden zwei ABLV-Linien unterschieden, welche mit den Flughunden bzw. mit der Fledermausart assoziiert sind (Guyatt et al., 2003). Das Verbreitungsgebiet von Pt. alecto erstreckt sich von Australien über Papua-Neuguinea bis hin zur indonesischen Insel Java, so dass das Vorkommen von ABLV in Indonesien nicht ausgeschlossen wird (Arguin et al., 2002; Hutson et al., 2008b). Während bereits zwei Humanfälle in den Jahren 1996 und 1998 zu verzeichnen waren, wurde eine spill-over-infektion bei terrestrischen Tieren erst jüngst bei einem Pferd diagnostiziert (Johnson et al., 2010; Queensland Government, 2014). Asien Bei der aktiven Suche nach fledermausassoziierten Lyssaviren wurden in Zentralasien bisher unbekannte Tollwuterreger entdeckt (Tabelle 2). Im Jahr 1991 wurde im Süden von Kirgisistan das Aravan virus (ARAV) aus einem Vertreter

26 Einleitung 21 der Art Myotis blythi (Kleines Mausohr) und im Jahr 2001 im Norden von Tadschikistan das Khujand virus (KHUV) aus einer Myotis mystacinus (Kleine Bartfledermaus) isoliert (Kuzmin et al., 1992; Kuzmin et al., 2003). Im Jahr 2002 gelang zudem die Entdeckung des Irkut virus (IRKV) bei der Untersuchung einer Großen Röhrennasenfledermaus (Murina leucogaster) in Ostsibirien (Botvinkin et al., 2003). Von den drei in Asien beschriebenen fledermausassoziierten Lyssaviren erfolgte die wiederholte Detektion einzig bei IRKV im Zusammenhang mit einem humanen Tollwutfall (Jahr 2007) und ebenfalls bei Murina leucogaster im Zuge einer gezielten Beprobung von Fledermäusen im Jahr 2012 (Leonova et al., 2009; Liu et al., 2013b). Europa Der erste Fall von Fledermaustollwut in Europa wurde im Jahr 1954 in Hamburg festgestellt (Mohr, 1957). Erst nach einem humanen Tollwutfall zeigte die Virustypisierung mit Hilfe monoklonaler Antikörper, dass sich dieses Lyssavirus und die bis dahin nachgewiesenen Lyssaviren europäischer Fledermäuse deutlich von RABV unterschieden. Von den bisher an das WHO Rabies-Bulletin- Europe (RBE, ) gemeldeten Tollwutinfektionen bei Fledermäusen wird am häufigsten das European bat lyssavirus 1 (EBLV-1) bei den Schwesterarten Eptesicus serotinus und Eptesicus isabellinus nachgewiesen (Tabelle 2) (Müller et al., 2007; Vazquez-Moron et al., 2008; RBE, 2013). In einzelnen Fällen wurde eine EBLV-1-Infektion auch bei Individuen von N. noctula, M. myotis, V. murinus, Rh. ferrumequinum, P. nathusii, P. pipistrellus und bei einem in Gefangenschaft gehaltenen Nilflughund (R. aegyptiacus) diagnostiziert (Ronsholt et al., 1998; King et al., 2004). Weitere spill-over-infektionen bzw. dead-end-infektionen sind für terrestrische Säugetiere in Dänemark (Schafe, n=5), Frankreich (Katzen, n=2) und Deutschland (Steinmarder, n=1) beschrieben (Ronsholt, 2002; Müller et al., 2004; Dacheux et al., 2009). Europaweit gibt es nur zwei bestätigte EBLV-1-Infektionen beim Menschen aus den Jahren 1977 (Ukraine) und 1985 (Russland) (Fooks et al., 2003a). Innerhalb von Europa ist EBLV-1 weit verbreitet, wobei die meisten Fälle in Dänemark, Deutschland und den Niederlanden zu verzeichnen sind (Schatz et al., 2013a). EBLV-1 wird aufgrund der genetischen Diversität in die Subtypen EBLV- 1a und EBLV-1b unterteilt (Amengual et al., 1997; Davis et al., 2005). Während

27 Einleitung 22 die Mehrzahl der charakterisierten Isolate dem Typ 1a zugeordnet werden können (Davis et al., 2005; McElhinney et al., 2013), wurde EBLV-1b vereinzelt in E. serotinus aus Frankreich, Deutschland, den Niederlanden und Polen nachgewiesen (Picard-Meyer et al., 2004; Davis et al., 2005; Poel et al., 2005; Müller et al., 2007; Smreczak et al., 2009). Neueren Untersuchungen zufolge scheinen die in der Isabellfledermaus (E. isabellinus) auf der Iberischen Halbinsel nachgewiesenen EBLV-1-Varianten einen eigenen Subtyp darzustellen (Vazquez- Moron et al., 2011). Anhaltspunkte für die Existenz weiterer EBLV-1-Varianten in anderen Fledermausspezies außer der beiden Eptesicus-Arten, ähnlich der fledermausassoziierten RABV-Linien in Amerika, bestehen derzeit nicht. Im Gegensatz zu EBLV-1 wird das European bat lyssavirus 2 (EBLV-2) nur sporadisch bei Individuen der Gattung Myotis (M. daubentonii, M. dasycneme) festgestellt. Im Zeitraum von erfolgte im Rahmen der passiven Surveillance die Diagnose von insgesamt 20 EBLV-2-Infektionen bei M. daubentonii (n=16) und M. dasycneme (n=4), wohingegen bei Untersuchung freilebender Wasserfledermäuse nur zwei EBLV-2-RNA-Nachweise aus Maultupferproben beschrieben sind (McElhinney et al., 2013). Der Erstnachweis von EBLV-2 erfolgte im Jahr 1985 bei einem in Helsinki verstorbenen Fledermausbiologen, der in Finnland, der Schweiz und in Malaysia gearbeitet hatte, wodurch der Ort der Exposition lange Zeit ungeklärt blieb (Lumio et al., 1986). Während im Folgejahr EBLV-2 in der Schweiz festgestellt werden konnte, gelang die Detektion in Finnland trotz intensiver Untersuchungen erst im Jahr Das finnische Isolat aus einer M. daubentonii hat mit dem Isolat vom Menschen eine genetische Übereinstimmung (N-Gen) von 99.1% (Jakava-Viljanen et al., 2010). Ein weiterer EBLV-2-Humanfall in Folge eines Fledermausbisses war im Jahr 2002 in Schottland zu verzeichnen (Fooks et al., 2003b). Die Detektion und Isolierung des Bokeloh bat lyssavirus (BBLV) gelang erstmalig im Jahr 2009 bei einer Fransenfledermaus (Myotis nattereri) aus Niedersachsen, welche nach tollwuttypischen Symptomen in einer Pflegestation verstarb und anschließend in der Routineuntersuchung positiv auf Tollwut getestet wurde (Freuling et al., 2011). Die Annahme, dass M. nattereri Reservoirwirt für BBLV ist, wurde durch zwei weitere Nachweise in Fransenfledermäusen aus

28 Einleitung 23 Deutschland (Bayern) und Frankreich bestätigt (Freuling et al., 2013; Picard- Meyer et al., 2013). Aus einer Langflügelfledermaus (Miniopterus schreibersii) stammt das im Jahr 2002 in Südrussland (Kaukasus) isolierte West Caucasian bat virus (WCBV) (Botvinkin et al., 2003). Bis heute gibt es nur dieses einzige Isolat, welches sich phylogenetisch stark von den in Europa und Asien nachgewiesenen Lyssaviren unterscheidet (Kuzmin et al., 2005). Eine phylogenetisch nahverwandte und vermutlich neue Lyssavirusspezies, das Lleida bat lyssavirus (LLEBV), wurde ebenfalls in einer Mi. schreibersii im Jahr 2012 in Spanien detektiert, wobei Versuche, das Virus zu isolieren, bisher gescheitert sind (Ceballos et al., 2013). Die Langflügelfledermaus ist im gesamten europäischen Mittelmeergebiet verbreitet und zudem in Nordafrika, Anatolien, dem südlichen Asien und dem Kaukasus vorkommend (Hutson et al., 2008a). Aufgrund des großen Verbreitungsgebietes dieser Art ist das Vorkommen vom WCBV auch außerhalb von Europa zu vermuten. In Seren afrikanischer Miniopterus-Arten wurden bei der Testung gegen WCBV virus-neutralisierende Antikörper festgestellt. Kreuzneutralisationen mit RABV und anderen bis dahin in Afrika nachgewiesenen Lyssaviren konnten zu der Zeit ausgeschlossen werden (Kuzmin et al., 2008b). Bei Einzelnachweisen von fledermausassoziierten Lyssaviren wie ARAV, KHUV, WCBV, LLEBV, SHIBV sind Aussagen zur Verbreitung und zum Reservoir derzeit nicht möglich, da es sich auch um spill-over-infektionen handeln könnte. Auch fehlt bisweilen eine eindeutige Identifizierung der vermeintlichen Reservoirspezies, denn beispielsweise stimmen Verbreitungsgebiete gemäß International Union for Conservation of Nature (IUCN) nicht immer mit Angaben der ursprünglich identifizierten Fledermausarten überein (Kuzmin et al., 2005; IUCN, 2013). Zudem zeigen genetische Untersuchungen, dass es sich bei den bislang anhand von morphologischen Merkmalen geführten Speziesidentifizierungen insbesondere bei asiatischen und afrikanischen Fledermausarten, oft um noch unbekannte Unteroder Schwester- (kryptische) Arten handelt (Kawai et al., 2003; Murray et al., 2012; Monadjem et al., 2013).

29 Einleitung Ausscheidung und Übertragung von Lyssaviren Die Intra- aber auch die Inter-Spezies-Übertragung von fledermausassoziierten Lyssaviren erfolgt, ähnlich wie bei RABV bei terrestrischen Carnivoren, über den Speichel durch den direkten Kontakt (Bisse, Kratzer, Lecken) mit infizierten Tieren (Jackson, 2003; Banyard et al., 2011). In Europa konnte bei Breitflügel- und Wasserfledermäusen (Reservoirwirte) die Ausscheidung von EBLV-1 und EBLV-2 über den Speichel bzw. die Mundhöhle bei experimentellen und aktiven Surveillance-Studien eindeutig belegt werden (Johnson et al., 2008; Freuling et al., 2009; SNH, 2009; Megali et al., 2010; Schatz et al., 2013b). Für RABV bei amerikanischen Fledermausspezies wurde zusätzlich die Virusausscheidung bzw. -übertragung über den Harntrakt und die Atemwege sowie eine transplazentale Übertragung diskutiert (Allendorf et al., 2012). Um zu prüfen, ob durch die Inhalation von aerosolisierten RABV und EBLV-2 eine Tollwutinfektion verursacht werden kann, wurde eine experimentelle Studie bei Mäusen durchgeführt. Einzig bei RABV-infizierten Tieren konnten Erkrankungen beobachtet und Virus sowie virusspezifische RNA in Gehirn, Zunge, Lunge und Magen nachgewiesen werden (Johnson et al., 2006). Bei natürlich oder experimentell infizierten europäischen Fledermäusen liegen bislang keine Hinweise für andere Übertragungswege von fledermausassoziierten Tollwutviren vor (Freuling et al., 2009) Surveillance und Diagnostik von Lyssaviren Für die Überwachung der Fledermaustollwut in Europa wird eine passive und aktive Surveillance in enger Zusammenarbeit mit Fledermausspezialisten, verschiedenen Institutionen und Ämtern unter Berücksichtigung des Schutzstatus der Fledermäuse empfohlen (Med Vet Net Working Group, 2005; EUROBATS, 2006; Cliquet et al., 2010). Die passive Überwachung umfasst die Untersuchung von Fledermäusen, die entweder tot, mit tollwut-verdächtigen Symptomen oder krankhaftem ungewöhnlichem Verhalten aufgefunden werden und/oder die durch Kratz- und Beißverhalten Kontakt zu Menschen und Haustieren hatten. Dabei soll der Fokus nicht ausschließlich auf Reservoirspezies liegen, sondern alle Fledermausspezies umfassen. Zur Diagnose einer Lyssavirusinfektion wird Gehirnmaterial entnommen und in Form eines Abklatschpräparates mit Hilfe des direkten

30 Einleitung 25 Fluorescent Antibody Tests (FAT) auf das Vorhandensein von Lyssavirus-Antigen hin untersucht (Dean et al., 1996). FAT-negative Tiere mit Personenkontakt aber auch Tiere mit nicht eindeutig interpretierbaren FAT-Ergebnissen werden durch weitere Methoden wie dem Rabies Tissue Culture Infection Test (RTCIT) und/oder mit verschiedenen Assays der Reverse Transcriptase - Polymerase Chain Reaction (RT-PCR) überprüft (Webster & Casey, 1996; Heaton et al., 1997). Daten zu untersuchten und Tollwut-positiv getesteten Fledermäusen werden von den europäischen Ländern seit 1977 quartalsweise an das Tollwutinformationssystem WHO-Rabies-Bulletin-Europe (RBE) gemeldet (Cliquet et al., 2010). Im Rahmen der aktiven Surveillance soll eine möglichst flächendeckende und umfangreiche Beprobung freilebender einheimischer Fledermauspopulationen erfolgen. Dabei kann der Fokus sowohl auf alle vorkommenden Arten oder gezielt auf Reservoirspezies in bestimmten Regionen liegen. Die Beprobung von bestimmten Kolonien oder Wochenstuben soll maximal in einem jährlichen Turnus erfolgen, um Störungen der Tiere möglichst gering zu halten. Die Untersuchungen von Maultupfer- bzw. Serumproben mittels molekularbiologischer (RT-PCR) und serologischer (Rapid Fluorescent Focus Inhibition Test, RFFIT) (Smith et al., 1973) Testverfahren haben zum Ziel, lyssavirusspezifische RNA bzw. virusneutralisierende Antikörper (VNA) zu detektieren. Sowohl bei der aktiven als auch für die passive Surveillance ist dabei die Dokumentation der untersuchten Spezies, Geschlecht, Alter und Fundort essentiell (Cliquet et al., 2010).

31 26 2 Literaturverzeichnis Agnarsson, I., Zambrana-Torrelio, C. M., Flores-Saldana, N. P., May-Collado, L. J. (2011). A time-calibrated species-level phylogeny of bats (Chiroptera, Mammalia). PLoS Currents 3, Tree of Life. Edition doi: /currents.RRN1212. Allendorf, S. D., Cortez, A., Heinemann, M. B., Harary, C. M. A., Antunes, J. M. A. P., Peres, M. G., Vicente, A. F., Sodré, M. M., da Rosa, A. R., Megid, J. (2012). Rabies virus distribution in tissues and molecular characterization of strains from naturally infected non-hematophagous bats. Virus Research 165, Amengual, B., Whitby, J. E., King, A., Cobo, J. S., Bourhy, H. (1997). Evolution of European bat lyssaviruses. Journal of General Virology 78, Anthony, S., Ojeda-Flores, R., Rico-Chávez, O., Navarrete-Macias, I., Zambrana- Torrelio, C., Rostal, M. K., Epstein, J. H., Tipps, T., Liang, E., Sanchez- Leon, M., Sotomayor-Bonilla, J., Aguirre, A. A., Ávila, R., Medellín, R. A., Goldstein, T., Suzán, G., Daszak, P., Lipkin, W.I. (2013). Coronaviruses in bats from Mexico. Journal of General Virology 94, Arguin, P. M., Murray-Lillibridge, K., Miranda, M. E. G., Smith, J. S., Calaor, A. B., Rupprecht, C. E. (2002). Serologic evidence of lyssavirus infections among bats, the Philippines. Emerging Infectious Diseases 8, Badrane, H., Tordo, N. (2001). Host switching in lyssavirus history from the Chiroptera to the Carnivora orders. Journal of Virology 75, Banyard, A. C., Hayman, D., Freuling, C. M., Müller, T., Fooks, A. R., Johnson, N. (2013a). Bat rabies, In: Jackson, A.C. (Ed.) Rabies: Scientific basis of the disease and its management. Academic Press, New York, Banyard, A. C., Hayman, D., Johnson, N., McElhinney, L., Fooks, A. R. (2011). Bats and lyssaviruses, In: Jackson, A. C. (Ed.) Advances in virus research. Elsevier, Amsterdam, Banyard, A. C., Horton, D., Freuling, C. M., Müller, T., Fooks, A. R. (2013b). Control and prevention of canine rabies: the need for building laboratorybased surveillance capacity. Antiviral Research 98,

32 Literaturverzeichnis 27 Bundesamt für Naturschutz (2011). Beschlüsse der 5. und 6. EUROBATS- Vertragsstaatenkonferenzen und Berichte zum Fledermausschutz in Deutschland , In: Fledermausschutz in Europa; 2, Bonn, 418 S. Blanton, J. D., Dyer, J., McBrayer, J., Rupprecht, C. E. (2012). Rabies surveillance in the United States during Journal of the American Veterinary Medical Association 241, Botvinkin, A. D., Poleschuk, E. M., Kuzmin, I., Borisova, T. I., Gazaryan, S. V., Yager, P., Rupprecht, C. E. (2003). Novel lyssaviruses isolated from bats in Russia. Emerging Infectious Diseases 9, Boulger, L. R., Porterfield, J. S. (1958). Isolation of a virus from nigerian fruit bats. Transactions of the Royal Society of Tropical Medicine and Hygiene 52, Boyles, J. G., Cryan, P. M., McCracken, G. F., Kunz, T. H. (2011). Conservation. Economic importance of bats in agriculture. Science 332, Brookes, S. M., Parsons, G., Johnson, N., McElhinney, L. M., Fooks, A. R. (2005). Rabies human diploid cell vaccine elicits cross-neutralising and crossprotecting immune responses against European and Australian bat lyssaviruses. Vaccine 23, Calisher, C. H., Child, J. E., Field, H., Holmes, K. V., Schountz, T. (2006). Bats: important reservoir hosts of emerging viruses. Clinical Microbiology Reviews 19, Carini, A. (1911). Sur une grande épizootie de rage. Annals of the Institute Pasteur (Paris) 25, Ceballos, N. A., Moron, S. V., Berciano, J. M., Nicolas, O., Lopez, C. A., Juste, J., Nevado, C. R., Setien, A. A., Echevarria, J. E. (2013). Novel lyssavirus in bat, Spain. Emerging Infectious Diseases 19, Clayton, B. A., Wang, L. F., Marsh, G. A. (2013). Henipaviruses: an updated review focusing on the pteropid reservoir and features of transmission. Zoonoses and Public Health 60, Cliquet, F., Freuling, C. M., Smreczak, M., Poel, W., Horton, D., Fooks, A., Robardet, E., Picard-Meyer, E., Müller, T. (2010). Development of harmonised schemes for monitoring and reporting of rabies in animals in the European Union [Stand: ]. Verfügbar unter:

33 Literaturverzeichnis 28 [abgerufen am ]. Dacheux, L., Larrous, F., Mailles, A., Boisseleau, D., Delmas, O., Biron, C., Bourchier, C., Ilari, F., Lefranc, T., Raffi, F., Goudal, M., Bourhy, H. (2009). European bat lyssavirus transmission among cats, Europe. Emerging Infectious Diseases 15, Daoust, P. Y., Wandeler, A. I., Casey, G. A. (1996). Cluster of rabies cases of probable bat origin among red foxes in Prince Edward Island, Canada. Journal of Wildlife Diseases 32, Davis, P. L., Holmes, E. C., Larrous, F., van der Poel, W. H., Tjornehoj, K., Alonso, W., Bourhy, H. (2005). Phylogeography, population dynamics, and molecular evoluation of European bat lyssaviruses. Journal of Virology 79, Dean, D. J., Abelseth, M. K., Athanasiu, P. (1996). The fluorescence antibody test In: Meslin, F. X.,Kaplan, M. M., Koprowski, H. (Eds.) Laboratory techniques in rabies. World Health Organization, Geneva, Dietz, C., Helversen, O. von, Nill, D. (2007). Handbuch der Fledermäuse Europas und Nordwestafrikas. Biologie, Kennzeichen, Gefährdung. Kosmos, Stuttgart, 399 S. Dietzgen, R. G., Calisher, C. H., Kurath, G., Kuzmin, I. V., Rodriguez, L. L., Stone, D. M. (2012). Family Rhabdoviridae, In: King, A. M. Q., Adams, M. J., Carstens, E. B., Lefkowitz, E. J. (Eds.) Virus taxonomy: classification and nomenclature of viruses - Ninth report of the International Committee on Taxonomy of Viruses. Elsevier, San Diego, Drexler, J. F., Corman, V. M., Drosten, C. (2014). Ecology, evolution and classification of bat coronaviruses in the aftermath of SARS. Antiviral Research 101, Drexler, J. F., Corman, V. M., Müller, M. A., Maganga, G. D., Vallo, P., Binger, T., Gloza-Rausch, F., Rasche, A., Yordanov, S., Seebens, A., Oppong, S., Adu Sarkodie, Y., Pongombo, C., Lukashev, A. N., Schmidt-Chanasit, J., Stocker, A., Carneiro, A. J., Erbar, S., Maisner, A., Fronhoffs, F., Buettner, R., Kalko, E. K., Kruppa, T., Franke, C. R., Kallies, R., Yandoko, E. R., Herrler, G., Reusken, C., Hassanin, A., Kruger, D. H., Matthee, S., Ulrich,

34 Literaturverzeichnis 29 R. G., Leroy, E. M., Drosten, C. (2012). Bats host major mammalian paramyxoviruses. Nature Communications 3, 796. Dzikwi, A. A., Kuzmin, I. I., Umoh, J. U., Kwaga, J. K., Ahmad, A. A., Rupprecht, C. E. (2010). Evidence of Lagos bat virus circulation among Nigerian fruit bats. Journal of Wildlife Diseases 46, EUROBATS (2006). 5th Session of the Meeting of Parties, Resolution 5.2: Bats and Rabies in Europe [Stand: ]. Verfügbar unter: s/mop5_record_annex5_res5_2_bat_rabies.pdf [abgerufen am ]. EUROBATS (2013). Bat species occurring in the range of the Agreement on the Conservation of Populations of European Bats [Stand: ]. Verfügbar unter: ecion%28after_mop6%29.pdf [abgerufen am ]. Field, H., Young, P., Yob, J. M., Mills, J., Hall, L., Mackenzie, J. (2001). The natural history of Hendra and Nipah viruses. Microbes and Infection 3, Field, H. E. (2009). Bats and emerging zoonoses: Henipaviruses and SARS. Zoonoses Public Health 56, Fleming, T. H., Eby, P. (2003). Ecology of bat migration, In: Kunz, T. H., Fenton, M. B. (Eds.) Bat ecology. University of Chicago Press, Chicago [u. a.], Fooks, A. R., Brookes, S. M., Johnson, N., McElhinney, L. M., Hutson, A. M. (2003a). European bat lyssaviruses: an emerging zoonosis. Epidemiology and Infection 131, Fooks, A. R., McElhinney, L. M., Pounder, D. J., Finnegan, C. J., Mansfield, K., Johnson, N., Brookes, S. M., Parsons, G., White, K., McIntyre, P. G., Nathwani, D. (2003b). Case report: isolation of a European bat lyssavirus type 2a from a fatal human case of rabies encephalitis. Journal of Medical Virology 71, Fraser, G. C., Hooper, P. T., Lunt, R. A., Gould, A. R., Gleeson, L. J., Hyatt, A. D., Russell, G. M., Kattenbelt, J. A. (1996). Encephalitis caused by a lyssavirus in fruit bats in Australia. Emerging Infectious Diseases 2,

35 Literaturverzeichnis 30 Freuling, C. M., Vos, A., Johnson, N., Kaipf, I., Denzinger, A., Neubert, L., Mansfield, K., Hicks, D., Nunez, A., Tordo, N., Rupprecht, C., Fooks, A., Müller, T. (2009). Experimental infection of Serotine bats (Eptesicus serotinus) with European bat lyssavirus type 1a. Journal of General Virology 90, Freuling, C. M., Abendroth, B., Beer, M., Fischer, M., Hanke, D., Hoffmann, B., Höper, D., Just, F., Mettenleiter, T. C., Schatz, J., Müller, T. (2013). Molecular diagnostics for the detection of Bokeloh bat lyssavirus in a bat from Bavaria, Germany. Virus Research 177, Freuling, C. M., Beer, M., Conraths, F. J., Finke, S., Hoffmann, B., Keller, B., Kliemt, J., Mettenleiter, T. C., Mühlbach, E., Teifke, J. P., Wohlsein, P., Müller, T. (2011). Novel lyssavirus in Natterer's Bat, Germany. Emerging Infectious Diseases 17, Gattermann, R., Fritzsche, P., Neumann, K., Tschuch, G., Weinandy, R., Weinert, D. (2006). Wörterbuch zur Verhaltensbiologie der Tiere und des Menschen, 2., völlig neu bearbeitete Auflage. Edition. Spektrum Akademischer Verlag, München, 410 S. Gilbert, A. T., Petersen, B. W., Recuenco, S., Niezgoda, M., Gomez, J., Laguna- Torres, V. A., Rupprecht, C. (2012). Evidence of Rabies virus exposure among humans in the Peruvian Amazon. American Journal of Tropical Medicine and Hygiene 87, Gould, A. R., Hyatt, A. D., Lunt, R., Kattenbelt, J. A., Hengstberger, S., Blacksell, S. D. (1998). Characterisation of a novel lyssavirus isolated from Pteropid bats in Australia. Virus Research 54, Guyatt, K. J., Twin, J., Davis, P., Holmes, E. C., Smith, G. A., Smith, I. L., Mackenzie, J. S., Young, P. L. (2003). A molecular epidemiological study of Australian bat lyssavirus. Journal of General Virology 84, Haagmans, B. L., Al Dhahiry, S. H., Reusken, C. B., Raj, V. S., Galiano, M., Myers, R., Godeke, G. J., Jonges, M., Farag, E., Diab, A., Ghobashy, H., Alhajri, F., Al-Thani, M., Al-Marri, S. A., Al Romaihi, H. E., Al Khal, A., Bermingham, A., Osterhaus, A. D., Alhajri, M. M., Koopmans, M. P. (2014). Middle East respiratory syndrome coronavirus in dromedary camels: an outbreak investigation. The Lancet Infectious Diseases 14,

36 Literaturverzeichnis 31 Hanlon, C., Childs, J. E. (2013). Epidemiology, In: Jackson, A. C. (Ed.) Rabies: Scientific basis of the disease and its management. Academic Press, New York, 95. Hanlon, C. A., Kuzmin, I. V., Blanton, J. D., Weldon, W. C., Manangan, J. S., Rupprecht, C. E. (2005). Efficacy of rabies biologics against new lyssaviruses from Eurasia. Virus Research 111, Heaton, P. R., Johnstone, P., McElhinney, L. M., Cowley, R., O'Sullivan, E., Whitby, J. E. (1997). Heminested PCR assay for detection of six genotypes of rabies and rabies-related viruses. Journal of Clinical Microbiology 35, Hooper, P. T., Lunt, R. A., Gould, A. R., Samaratunga, H., Hyatt, A. D., Gleeson, L. J., Rodwell, B. J., Rupprecht, C. E., Smith, J. S., Murray, P. K. (1997). A new lyssavirus - the first endemic rabies-related virus recognized in Australia. Bulletin de l Institut Pasteur 95, Horton, D. L., Banyard, A., Marston, D. A., Wise, E., Selden, D., Nunez, A., Hicks, D., Lembo, T., Cleaveland, S., Peel, A.J., Kuzmin, I. V., Rupprecht, C. E., Fooks, A. R. (2014). Antigenic and genetic characterisation of a divergent African virus, Ikoma lyssavirus. Journal of General Virology, DOI: /vir Hutcheon, J. M., Kirsch, J. A. W. (2006). A moveable face: deconstructing the Microchiroptera and a new classification of extant bats. Acta Chiropterologica 8, Hutson, T., Suyanto, A., Helgen, K., McKenzie, N., Hall, L. (2008a). Miniopterus schreibersii [Stand: ]. Verfügbar unter: [abgerufen am ]. Hutson, T., Suyanto, A., Helgen, K., McKenzie, N., Hall, L. (2008b). Pteropus alecto [Stand: ]. Verfügbar unter: [abgerufen am ]. Hutterer, R., Ivanova, T., Meyer-Cords, C., Rodrigues, L. (2005). Bat migrations in Europe: a review of banding data and literature. Naturschutz und Biologische Vielfalt 28, International Committee on Taxonomy of Viruses (2013). Virus taxonomy [Stand: Juli 2013]. Verfügbar unter: [abgerufen am ].

37 Literaturverzeichnis 32 International Union for Conservation of Nature (2011). Swooping out of sight: Bats in need of greater protection [Stand: ]. Verfügbar unter: [abgerufen am ]. International Union for Conservation of Nature (2013). Jackson, A. C. (2003). Rabies virus infection: an update. Journal of Neurovirology 9, Jakava-Viljanen, M., Lilley, T., Kyheroinen, E. M., Huovilainen, A. (2010). First encounter of European bat lyssavirus type 2 (EBLV-2) in a bat in Finland. Epidemiology and Infection 138, Johnson, N., Phillpotts, R., Fooks, A. R. (2006). Airborne transmission of lyssaviruses. Journal of Medical Microbiology 55, Johnson, N., Vos, A., Freuling, C. M., Tordo, N., Fooks, A. R., Müller, T. (2010). Human rabies due to lyssavirus infection of bat origin. Veterinary Microbiology 142, Johnson, N., Vos, A., Neubert, L., Freuling, C. M., Mansfield, K., Kaipf, I., Denzinger, A., Hicks, D., Nunez, A., Franka, R., Rupprecht, C., Müller, T., Fooks, A. (2008). Experimental study of European bat lyssavirus type 2 infection in Daubenton's bats (Myotis daubentonii). Journal of General Virology 89, Kawai, K., Nikaido, M., Harada, M., Matsumura, S., Lin, L. K., Wu, Y., Hasegawa, M., Okada, N. (2003). The status of the Japanese and East Asian bats of the genus Myotis (Vespertilionidae) based on mitochondrial sequences. Molecular Phylogenetics and Evolution 28, Kgaladi, J., Wright, N., Coertse, J., Markotter, W., Marston, D., Fooks, A. R., Freuling, C. M., Müller, T. F., Sabeta, C. T., Nel, L. H. (2013). Diversity and epidemiology of Mokola virus. PLoS Neglected Tropical Diseases 7, e2511. King, A. A., Fooks, A. R., Aubert, M., Wandeler, A.I. (2004). Historical perspective of rabies in Europe and the Mediterranean Basin. OIE, Paris, 361 p. Ksiazek, T. G., Erdman, D., Goldsmith, C. S., Zaki, S. R., Peret, T., Emery, S., Tong, S. X., Urbani, C., Comer, J. A., Lim, W., Rollin, P. E., Dowell, S. F., Ling, A. E., Humphrey, C. D., Shieh, W. J., Guarner, J., Paddock, C. D., Rota, P., Fields, B., DeRisi, J., Yang, J. Y., Cox, N., Hughes, J. M., LeDuc, J. W., Bellini, W. J., Anderson, L. J., Grp, S.W. (2003). A novel coronavirus

38 Literaturverzeichnis 33 associated with severe acute respiratory syndrome. New England Journal of Medicine 348, Kulzer, E., Fischer, M. S., Köhncke, M., Kükenthal, W., Beier, M. (2005). Chiroptera; Vol. 3: Biologie. In Handbuch der Zoologie = Handbook of zoology / eine Naturgeschichte der Stämme des Tierreiches; Bd. 8 (Berlin, de Gruyter), VI, 250 S. Kunz, T. H., Braun de Torrez, E., Bauer, D., Lobova, T., Fleming, T. H. (2011). Ecosystem services provided by bats. Annals of the New York Academy of Sciences 1223, Kunz, T. H., Racey, P. A. (1998). Bat biology and conservation. Smithsonian Institution Press, Washington, 365 p. Kurth, A., Kohl, C., Brinkmann, A., Ebinger, A., Harper, J. A., Wang, L. F., Mühldorfer, K., Wibbelt, G. (2012). Novel paramyxoviruses in free-ranging European bats. PLoS ONE 7, e Kuzmin, I. V., Botvinkin, A. D., Rybin, S. N., Bayaliev, A. B. (1992). A lyssavirus with an unusual antigenic structure isolated from a bat in Southern Kyrghyzstan. Voprosy Virusologii 37, Kuzmin, I. V., Bozick, B., Guagliardo, S. A., Kunkel, R., Shak, J. R., Tong, S., Rupprecht, C. E. (2011). Bats, emerging infectious diseases, and the rabies paradigm revisited. Emerging Health Threats Journal 4, Kuzmin, I. V., Hughes, G. J., Botvinkin, A. D., Orciari, L. A., Rupprecht, C. E. (2005). Phylogenetic relationships of Irkut and West Caucasian bat viruses within the Lyssavirus genus and suggested quantitative criteria based on the N gene sequence for lyssavirus genotype definition. Virus Research 111, Kuzmin, I. V., Mayer, A. E., Niezgoda, M., Markotter, W., Agwanda, B., Breiman, R. F., Rupprecht, C. E. (2010). Shimoni bat virus, a new representative of the Lyssavirus genus. Virus Research 149, Kuzmin, I. V., Niezgoda, M., Franka, R., Agwanda, B., Markotter, W., Beagley, J. C., Urazova, O. Y., Breiman, R. F., Rupprecht, C. E. (2008a). Lagos bat virus in Kenya. Journal of Clinical Microbiology 46, Kuzmin, I. V., Niezgoda, M., Franka, R., Agwanda, B., Markotter, W., Beagley, J. C., Urazova, O. Y., Breiman, R. F., Rupprecht, C. E. (2008b). Possible

39 Literaturverzeichnis 34 emergence of West Caucasian bat virus in Africa. Emerging Infectious Diseases 14, Kuzmin, I. V., Orciari, L. A., Arai, Y. T., Smith, J. S., Hanlon, C. A., Kameoka, Y., Rupprecht, C. E. (2003). Bat lyssaviruses (Aravan and Khujand) from Central Asia: phylogenetic relationships according to N, P and G gene sequences. Virus Research 97, Kuzmin, I. V., Rupprecht, C.E. (2007). Bat rabies, In: Jackson, A. C., Wunner, W. (Eds.) Rabies. Academic Press, New York, Kuzmin, I. V., Shi, M., Orciari, L. A., Yager, P. A., Velasco-Villa, A., Kuzmina, N. A., Streicker, D. G., Bergman, D. L., Rupprecht, C. E. (2012). Molecular inferences suggest multiple host shifts of rabies viruses from bats to mesocarnivores in Arizona during PLoS Pathogens 8, e Leonova, G. N., Belikov, S. I., Kondratov, I. G., Krylova, N. V., Pavlenko, E. V., Romanova, E. V., Chentsova, I. V., Petukhova, S. A. (2009). A fatal case of bat lyssavirus infection in Primorye Territory of the Russian Far East. Rabies-Bulletin-Europe 33, 5-8. Leroy, E. M., Kumulungui, B., Pourrut, X., Rouquet, P., Hassanin, A., Yaba, P., Delicat, A., Paweska, J. T., Gonzalez, J. P., Swanepoel, R. (2005). Fruit bats as reservoirs of Ebola virus. Nature 438, Leslie, M. J., Messenger, S., Rohde, R. E., Smith, J., Cheshier, R., Hanlon, C., Rupprecht, C. E. (2006). Bat-associated Rabies virus in skunks. Emerging Infectious Diseases 12, Li, W., Shi, Z., Yu, M., Ren, W., Smith, C., Epstein, J. H., Wang, H., Crameri, G., Hu, Z., Zhang, H., Zhang, J., McEachern, J., Field, H., Daszak, P., Eaton, B. T., Zhang, S., Wang, L. F. (2005). Bats are natural reservoirs of SARSlike coronaviruses. Science 310, Lindhe Norberg, U. M., Fischer, M. S., Köhncke, M., Kükenthal, W., Beier, M. (2002). Chiroptera; Vol. 2: The flight of bats. In Handbuch der Zoologie = Handbook of zoology / eine Naturgeschichte der Stämme des Tierreiches ; Bd. 8 (Berlin, de Gruyter), 137 S. Liu, Y., Chen, Q., Zhang, F., Zhang, S., Li, N., Lian, H., Wang, Y., Zhang, J., Hu, R. (2013a). Evaluation of rabies biologics against Irkut virus isolated in China. Journal of Clinical Microbiology 51,

40 Literaturverzeichnis 35 Liu, Y., Zhang, S. F., Zhao, J. H., Zhang, F., Hu, R. L. (2013b). Isolation of Irkut virus from a Murina leucogaster Bat in China. PLoS Neglected Tropical Diseases 7, e2097. Luis, A. D., Hayman, D. T. S., O'Shea, T. J., Cryan, P. M., Gilbert, A. T., Pulliam, J. R. C., Mills, J. N., Timonin, M. E., Willis, C. K. R., Cunningham, A. A., Fooks, A. R., Rupprecht, C. E., Wood, J. L. N., Webb, C. T. (2013). A comparison of bats and rodents as reservoirs of zoonotic viruses: are bats special? Proceedings of the Royal Society B: Biological Sciences 280, Lumio, J., Hillbom, M., Roine, R., Ketonen, L., Haltia, M., Valle, M., Neuvonen, E., Lähdewirta, J. (1986). Human rabies of bat origin in Europe. The Lancet 327, 378. Malerczyk, C., Selhorst, T., Tordo, N., Moore, S. A., Müller, T. (2009). Antibodies induced by vaccination with purified chick embryo cell culture vaccine (PCECV) cross-neutralize non-classical bat lyssavirus strains. Vaccine 27, Markotter, W., Kuzmin, I., Rupprecht, C. E., Randles, J., Sabeta, C. T., Wandeler, A. I., Nel, L. H. (2006). Isolation of Lagos bat virus from water mongoose. Emerging Infectious Diseases 12, Marston, D. A., Horton, D. L., Ngeleja, C., Hampson, K., McElhinney, L. M., Banyard, A. C., Haydon, D., Cleaveland, S., Rupprecht, C. E., Bigambo, M., Fooks, A. R., Lembo, T. (2012). Ikoma lyssavirus, Highly divergent novel lyssavirus in an African Civet. Emerging Infectious Diseases 18, McElhinney, L. M., Marston, D. A., Leech, S., Freuling, C. M., van der Poel, W. H., Echevarria, J., Vazquez-Moron, S., Horton, D. L., Müller, T., Fooks, A. R. (2013). Molecular epidemiology of bat lyssaviruses in Europe. Zoonoses and Public Health 60, Med Vet Net Working Group (2005). Passive and active surveillance of bat lyssavirus infections. Rabies-Bulletin-Europe 29, 5. Megali, A., Yannic, G., Zahno, M. L., Brugger, D., Bertoni, G., Christe, P., Zanoni, R. (2010). Surveillance for European bat lyssavirus in Swiss bats. Archives of Virology 155, Memish, Z. A., Mishra, N., Olival, K. J., Fagbo, S. F., Kapoor, V., Epstein, J. H., Alhakeem, R., Durosinloun, A., Al Asmari, M., Islam, A., Kapoor, A., Briese,

41 Literaturverzeichnis 36 T., Daszak, P., Al Rabeeah, A. A., Lipkin, W. I. (2013). Middle East respiratory syndrome coronavirus in bats, Saudi Arabia. Emerging Infectious Diseases 19, Meredith, C. D., Prossouw, A. P., Koch, H. P. (1971). An unusual case of human rabies thought to be of chiropteran origin. South African Medical Journal 45, Messenger, S. L., Smith, J. S., Rupprecht, C. E. (2002). Emerging epidemiology of bat-associated cryptic cases of rabies in humans in the United States. Clinical Infectious Diseases 35, Mickleburgh, S. P., Hutson, A. M., Racey, P. A. (2002). A review of the global conservation status of bats. Oryx 36, Mildenstein, T., Jong, C. D. (2011). Natural history, ecological and socio-economic value of bats, In: Newman, S. H.,Field, H. E.,Jong, C. E., de, Epstein, J. H. (Eds.). Investigating the role of bats in emerging zoonoses. Balancing ecology, conservation and public health interest. Food and Agriculture Organization of the United Nations, Rome, Mohr, W. (1957). Die Tollwut. Medizinische Klinik 52, Monadjem, A., Goodman, S. M., Stanley, W. T., Appleton, B. (2013). A cryptic new species of Miniopterus from south-eastern Africa based on molecular and morphological characters. Zootaxa 3746, Müller, T., Cox, J., Peter, W., Schäfer, R., Johnson, N., McElhinney, L. M., Geue, J. L., Tjornehoj, K., Fooks, A. R. (2004). Spill-over of European bat lyssavirus type 1 into a stone marten (Martes foina) in Germany. Journal of Veterinary Medicine Series B 51, Müller, T., Johnson, N., Freuling, C. M., Fooks, A. R., Selhorst, T., Vos, A. (2007). Epidemiology of bat rabies in Germany. Archives of Virology 152, Murray, K., Rogers, R., Selvey, L., Selleck, P., Hyatt, A., Gould, A., Gleeson, L., Hooper, P., Westbury, H. (1995). A novel morbillivirus pneumonia of horses and its transmission to humans. Emerging Infectious Diseases 1, Murray, S. W., Campbell, P., Kingston, T., Zubaid, A., Francis, C. M., Kunz, T. H. (2012). Molecular phylogeny of hipposiderid bats from Southeast Asia and evidence of cryptic diversity. Molecular Phylogenetics and Evolution 62,

42 Literaturverzeichnis 37 National Center for Biotechnology Information (2014). The Nucleotide database [Stand: ]. Verfügbar unter: [abgerufen am ]. Naturschutzbund Deutschland (2014). Die heimischen Fledermäuse [Stand: 2014]. Verfügbar unter: [abgerufen am ]. Negredo, A., Palacios, G., Vázquez-Morón, S., González, F., Dopazo, H., Molero, F., Juste, J., Quetglas, J., Savji, N., Cruz Martínez, Maria de la, Herrera, J. E., Pizarro, M., Hutchison, S. K., Echevarría, J. E., Lipkin, W. I., Tenorio, A. (2011). Discovery of an Ebolavirus-like filovirus in Europe. PLoS Pathogens 7, e Niethammer, J., Krapp, F. (2011). Die Fledermäuse Europas. Ein umfassendes Handbuch zur Biologie, Verbreitung und Bestimmung, Erw. Sonderausgabe aus dem Handbuch der Säugetiere Europas, 1. Auflage. Edition. AULA- Verlag, Wiebelsheim, 1202 S. Patyk, K., Turmelle, A., Blanton, J. D., Rupprecht, C. E. (2012). Trends in national surveillance data for bat rabies in the United States: Vector Borne and Zoonotic Diseases 12, Pavri, K. M., Singh, K. R., Hollinger, F. B. (1971). Isolation of a new parainfluenza virus from a frugivorous bat, Rousettus leschenaulti, collected at Poona, India. American Journal of Tropical Medicine and Hygiene 20, Pawan, J. L. (1936). The transmission of paralytic rabies in Trinidad by the vampire bat (Desmodus rotunduns murinus Wagner, 1840). Annals of Tropical Medicine and Parasitology 30, Paweska, J. T., Blumberg, L. H., Liebenberg, C., Hewlett, R. H., Grobbelaar, A. A., Leman, P. A., Croft, J. E., Nel, L. H., Nutt, L., Swanepoel, R. (2006). Fatal human infection with rabies-related Duvenhage virus, South Africa. Emerging Infectious Diseases 12, Picard-Meyer, E., Barrat, J., Tissot, E., Barrat, M. J., Bruyere, V., Cliquet, F. (2004). Genetic analysis of European bat lyssavirus type 1 isolates from France. Veterinary Record 154,

43 Literaturverzeichnis 38 Picard-Meyer, E., Servat, A., Robardet, E., Moinet, M., Borel, C., Cliquet, F. (2013). Isolation of Bokeloh bat lyssavirus in Myotis nattereri in France. Archives of Virology 158, Poel, W. H. M. v. d., Lina, P. H., Kramps, J. A. (2006). Public health awareness of emerging zoonotic viruses of bats: a European perspective. Vector Borne and Zoonotic Diseases 6, Poel, W. H. M. v. d., Van der Heide, R., Verstraten, E. R. A. M., Takumi, K., Lina, P. H. C., Kramps, J. A. (2005). European bat lyssaviruses, the Netherlands. Emerging Infectious Diseases 11, Queensland Government (2014). Australian bat lyssavirus [Stand: ]. Verfügbar unter: [abgerufen am ]. Rabies-Bulletin-Europe (2013). Rabies surveillance [Stand: 2013]. Verfügbar unter: [abgerufen am ]. Ronsholt, L. (2002). A new case of European bat lyssavirus (EBL) infection in Danish sheep. Rabies-Bulletin-Europe 26, 15. Ronsholt, L., Sorensen, K. J., Bruschke, C. J., Wellenberg, G. J., van Oirschot, J. T., Johnstone, P., Whitby, J. E., Bourhy, H. (1998). Clinically silent rabies infection in (zoo) bats. Veterinary Record 142, Sabeta, C., Phahladira, B. (2013). Mokola virus (MOKV) in southern Africa: a review of genetic, epidemiologic and surveillance studies. iconcept Press. Scatterday, J. E. (1954). Bat rabies in Florida. Journal of the American Veterinary Medical Association 124, Schatz, J., Fooks, A. R., McElhinney, L., Horton, D., Echevarria, J., Vazquez- Moron, S., Kooi, E. A., Rasmussen, T. B., Müller, T., Freuling, C. M. (2013a). Bat rabies surveillance in Europe. Zoonoses and Public Health 60, Schatz, J., Ohlendorf, B., Busse, P., Pelz, G., Dolch, D., Teubner, J., Encarnacao, J. A., Mühle, R.-U., Fischer, M., Hoffmann, B., Kwasnitschka, L., Balkema- Buschmann, A., Mettenleiter, T. C., Müller, T., Freuling, C. M. (2013b). Twenty years of active bat rabies surveillance in Germany: a detailed

44 Literaturverzeichnis 39 analysis and future perspectives. Epidemiology and Infection 142, Schnell, M. J., McGettigan, J., Wirblich, C., Papaneri, A. (2010). The cell biology of Rabies virus: using stealth to reach the brain. Nature Reviews. Microbiology 8, Scottish Natural Heritage (2009). Scottish Natural Heritage releases latest bat lyssavirus monitoring results [Stand: ]. Verfügbar unter: [abgerufen am ]. Shirato, K., Maeda, K., Tsuda, S., Suzuki, K., Watanabe, S., Shimoda, H., Ueda, N., Iha, K., Taniguchi, S., Kyuwa, S., Endoh, D., Matsuyama, S., Kurane, I., Saijo, M., Morikawa, S., Yoshikawa, Y., Akashi, H., Mizutani, T. (2012). Detection of bat coronaviruses from Miniopterus fuliginosus in Japan. Virus Genes 44, Shope, R. E., Murphy, F. A., Harrison, A. K., Causey, O. R., Kemp, G. E., Simpson, D. I. H., Moore, D. L. (1970). Two African viruses Serologically and Morphologically Related to Rabies virus. Journal of Virology 6, Simmons, N. B. (2005). Evolution. An Eocene big bang for bats. Science 307, Smith, I., Broos, A., Jong, C. de, Zeddeman, A., Smith, C., Smith, G., Moore, F., Barr, J., Crameri, G., Marsh, G., Tachedjian, M., Yu, M., Kung, Y. H., Wang, L. F., Field, H. (2011). Identifying Hendra virus diversity in pteropid bats. PLoS ONE 6, e Smith, J. S., Yager, P. A., Baer, G. M. (1973). A rapid reproducible test for determining rabies neutralizing antibody. Bulletin of the World Health Organization 48, Smreczak, M., Orłowska, A., Zmudzinski, J. F. (2009). First case of the European bat lyssavirus type 1b in bats (Eptesicus serotinus) in Poland in retrospective study. Bulletin of the Veterinary Institute in Pulawy 53, Speakman, J. R., Thomas, D. W. (2003). Physiological ecology and energetics of bats, In: Kunz, T. H., Fenton, M. B. (Eds.) Bat ecology. University of Chicago Press, Chicago [u. a.],

45 Literaturverzeichnis 40 Springer, M. S., Teeling, E. C., Madsen, O., Stanhope, M. J., Jong, W. W. de (2001). Integrated fossil and molecular data reconstruct bat echolocation. Proceedings of the National Academy of Sciences of the United States of America 98, Streicker, D., Turmelle, A. S., Vonhof, M. J., Kuzmin, I., McCracken, G. F., Rupprecht, C. E. (2010). Host phylogeny constrains Cross-Species emergence and establishment of Rabies virus in bats. Science 329, Teeling, E. C., Springer, M. S., Madsen, O., Bates, P., O'Brien, S. J., Murphy, W. J. (2005). A molecular phylogeny for bats illuminates biogeography and the fossil record. Science 307, Thiel, P. P. van, Hoek, J. A. van der, Eftiov, F., Tepaske, R., Zaarijer, H. J., Spanjaard, L., Boer, H. E. de, Doornum, G. J. van, Schuten, M., Osterhaus, A. D., Kager, P. A. (2008). Fatal case of human rabies (Duvenhage virus) from a bat in Kenya: The Netherlands, December EuroSurveillance 13, pii=8007. Towner, J. S., Amman, B. R., Sealy, T. K., Carroll, S. A. R., Comer, J. A., Kemp, A., Swanepoel, R., Paddock, C. D., Balinandi, S., Khristova, M. L., Formenty, P. B. H., Albarino, C. G., Miller, D. M., Reed, Z. D., Kayiwa, J. T., Mills, J. N., Cannon, D. L., Greer, P. W., Byaruhanga, E., Farnon, E. C., Atimnedi, P., Okware, S., Katongole-Mbidde, E., Downing, R., Tappero, J. W., Zaki, S. R., Ksiazek, T. G., Nichol, S. T., Rollin, P. E. (2009). Isolation of genetically diverse Marburg viruses from Egyptian fruit bats. PLoS Pathogens 5, e Tse, H., Tsang, A. K., Tsoi, H. W., Leung, A. S., Ho, C. C., Lau, S. K., Woo, P. C., Yuen, K. Y. (2012). Identification of a novel bat papillomavirus by metagenomics. PLoS ONE 7, e Vaughan, T. A., Ryan, J. M., Czaplewski, N. J. (2011). Mammalogy, 5. ed. Edition. Jones and Bartlett, Sudbury, Mass. [u. a.], 750 p. Vazquez-Moron, S., Juste, J., Ibanez, C., Berciano, J. M., Echevarria, J. E. (2011). Phylogeny of European bat lyssavirus 1 in Eptesicus isabellinus bats, Spain. Emerging Infectious Diseases 17, Vazquez-Moron, S., Juste, J., Ibanez, C., Ruiz-Villamor, E., Avellon, A., Vera, M., Echevarria, J. E. (2008). Endemic Circulation of European bat lyssavirus

46 Literaturverzeichnis 41 type 1 in Serotine bats, Spain. Emerging Infectious Diseases 14, Waterman, J. A. (1959). The history of the outbreak of paralytic rabies in Trinidad transmitted by bats to human beings and the lower animals from Caribbean Medical Journal 21, 1-6. Webster, W. A., Casey, G. A. (1996). Virus isolation in neuroblastoma cell culture, In: Meslin, F. X.,Kaplan, M. M., Koprowski, H. (Eds.) Laboratory techniques in rabies. World Health Organization, Geneva, World Health Organisation (2013). Rabies [Stand: Juli 2013]. Verfügbar unter: [abgerufen am ]. Wong, S., Lau, S., Woo, P., Yuen, K. Y. (2007). Bats as a continuing source of emerging infections in humans. Reviews in Medical Virology 17, Woo, P. C. Y., Lau, S. K. P., Lam, C. S. F., Lau, C. C. Y., Tsang, A. K. L., Lau, J. H. N., Bai, R., Teng, J. L. L., Tsang, C. C. C., Wang, M., Zheng, B.-J., Chan, K.-H., Yuen, K.-Y. (2012). Discovery of seven novel mammalian and avian coronaviruses in the genus Deltacoronavirus supports bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus. Journal of Virology 86, Wright, E., Hayman, D. T. S., Vaughan, A., Temperton, N. J., Wood, J. L. N., Cunningham, A. A., Suu-Ire, R., Weiss, R. A., Fooks, A. R. (2010). Virus neutralising activity of African fruit bat (Eidolon helvum) sera against emerging lyssaviruses. Virology 408, Wunner, W. H., Conzelmann, K. K. (2013). Rabies virus, In: Jackson, A. C. (Ed.) Rabies: Scientific basis of the disease and its management. Academic Press, New York, Zaki, A. M., van Boheemen, S., Bestebroer, T. M., Osterhaus, A. D. M. E., Fouchier, R. A. M. (2012). Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. New England Journal of Medicine 367,

47 42 3 Abkürzungsverzeichnis ABLV ARAV BBLV DUVV Australian bat lyssavirus Aravan virus Bokeloh bat lyssavirus Duvenhage virus E. Eptesicus EBLV-1 European bat lyssavirus 1 EBLV-2 European bat lyssavirus 2 EFSA G European Food Safety Authority Glykoprotein H. Hipposideros HeV ICTV FAT IKOV IRKV IUCN KHUV L LBV LLEBV M Hendra virus International Committee on Taxonomy of Viruses Fluorescent Antibody Test Ikoma virus Irkut virus International Union for Conservation of Nature Khujand virus RNA-Polymerase Lagos bat virus Lleida bat lyssavirus Matrixprotein M. Myotis Mi. MERS-CoV MOKV N Miniopterus Middle East Respiratory Syndrome-Coronavirus Mokola virus Nukleokapsidprotein N. Nyctalus n Anzahl

48 Abkürzungsverzeichnis 43 NiV P Nipah virus Phosphoprotein P. Pipistrellus Pl. Pt. Plecotus Pteropus R. Rousettus RABV RFFIT Rh. RNA RNP RTCIT RT-PCR RT-qPCR SARS-CoV SHIBV sp. Rabies virus Rapid Fluorescent Focus Inhibition Test Rhinolophus Ribonucleic acid Ribonukleoprotein Rabies Tissue Culture Infection Test Reverse Transcriptase Polymerase Chain Reaction Quantitative real-time RT-PCR Severe Acute Respiratory Syndrome-Coronavirus Shimoni bat lyssavirus Spezies (singular) V. Vespertilio VNA WCBV WHO ct virus-neutralisierende Antikörper West Caucasian bat virus World Health Organization cycle threshold

49 44 4 Zielsetzung In Europa ist das Wissen über fledermausassoziierte Lyssaviren in Hinblick auf die Diversität, Abundanz, geographische Verbreitung, Wirtsspezifität aber auch die Pathogenität und mögliche Übertragungswege lückenhaft. Obwohl international verbindliche Empfehlungen von Med-Vet-Net und EUROBATS zur Überwachung der Fledermaustollwut durch die Untersuchung von moribunden oder toten Tieren (passive Surveillance) und/oder die Beprobung von freilebenden Fledermauspopulationen (aktive Surveillance) existieren, ist aufgrund des strengen Schutzstatus europäischer Fledermäuse sowie der unterschiedlichen Abundanz individueller Fledermausarten eine flächendeckende und systematische Etablierung einer Tollwut-Surveillance ähnlich der der klassischen Tollwut bei Wild- und Haustieren sowohl in Deutschland als auch in anderen europäischen Ländern stark eingeschränkt bzw. durch zusätzliche länderspezifische Regelungen teilweise nicht möglich. Ziel der vorliegenden Arbeit war es daher, durch zielgerichtete epidemiologische und virologische Untersuchungen sowie die Einbeziehung populationsbiologisch relevanter Informationen den derzeitigen Kenntnisstand zum Vorkommen von fledermausassoziierten Lyssavirusinfektionen in Deutschland zu erweitern, um das Risiko einer potentiellen Gesundheitsgefährdung des Menschen besser einschätzen sowie vor dem Hintergrund des Schutzstatus einheimischer Fledermausarten Empfehlungen für eine zukünftige adäquate Surveillance dieser Zoonose geben zu können. Die Untersuchungen stützten sich dabei auf drei Teilprojekte: (i) einer Statuserhebung und Analyse der Fledermaustollwut- Surveillance in Europa, (ii) einer intensivierten (enhanced) passiven Tollwut- Surveillance sowie (iii) einer Pilotstudie zur aktiven Tollwut-Surveillance bei freilebenden Fledermausarten in Deutschland. Darüber hinaus wurde bei natürlich infizierten Fledermäusen die Virusverteilung in einzelnen Organen unter dem Aspekt möglicher Ausscheidungswege untersucht. Molekularbiologische Untersuchungen sowie phylogenetische Analysen zur Ermittlung der genetischen Diversität aller innerhalb der letzten beiden Teilprojekte isolierten Lyssaviren komplettierten die Untersuchungen.

50 Zielsetzung 45 Die Statuserhebung der Fledermaustollwut-Surveillance in Europa erfolgte vor dem Hintergrund geltender internationaler Empfehlungen von Med-Vet-Net und EUROBATS. Anhand offizieller Meldungen sowie zusätzlicher umfangreicher Literaturrecherchen wurden die Anzahl untersuchter und infizierter Tiere sowie die der identifizierten Lyssaviren pro Fledermausspezies im Rahmen der passiven und aktiven Surveillance auf Länderebene ausgewertet und verglichen. Die Ergebnisse wurden zudem im Zusammenhang mit den durchgeführten Methoden diskutiert und durch die Beurteilung der beiden Surveillancesysteme wurde versucht, eine Empfehlung für Länder mit fehlender Fledermaustollwut- Surveillance zu geben. In Deutschland erfolgt die Überwachung der Fledermaustollwut im Rahmen der Routinediagnostik (passive Surveillance). Vorangegangene Studien haben gezeigt, dass aufgrund des selektiven Charakters des Stichprobenumfangs, des unzureichenden Bewusstseins und Wissensstands von Fledermausexperten und der Bevölkerung sowie fehlender oder lückenhafter epidemiologischer Hintergrundinformationen (Speziesidentifizierung eingesandter Fledermäuse, Angaben zu Untersuchungszahlen, Fundort und -zeitpunkt und den detektierten Lyssaviren) epidemiologische Auswertungen als auch fundierte Risikobewertungen zu dieser fledermausassoziierten Zoonose nur begrenzt möglich sind. Der Fokus des zweiten Teilprojektes lag daher auf dem kontinuierlichen Ausbau und der langfristigen Etablierung einer zusätzlich zur Tollwut- Routinediagnostik initiierten, deutschlandweiten, verbesserten, passiven Surveillance, bei der eine retrospektive Testung von Fledermaustotfunden aus regionalen musealen oder privaten Sammlungen erfolgte und eine entsprechende Speziesidentifizierung und phylogenetische Untersuchung von Virusisolaten durchgeführt wurde. Neben der räumlich-zeitlichen Analyse der in diesem Teilprojekt erhobenen Daten aus dem Zeitraum 1998 bis 2013 beinhaltete diese Studie auch einen wissenschaftlichen Vergleich mit Daten und Ergebnissen der Tollwut-Routinediagnostik bei Fledermäusen in Deutschland sowie mit anderen Studien aus Europa. Vor dem Hintergrund internationaler Empfehlungen wurde in Deutschland in Zusammenarbeit mit Fledermaussachverständigen eine umfangreiche Pilotstudie zur aktiven Fledermaustollwut-Surveillance durchgeführt. Im Rahmen der

51 Zielsetzung 46 Beprobung freilebender Fledermäuse erfolgte eine Entnahme von Speichel- und Blutproben aus unterschiedlichen Fledermauskolonien zum Nachweis von Lyssaviren oder lyssavirusspezifischer viraler RNA sowie von virusneutralisierenden Antikörpern. Vor dem Hintergrund widersprüchlicher Ergebnisse internationaler Studien bestand das wissenschaftliche Interesse dieses Teilprojektes in der Beantwortung der Fragen, ob (i) diese Form der Tollwut- Surveillance zusätzliche Informationen zum Vorkommen, zur Prävalenz und zur Dynamik von Fledermaustollwut in einheimischen Fledermauspopulationen liefern kann, (ii) eine flächendeckende Anwendung erlaubt, sowie (iii) grundsätzlich geeignet ist, eine passive Surveillance zu ergänzen bzw. zu ersetzen. Um weitere Erkenntnisse über die Pathogenese und Übertragung von Europäischen Fledermaustollwutviren in ihrem natürlichen Wirt zu erlangen, sollten innerhalb eines weiteren Teilprojektes im Rahmen der Tollwut- Routinediagnostik oder retrospektiven Studie (enhanced passive Surveillance) positiv auf Lyssaviren getestete Fledermäuse in toto analysiert werden. Dazu wurden unterschiedliche Organe entnommen und mit Hilfe von molekularbiologischen (quantitative real-time RT-PCR), virologischen (Virusisolierung in Zellkultur) als auch histopathologischen (Immunhistochemie, Insitu Hybridisierung) Testverfahren untersucht. Die erzielten Ergebnisse dienten der Verifizierung vorangegangener Beobachtungen zur Verteilung europäischer Fledermaustollwutviren in Organen von natürlich infizierten Tieren sowie dem Vergleich zu pathogenetischen Befunden von experimentell infizierten Tieren. Dabei interessierte vor allem die Frage, welche Organe an einer Ausscheidung von Lyssaviren bei diesen Tierarten beteiligt sein könnten. Durch die bessere Einschätzung der Situation der Fledermaustollwut und die davon ausgehenden Gefahren einer Tollwutinfektion beim Menschen, sollen die aus dieser Arbeit gewonnenen Erkenntnisse des Weiteren zum Schutz der einheimischen Fledermausarten beitragen.

52 47 5 Zusammenfassende Darstellung & Diskussion der Ergebnisse (1) Bat Rabies Surveillance in Europe Die Auswertung der Daten aus der europäischen Tollwutdatenbank am Friedrich- Loeffler-Institut (FLI) ergab, dass im Untersuchungszeitraum 1977 bis 2010 europaweit insgesamt 959 Tollwutinfektionen bei Fledermäusen (Antigennachweis bzw. Virusisolierung) an das WHO Rabies-Bulletin-Europe (RBE) gemeldet wurden. Bei der Mehrzahl der gemeldeten Tollwutfälle handelte es sich um Infektionen mit der Lyssavirusspezies EBLV-1. Die häufigsten EBLV-1 Nachweise stammten aus den Niederlanden, Deutschland, Dänemark und Polen, aber auch Regionen in Frankreich und Spanien waren vergleichsweise stärker betroffen als andere europäische Länder. Nachweise von EBLV-2 konnten im gesamten Zeitraum hingegen nur aus dem Vereinigten Königreich, den Niederlanden, Finnland, der Schweiz und Deutschland geführt werden. Während bis 1984 nur zwei Tollwutfälle bei Fledermäusen gemeldet wurden, stieg die Anzahl untersuchter und positiv getesteter Tiere im Jahr 1985 nach der tödlichen Infektion eines Fledermausbiologen in Finnland europaweit deutlich an. Eine Zunahme der Untersuchungszahlen infolge erhöhter Sensibilisierung der öffentlichen Bevölkerung sowie ehrenamtlicher Fledermausschützer bzw. -biologen gegenüber Fledermaustollwut konnte insbesondere im Jahr 2002 im Vereinigten Königreich festgestellt werden, nachdem dort eine weitere EBLV-2 Infektion beim Menschen diagnostiziert wurde. Besonders in den Jahren 2006 bis 2010 stellte sich bei der Surveillance der Fledermaustollwut ein sehr heterogenes Bild dar. In diesem Zeitraum lagen Meldungen von Fledermaustollwutfällen an das RBE für nur 29 von 46 europäischen Ländern vor. Während vermutlich für einige Länder mit etablierter Surveillance lediglich die Datenübermittlung fehlte, muss angenommen werden, dass in Ländern, in denen bislang keine Anzeichen für das Vorkommen dieser Lyssavirusinfektionen vorliegen, entweder keine oder nur eine sporadische Überwachung der Fledermaustollwut durchgeführt wird. Zudem lagen extreme Schwankungen bei der Anzahl untersuchter Tiere auf Länderebene vor. Im Gegensatz zu Ländern wie Frankreich, Österreich, Slowenien, Deutschland und dem Vereinigten Königreich mit Stichprobengrößen zwischen mehreren hundert

53 Zusammenfassende Darstellung & Diskussion der Ergebnisse 48 bzw. tausend untersuchter Fledermäuse, wurden beispielsweise in Bulgarien, Griechenland und der Türkei nur einzelne Tiere getestet. Diese Daten zeigen deutlich, dass trotz internationaler Empfehlungen (Med-Vet-Net, EUROBATS, EFSA) die Tollwutüberwachung bei Fledermäusen auf europäischer Ebene uneinheitlich durchgeführt wird. Diese Unterschiede sind unter anderem die Folge (i) fehlender Zusammenarbeit zwischen Fledermausbiologen und Veterinär- sowie humanmedizinischen Behörden, (ii) fehlender Netzwerke von Fledermaussachverständigen, (iii) länderspezifischer Regelungen hinsichtlich der musealen Auswertung von Fledermausfunden, die eine routinemäßige Tollwutuntersuchung von Fledermäusen erschweren sowie (iv) fehlenden Bewusstseins, Kenntnisstandes sowie fehlender Sensibilisierung für die Fledermaustollwut in der Bevölkerung. Lyssaviren sind bei Fledermäusen mit bestimmten Reservoirspezies assoziiert. Als großes Manko bei Meldungen an das RBE erwies sich, dass im Gegensatz zu anderen Säugetieren bisher keine detaillierten Informationen zur Speziesidentifizierung von Fledermäusen in Bezug auf die Anzahl untersuchter und Tollwut-positiv getesteter Tiere abgefragt werden, die für eine epidemiologische Auswertung jedoch zwingend notwendig sind. Dies ist auf Ansätze der Surveillance der sylvatischen Tollwut in Europa zurückzuführen. Retrospektive Erhebungen zu dieser Problematik anhand eines Fragebogens zeigten, dass trotz geringer Resonanz (insgesamt nur 11 Rückmeldungen) in nur sechs europäischen Ländern eine nicht vollständige Speziesidentifizierung von Fledermäusen mittels morphologischer oder genetischer Merkmale erfolgt. In den meisten Fällen werden nur Tollwut-positive Tiere spezifiziert. Ein Abgleich von Informationen der europäischen Tollwutdatenbank (RBE) mit der internationalen Literatur ergab, dass nur wenige detaillierte Studien zur passiven und aktiven Fledermaustollwut-Surveillance in Europa publiziert wurden und teilweise keine Datenkongruenz bei passiven Surveillance-Studien vorliegt. Auf Grundlage publizierter Daten ( ) zur passiven Surveillance wurden mit Hilfe des Fluorescent Antibody Tests (FAT) und anschließender Viruscharakterisierung EBLV-1-Infektionen bei E. serotinus (n=287) und EBLV-2- Infektionen bei M. daubentonii (n=14) und M. dasycneme (n=5) festgestellt. Die Isolierung von bisher unbekannten Lyssaviren gelang bei jeweils einem Vertreter der Art Mi. schreibersii (WCBV) und M. nattereri (BBLV). Einzelne EBLV-1-Isolate

54 Zusammenfassende Darstellung & Diskussion der Ergebnisse 49 stammen auch aus Vertretern der Arten N. noctula, P. nathusii, P. pipistrellus, Rh, ferrumequinum und V. murinus. Zudem wurde EBLV-1-spezifische RNA in Gehirnproben von M. myotis, Pl. austriacus, Mi. schreibersii und M. nattereri detektiert, wobei die letzten beiden Spezies eher mit WCBV und BBLV assoziiert zu sein scheinen. Normalerweise werden derartige Befunde nicht an das RBE gemeldet. Interessanterweise wurden den Studien zufolge einige der 52 europäischen Fledertierarten noch nie auf Tollwut hin untersucht, so dass ihre Rolle bei der Epidemiologie von Lyssaviren unklar bleibt. Um möglichst alle Arten zu erfassen, wird daher eine Speziesidentifizierung auf Grundlage von morphologischen Merkmalen oder molekularbiologischen Methoden als dringend notwendig erachtet. Nach Literaturangaben wurden im Rahmen der aktiven Fledermaustollwut- Surveillance Maultupfer und Serumproben von freilebenden Fledermäusen verschiedenster Arten in sechs bzw. acht europäischen Ländern untersucht. Nach den vorliegenden Daten wurde mittels RT-PCR einzig bei in Spanien vorkommenden Isabellfledermäusen (E. isabellinus) eine hohe Prävalenz von EBLV-1-spezifischer RNA gefunden, während die Detektion von EBLV-2- spezifischer RNA nur bei jeweils einer Wasserfledermaus (M. daubentonii) aus Schottland und der Schweiz gelang. Im Gegensatz dazu wurden in mehreren Ländern virus-neutralisierende Antikörper (VNA) vorrangig in Serumproben von E. serotinus, E. isabellinus, M. daubentonii, M. myotis aber auch sporadisch bei weiteren sieben Fledermausarten gefunden. Die hohe Seroprävalenz bei M. myotis in Spanien ist bemerkenswert, da in dieser Art innerhalb der passiven Surveillance erst zwei bestätigte Tollwutfälle aus Deutschland und Polen gemeldet wurden. Aufgrund der kreuzneutralisierenden Eigenschaften gegenüber Lyssaviren gleicher Phylogruppen sind Rückschlüsse auf spezifische Tollwuterreger bei seropositiven Tieren jedoch nicht möglich. Vor dem Hintergrund der Tatsache, dass in Europa derzeit mindestens drei verschiedene Lyssavirusspezies aus der Phylogruppe I zirkulieren und kreuzneutralisierende Eigenschaften aufweisen, wird eine eindeutige kausale Zuordnung schwierig. Zudem erschwert die Anwendung von unterschiedlich modifizierten, nicht standardisierten serologischen Tests unter Verwendung verschiedener Testviren und willkürlicher Bestimmung von cut-off-werten die Bewertung gemessener Seroprävalenzen.

55 Zusammenfassende Darstellung & Diskussion der Ergebnisse 50 Die Statuserhebung der Fledermaustollwut-Surveillance verdeutlicht, dass nach wie vor erhebliche Defizite hinsichtlich der Überwachung der Fledermaustollwut in Europa bestehen. Internationale Empfehlungen zur Tollwut-Surveillance sind dringend umzusetzen und insbesondere in Ländern mit fehlendem Überwachungssystem zu implementieren, wobei der Fokus zunächst auf der passiven Fledermaustollwut-Surveillance liegen sollte. (2) Enhanced Passive Bat Rabies Surveillance in Indigenous Bat Species from Germany - A Retrospective Study Im Rahmen einer retrospektiven Studie wurden im Untersuchungszeitraum von 1998 bis Juni 2013 insgesamt 5478 Tiere aus 21 einheimischen Arten akquiriert und auf das Vorliegen einer Lyssavirusinfektion untersucht. Der Virusnachweis an Gehirnabklatschpräparaten erfolgte mittels direktem Fluorescent Antibody Test (FAT). FAT-positive und -fragliche Proben wurden zur Bestätigung und/oder zur weiteren Charakterisierung mit Hilfe der Virusisolierung in der Zellkultur (Rabies Tissue Culture Infection Test, RTCIT) und EBLV-1/-2-spezifischer RT-PCRs untersucht. Innerhalb dieser Studie gelang bei 49 Breitflügelfledermäusen (E. serotinus) der Nachweis einer EBLV-1-Infektion. Mit einer Ausnahme konnte in allen Fällen das entsprechende Virus isoliert werden. Die Mehrheit der Virusisolate wurde in der partiellen Sequenzierung als EBLV-1a charakterisiert. Eine räumlich-zeitliche phylogenetische Analyse ergab, dass die EBLV-1a-Virusvarianten trotz hoher Sequenzidentität genetische Cluster bilden, die sich häufig geographisch zuordnen lassen. Eine EBLV-1b-Infektion konnte bei fünf Tieren aus dem Saarland, Sachsen-Anhalt und Sachsen nachgewiesen werden. Im Zusammenhang mit einem polnischen EBLV-1b Nachweis deuten diese sporadischen Befunde darauf hin, dass diese Virusvariante weiterverbreitet ist als bislang angenommen. Spill-over-Infektionen von EBLV-1a wurden bei einem Braunen Langohr (Pl. auritus), einer Zwerg- (P. pipistrellus) und einer Rauhautfledermaus (P. nathusii) festgestellt. Diese Befunde bekräftigen die Notwendigkeit der Untersuchungen aller Fledermausspezies sowie einer Speziesidentifizierung. Innerhalb der retrospektiven Studie gelang der Nachweis und die Isolierung von EBLV-2 bei drei Wasserfledermäusen (M. daubentonii). Im Gegensatz dazu wurde dieses Lyssavirus innerhalb der Tollwut-

56 Zusammenfassende Darstellung & Diskussion der Ergebnisse 51 Routineuntersuchung erst einmal diagnostiziert. Als waldbewohnende Art kommen Wasserfledermäuse eher selten mit Menschen in Kontakt und werden daher nur sporadisch von der Bevölkerung gefunden und zur Tollwut-Routineuntersuchung an die Veterinäruntersuchungsämter eingesandt. Unabhängig von der vergleichsweise geringen Anzahl getesteter Tiere scheint die Prävalenz von EBLV-2 bei Wasserfledermäusen im Vergleich zu EBLV-1 bei Breitflügelfledermäusen nicht nur in Deutschland, sondern europaweit geringer zu sein. Zusammenfassend wird jedoch der Durchseuchungsgrad mit EBLV innerhalb der in Deutschland heimischen Fledermauspopulationen anhand der Ergebnisse und unter Berücksichtigung des in dieser Studie untersuchten großen Stichprobenumfanges als gering eingeschätzt. Die Informationen zum Fundort der retrospektiv untersuchten Fledermäuse belegen dennoch, dass die Fledermaustollwut weiter verbreitet ist, als bisher gezeigt werden konnte. Die sich bereits bei der Routinediagnostik abzeichnende Häufung von Fledermaustollwutfällen im Norddeutschen Tiefland wurde in dieser Studie bestätigt und scheint mit der größeren Abundanz der Breitflügelfledermaus zusammen zu hängen. Die Untersuchungen verdeutlichen, dass eine verbesserte (enhanced) passive Surveillance im Vergleich zur Tollwut-Routinediagnostik entscheidende Vorteile in Bezug auf den Stichprobenumfang, das Artenspektrum sowie die Fehlerfreiheit von artbezogenen biologischen und epidemiologischen Daten und somit entscheidende Vorteile für eine gezielte Risikobewertung einer potentiellen Gesundheitsgefährdung des Menschen durch fledermausassoziierte Lyssaviren bietet. Diese Form sollte daher als Standard für eine zukünftige Überwachung der Fledermaustollwut in Deutschland und Europa betrachtet werden. (3) Twenty Years of Active Bat Rabies Surveillance in Germany: A Detailed Analysis and Future Perspectives. Deutschland zählt zu den europäischen Ländern mit der höchsten Anzahl gemeldeter Tollwutfälle bei Fledermäusen. Um neben den Erkenntnissen aus der passiven Surveillance zusätzliche Informationen über die Verbreitung der bisher nachgewiesenen Lyssaviren EBLV-1, EBLV-2 und BBLV zu erhalten, wurde im Zeitraum von 1998 bis 2012 an 42 Standorten in Deutschland eine umfangreiche

57 Zusammenfassende Darstellung & Diskussion der Ergebnisse 52 Beprobung von freilebenden einheimischen Fledermauspopulationen durchgeführt (aktive Surveillance). Insgesamt wurden 4546 Maultupfer- und 1736 Serumproben von 18 einheimischen Fledermausspezies entnommen und mit Hilfe molekularer, virologischer und serologischer Verfahren labordiagnostisch untersucht. Lyssavirusspezifische RNA konnte nur in wenigen Proben nachgewiesen werden. EBLV-1-spezifische RNA wurde in Maultupferproben von fünf Breitflügel- (E. serotinus), einer Fransen- (M. nattereri) und einer Mopsfledermaus (B. barbastellus) mit Hilfe verschiedener RT-PCRs detektiert. Drei der positiv getesteten Breitflügelfledermäuse stammten aus einer Wochenstubenkolonie (Hartmannsdorf, Brandenburg), bei denen trotz Wiederfang kein wiederholter RNA-Nachweis im Maultupfer möglich war. Beim Nachweis von EBLV-1- spezifischer RNA in den anderen Fledermausspezies muss vermutlich von einer spill-over-infektion durch infizierte Breitflügelfledermäuse bei der Nutzung gemeinsamer Quartiere ausgegangen werden. Diese Ergebnisse bestätigen Erfahrungen aus anderen europäischen Studien. Dennoch konnte in dieser Arbeit erstmalig EBLV-1a aus einer RT-PCR-positiven Maultupferprobe von einer scheinbar gesunden Breitflügelfledermaus isoliert werden. Ursachen für die eher sporadischen RNA Nachweise in Maultupfern sind vielfältig und könnten unter anderem die nicht zielgerichtete Stichprobenentnahme, der unbekannte Infektionsstatus der beprobten Fledermauskolonien bzw. Tiere, die Pathogenese der fledermausassoziierten Lyssaviren (nicht-persistente Infektion) oder ein möglicher Verdünnungseffekt der Probe bzw. Degradation der in der Probe enthaltenen RNA sein. Trotz der umfangreichen Beprobung der für EBLV-2 und BBLV charakteristischen Reservoire (M. daubentonii und M. nattereri) konnte bei diesen, aber auch bei anderen Myotis-Arten keine lyssavirusspezifische RNA detektiert werden. Nachweise von bislang unbekannten Lyssaviren waren aufgrund der verwendeten EBLV-1/-2- und BBLV-spezifischen RT-PCRs nicht möglich. Die Verwendung panlyssavirus-spezifischer RT-PCRs, durch welche das komplette Spektrum an Lyssaviren detektiert werden kann, könnte zukünftig weitere wertvolle Erkenntnisse liefern. Bei der serologische Testung von Serumproben gegen EBLV-1 wurden virusneutralisierende Antikörper (VNA) in acht verschiedenen Fledermausspezies (B.

58 Zusammenfassende Darstellung & Diskussion der Ergebnisse 53 barbastella, E. serotinus, M. myotis, N. leisleri, N. noctula, P. nathusii und Pl. austriacus) festgestellt, wobei hauptsächlich Seren von E. serotinus, aber auch von M. myotis höhere Titer aufwiesen. Innerhalb einer Wochenstubenkolonie von E. serotinus konnte über einen Untersuchungszeitraum von fünf Jahren bei Seren von beringten Tieren eine unterschiedliche Dynamik von VNA-Titern nachgewiesen werden. Obwohl ähnliche serologische Befunde bei einigen dieser Fledermausarten in anderen Ländern wie Spanien, Frankreich und dem Vereinigten Königreich beschrieben wurden, ist ein Vergleich von Ergebnissen verschiedener Sero-Surveillance-Studien grundsätzlich schwierig. Dies ist vordergründig durch das Fehlen standardisierter Testverfahren, insbesondere durch die Nutzung verschiedenster modifizierter serologischer Assays, die willkürliche Festlegung von cut-off-werten sowie die Verwendung unterschiedlicher Testviren bedingt. Variierende Seroprävalenzen in Reservoirspezies oder anderen Arten können zudem durch regionale Unterschiede in der Viruszirkulation und -dynamik oder durch kreuzneutralisierende Antikörper möglicherweise unbekannter oder nah verwandter Lyssaviren hervorgerufen werden. So sind beispielsweise die Unterschiede in der vermeintlichen EBLV-1- Seroprävalenz bei M. myotis in Spanien und Deutschland nur schwer interpretierbar. Unter Berücksichtigung eigener und publizierter Daten liefert die aktive Surveillance im Gegensatz zur passiven Surveillance nur begrenzte Erkenntnisse zum Vorkommen, der Prävalenz und Dynamik von Fledermaustollwut in einheimischen Fledermauspopulationen. Die biologischen, methodischen und logistischen Limitierungen erlauben keine flächendeckende Anwendung. Daher kann die aktive Surveillance eine passive Überwachung nicht ersetzen bzw. nur bedingt ergänzen. Diese Form kann jedoch bei Fledermauskolonien mit bekanntem Infektionsstatus und adäquater Beprobung wertvolle Daten zur Virusdynamik und -zirkulation generieren. (4) Lyssavirus Distribution in Naturally Infected Bats from Germany Neben dem Gehirn wurden Gewebe neun verschiedener Organe EBLV-positiver Breitflügelfledermäuse (n=54), Wasserfledermäuse (n=2) sowie einer Rauhautfledermaus mit Hilfe von molekularbiologischen (RT-qPCR) und virologischen (RTCIT) Methoden untersucht. Bei Breitflügel- und Wasserfledermäusen konnte

59 Zusammenfassende Darstellung & Diskussion der Ergebnisse 54 abgesehen von individuellen Unterschieden virusspezifische RNA in allen untersuchten Organen nachgewiesen und somit vorangegangene Daten von natürlich und experimentell infizierten Tieren verifiziert werden. Zum ersten Mal wurde in dieser Studie die Viruslast in den betroffenen Organgeweben anhand der ermittelten ct-werte (cycle threshold) der RT-qPCR geschätzt. Begründet durch die neurotropen Eigenschaften der Lyssaviren wurde die höchste Viruslast im Gehirn festgestellt. Signifikant hohe Viruslasten waren zudem auch in der Speicheldrüse nachweisbar. Eine Virusanzucht gelang aus fünf nicht neuronalen Organen. Es ist bekannt, dass Lyssaviren vorrangig über den Speichel infizierter Tiere ausgeschieden und dadurch übertragen werden, obwohl gerade für fledermausassoziierte Lyssaviren auch andere Übertragungswege postuliert wurden. Innerhalb der eigenen Studie wurden 85% der Speicheldrüsen von E. serotinus mit Hilfe der RT-qPCR positiv getestet und bei 47% dieser Proben Virus isoliert. Negative Ergebnisse in Speicheldrüsen bei einzelnen Tieren könnten mit dem Stadium des Infektionsverlaufs zum Zeitpunkt der Probengewinnung bzw. der intermittierenden Virusreplikation und -ausscheidung erklärt werden. Der fehlende Nachweis von Virus oder viraler RNA in der Speicheldrüse von P. nathusii ist kennzeichnend für sogenannte dead-end-infektionen im Fehlwirt. Experimentelle Studien bei Breitflügelfledermäusen legten eine besondere Rolle der Zunge als Ausscheidungsorgan für EBLV-1 nahe. Durch den histologischen Nachweis (Immunhistochemie, In-situ-Hybridisierung) von Lyssavirusantigen bzw. -RNA in verschiedenen zellulären Strukturen des Zungengewebes (Nerven- und Muskelfasern, Papille, intralinguale Speicheldrüsen) bei den in dieser Studie vorliegenden, natürlich infizierten Breitflügelfledermäusen wurden diese Beobachtungen bestätigt und erhärtet. Zusätzlich zur Speicheldrüse scheint die Zunge ein Organ zu sein, in dem Virusreplikation und Virusausscheidung stattfinden kann. Die Übertragung und Ausscheidung von fledermausassoziierten Lyssaviren über den Harntrakt oder die Atemwege ist wissenschaftlich umstritten. Obwohl in der RT-qPCR ein relativ hoher Prozentsatz an Lungen (48,1%) und Nieren (68,5%) positiv reagierte, konnten diese Ergebnisse immunhistochemisch nicht bestätigt werden. Aufgrund der vorliegenden Ergebnisse ist der Nachweis lyssavirusspezifischer RNA in verschiedenen Organen aller Wahrscheinlichkeit nach durch eine vom

60 Zusammenfassende Darstellung & Diskussion der Ergebnisse 55 zentralen Nervensystem ausgehend zentrifugale Virusausbreitung entlang der Organ-innervierenden Nerven hervorgerufen. Eine diffuse Virusausbreitung infolge einer defekten Blut-Hirn-Schranke im fortgeschrittenen Infektionsstadium kann jedoch nicht ausgeschlossen werden. Die Untersuchung trächtiger Fledermäuse im Hinblick auf eine transplazentale Virusübertragung ist nur selten möglich und konnte innerhalb der eigenen Studie einzig bei einer mit EBLV-1 infizierten Breitflügelfledermaus erfolgen. Eine Infektion und somit vertikale Übertragung von Lyssavirus auf den Fötus wurde in Übereinstimmung mit anderen Studien jedoch nicht festgestellt.

61 6 Publikationen 56

62 Publikationen 57 Bat Rabies Surveillance in Europe Schatz, J.; Fooks, A. R.; McElhinney, L.; Horton, D.; Echevarria, J.; Vázquez- Moron, S.; Kooi, E. A.; Rasmussen, T. B.; Müller, T. and C. M. Freuling Zoonoses and Public Health 2013

63 Publikationen 58 Zoonoses and Public Health SPECIAL ISSUE BATS Bat Rabies Surveillance in Europe J. Schatz 1, A. R. Fooks 2, L. McElhinney 2, D. Horton 2, J. Echevarria 3,S.Vázquez-Moron 3, E. A. Kooi 4, T. B. Rasmussen 5,T.Müller 1 and C. M. Freuling Institute of Molecular Biology, WHO Collaborating Centre for Rabies Surveillance and Research, Friedrich-Loeffler-Institute, Federal Research Institute for Animal Health, Greifswald-Insel Riems, Germany Wildlife Zoonoses and Vector Borne Diseases Research Group, Animal Health and Veterinary Laboratories Agency (Weybridge), Surrey, UK Instituto de Salud Carlos III, Majadahonda, Madrid, Spain Central Veterinary Institute of Wageningen UR, Lelystad, The Netherlands DTU National Veterinary Institute, Lindholm, Kalvehave, Denmark Impacts Rabies in European bats is caused by at least four different lyssavirus species that seem to have an association with certain bat species, that is, the Serotine bat (EBLV-1), the Daubenton s and Pond bat (EBLV-2), Schreiber s long-fingered bat (WCBV) and the Natterer s bat (BBLV). Almost all bat rabies cases were detected in dead or clinically affected bats i.e. passive surveillance. This is a much more sensitive approach than active surveillance where oral swab samples taken from individuals randomly captured during planned surveys were screened for viral RNA and/or virus. The focus of bat rabies surveillance should be on testing of dead or moribund animals, and resulting positive FAT results should be further analysed to identify the lyssavirus species and all bats submitted for testing should be identified to species level. Keywords: Rabies; bats; lyssavirus; surveillance Correspondence: C.M. Freuling. Institute of Molecular Biology, WHO Collaborating Centre for Rabies Surveillance and Research, Friedrich-Loeffler- Institute, Federal Research Institute for Animal Health, Greifswald-Insel Riems, Germany. Tel.: ; Fax: ; conrad.freuling@ fli.bund.de Received for publication December 5, 2011 doi: /zph Summary Rabies is the oldest known zoonotic disease and was also the first recognized bat associated infection in humans. To date, four different lyssavirus species are the causative agents of rabies in European bats: the European Bat Lyssaviruses type 1 and 2 (EBLV-1, EBLV-2), the recently discovered putative new lyssavirus species Bokeloh Bat Lyssavirus (BBLV) and the West Caucasian Bat Virus (WCBV). Unlike in the new world, bat rabies cases in Europe are comparatively less frequent, possibly as a result of varying intensity of surveillance. Thus, the objective was to provide an assessment of the bat rabies surveillance data in Europe, taking both reported data to the WHO Rabies Bulletin Europe and published results into account. In Europe, 959 bat rabies cases were reported to the RBE in the time period with the vast majority characterized as EBLV-1, frequently isolated in the Netherlands, North Germany, Denmark, Poland and also in parts of France and Spain. Most EBLV-2 isolates originated from the United Kingdom (UK) and the Netherlands, and EBLV-2 was also detected in Germany, Finland and Switzerland. Thus far, only one isolate of BBLV was found in Germany. Published passive bat rabies surveillance comprised testing of 28 of the 52 different European bat species for rabies. EBLV-1 was isolated exclusively from Serotine bats (Eptesicus serotinus and Eptesicus isabellinus), while EBLV-2 was detected in 14 Daubenton s bats (Myotis daubentonii) and 5 Pond bats (Myotis dasycneme). A virus from a single Natterer s bat (Myotis nattereri) was characterized as BBLV. During active surveillance, only oral swabs from 2 Daubenton s bats (EBLV-2) and from several Eptesicus bats (EBLV-1) yielded virus positive RNA. Virus neutralizing antibodies against lyssaviruses were detected in various European bat species from different countries, and its value and implications are discussed. 22 ª 2012 Blackwell Verlag GmbH Zoonoses and Public Health, 2013, 60, 22 34

64 Publikationen 59 J. Schatz et al. Bat Rabies Surveillance in Europe Introduction Bats have been shown to be reservoir of a plethora of viruses (Calisher et al., 2006) and are also associated with zoonotic viral diseases such as SARS, Nipah, Hendra and rabies. Rabies is a viral zoonotic disease inevitably fatal in humans and other mammals once clinical signs develop. It is caused by different lyssavirus species of the Rhabdoviridae family, order Mononegavirales (Table 1). Most known lyssavirus species have been isolated from bats except for Mokola virus and Ikoma lyssavirus (IKOV) for which the reservoirs are not yet known (World Health Organisation, 2005; Marston et al., 2012). Based on their antigenic, genetic and immunological features lyssaviruses can be divided into two phylogroups. Phylogroup I comprises the majority of lyssavirus species, whereas Lagos Bat Virus (LBV), Mokola Virus (MOKV) and Shimoni Bat Virus (SHIBV) form phylogroup II (Badrane et al., 2001; Kuzmin et al., 2010). West Caucasian Bat Virus (WCBV) and IKOV may be representatives of a possible new phylogroup (Kuzmin et al., 2005; Marston et al., 2012). Interestingly, rabies is the oldest known zoonotic disease and was also the first recognized bat associated disease. In the beginning of the 20th century, Carini (1911) suggested a link between rabies and vampire bat bites in South and Central America. However, it took a further three decades before rabies was also detected in non-haematophagous bat species. In 1953, the first rabies case in insectivorous bats was reported from Florida, USA (Venters et al., 1954), and only 1 year later, the first record of a rabid bat in Europe was reported from Hamburg in Germany (Mohr, 1957). Four different lyssavirus species have been isolated from European bats: the European bat lyssaviruses type 1 and 2 (EBLV-1, EBLV-2) (Bourhy et al., 1992), the recently discovered putative new lyssavirus species Bokeloh Bat Lyssavirus (BBLV) (Freuling et al., 2011) and the West Caucasian Bat Virus (WCBV) (Kuzmin et al., 2005). The majority of isolates in Europe were characterized as EBLV- 1 mostly associated with Eptesicus serotinus (Müller et al., 2007) and Eptesicus isabellinus (Vazquez-Moron et al., 2008a). EBLV-2 has only been isolated sporadically. Except for five cases in the Netherlands where EBLV-2 was isolated from Pond bats, Myotis dasycneme (van der Poel et al., 2005), all other bat isolates were collected from Daubenton s bats, Myotis daubentonii (Freuling et al., 2012). Both WCBV and BBLV have only been isolated once. Whilst WCBV was detected in a Schreiber s bent-winged bat (Miniopterus schreibersii) on the European side of the Caucasus Mountains, BBLV was isolated from a Natterer s bat (Myotis nattereri) in Germany (Freuling et al., 2011). The relevance of bat rabies for public health in Europe is illustrated by the fact that both EBLV-1 and EBLV-2 have caused human deaths, although the number is small (Johnson et al., 2010). Spill-over infections to other mammals have only been described for EBLV-1 in a stone marten (Martes foina), (Müller et al., 2004), sheep (Tjornehoj et al., 2006) and cats (Dacheux et al., 2009). Recently, guidelines on passive and active bat rabies surveillance were established by a European research consortium Med-Vet-Net (Med-Vet-Net Working Group, 2005). Passive surveillance was defined as the testing of sick or dead bats of all indigenous bat species for lyssavirus infections using standard antigen detection, that is, Table 1. Current diversity of lyssavirus species (World Health Organisation, 2005, Kuzmin et al. 2010, Freuling et al., 2011; Marston et al., 2012) Lyssavirus Geographical distribution Potential vector(s)/ reservoirs Phylogroup Classical rabies virus (RABV) Worldwide Bats in America I Lagos bat virus (LBV) Africa Frugivorous bats (Megachiroptera) II Mokola virus (MOKV) Africa Unknown II Duvenhage virus (DUVV) Southern Africa Insectivorous bats I European bat lyssavirus type 1 (EBLV 1) Europe Insectivorous bats (Eptesicus serotinus, E. isabellinus) I European bat lyssavirus type 2 (EBLV 2) Europe Insectivorous bats (Myotis daubentonii, Myotis dasycneme) Australian bat lyssavirus (ABLV) Australia Frugivorous bats/insectivorous bats I (Megachiroptera/Microchiroptera) Aravan virus (ARAV) Central Asia Insectivorous bats (Myotis blythii) I Irkut virus (IRKV) East Siberia Insectivorous bats (Murina leucogaster) I Khujand virus (KHUV) Central Asia Insectivorous bats (Myotis mystacinus) I West Caucasian bat virus (WCBV) Caucasian region Insectivorous bats (Miniopterus schreibersii) III? Bokeloh bat lyssavirus (BBLV) Europe Insectivorous bats (Myotis nattereri) I Shimoni bat virus (SHIBV) East Africa Insectivorous bats (Hipposideros commersoni) II Ikoma lyssavirus (IKOV) Tanzania?(Civettictis civetta) III? I ª 2012 Blackwell Verlag GmbH 23 Zoonoses and Public Health, 2013, 60, 22 34

65 Publikationen 60 Bat Rabies Surveillance in Europe J. Schatz et al. the fluorescent antibody test (FAT). It comprises both dead bats submitted primarily by bat biologist networks, and also bats submitted by the public due to exposure concerns. Active surveillance is the monitoring of bat populations for lyssavirus infections by screening oral swab (detection of lyssavirus-specific RNA using different RT-PCRs or virus isolation) and/or sera (detection of virus neutralizing antibodies using virus neutralization assays, for example, modified RFFIT) (Med-Vet-Net Working Group, 2005). This scheme was adopted by the UN EUROBATS Resolution 5.2, Bats and Rabies in Europe (Anon, 2006) and by a recent expert opinion on request of the European Food Safety Authority (Cliquet et al., 2010). However, it is not clear yet whether these guidelines had an impact on European bat rabies surveillance. The objective of this study was to assess the current state of bat rabies surveillance in Europe using all available data sources, that is, officially reported or published bat rabies surveillance data, including bat species identification. in parts of France and Spain (Fig. 1a). Few cases were reported from Romania, Hungary, Slovenia and Russia. Most EBLV-2 isolates originated from the UK and the Netherlands, and EBLV-2 was also detected in Germany, Finland and Switzerland. Thus far, only one isolate of BBLV was found in Germany (Fig. 1b). From 1977 to 1984, only two bat rabies cases were reported to the RBE. Since 1985, the number of reported rabies cases in bats increased with the highest numbers in 1986 (n = 122) and 1987 (n = 140), respectively. From 2006 to 2010, the number of positive bats ranged between 26 and 36 (Fig. 2a). Of all reported bat rabies cases in Europe ( ) the majority (n = 418) were detected in the third quarter, while within the fourth quarter only 92 bats tested rabies positive. The number of bat rabies cases reported in first quarter amount to 270, while in second quarter 167 bat rabies cases were reported (Fig. 2b). (a) Material and Methods Data on bat rabies surveillance were retrieved from the WHO Rabies Bulletin Europe (RBE), established and maintained by the WHO Collaboration Centre for Rabies Surveillance and Research, at the Friedrich-Loeffler-Institute, Germany. This European database collects data on all rabies cases in Europe since 1977 (Meslin, 2007). The veterinary authorities of participating European countries are encouraged to regularly submit data on officially confirmed rabies cases per species. All data are summarized at a certain regional level depending on the administrative unit and per quarter of the year. Rabies positive cases in bats were analysed cumulative for the years , and additionally attributed to quarters. For rabies surveillance, the number of negative bats tested and reported to the RBE for the years were analysed. In addition, a more specific questionnaire on bat rabies surveillance was developed. The contributors to the RBE were asked to provide data on the number of animals tested per bat species and the number of positive cases thereof, cumulative for the same time period. Furthermore, publications from 1995 to 2011 on bat rabies surveillance in Europe were also analysed for data on both passive and active bat lyssavirus surveillance. (b) Results In Europe, 959 cases of bat rabies were reported in the time period (Fig. 1, 2). The majority of them were characterized as EBLV-1, frequently isolated in the Netherlands, North Germany, Denmark, Poland and also Fig. 1. Geographical origin of reported bat rabies cases in Europe ( ): (a) all cases except confirmed cases of EBLV-2, (b) EBLV- 2 cases (dots) and BBLV (star). 24 ª 2012 Blackwell Verlag GmbH Zoonoses and Public Health, 2013, 60, 22 34

66 Publikationen 61 J. Schatz et al. Bat Rabies Surveillance in Europe (a) Table 2. Number of rabies negative and positive tested bats in several countries ( ) Country Tested negative Rabies cases (b) I II III IV Fig. 2. Number of reported bat rabies case in Europe ( ): (a) annually, (b) per quarter. In 12 cases, no information on the isolation date was submitted to the RBE. Of 46 European countries, 29 submitted data on bat rabies surveillance to the RBE for the time period (Table 2). Most countries reported several hundred bats being tested, while others only investigated single animals. In the UK, for instance, in this time, period a total of 5163 grounded bats were investigated. Bat rabies cases (n = 162) were reported from 12 European countries, with the majority from the Netherlands (n = 45), Germany (n = 35), France (n = 30), Poland (n = 18) and Denmark (n = 13). In Finland, Hungary, Romania, the Russian Federation and the Ukraine only few cases of positive bats were notified (Table 2). The response to the questionnaire was limited, only 11 countries replied and 6 questionnaires concerning data on individual bat species were analysed (Table S1). While the proportion of unknown bat specimens that were not identified to the species level was fairly high in some countries, in Switzerland and Serbia, all tested bats were assigned to their species level. The most frequently tested bat species is the Common pipistrelle bat (Pipistrellus pipistrellus). From all assumed reservoir species, Myotis daubentonii (n = 57) and Miniopterus schreibersii (n = 36) were most frequently analysed in those countries; however, without a positive rabies result. Of 28 Serotine bats tested, 11 rabies cases were reported from Hungary, Spain Albania Austria Belgium Bulgaria 1 0 Croatia 81 0 Czech Republic 75 0 Denmark Estonia 5 0 Finland 33 1 France Germany Greece 5 0 Hungary 41 2 Italy 26 0 Lithuania 6 0 Moldova 18 0 Poland Romania Unknown 1 Russian Federation Unknown 2 Serbia Slovak Republic 24 0 Slovenia Spain Switzerland + Liechtenstein The Netherlands Turkey 1 0 Ukraine 27 3 United Kingdom P and Poland. Furthermore, rabies was found in 6 of the 14 investigated Eptesicus isabellinus bats. Whilst in Poland 8 bat rabies cases could not be attributed to a certain bat species, other cases were formally attributed to Eptesicus serotinus (n = 8), Myotis myotis (n = 1) and Plecotus auritus (n = 1). During the past two decades, published studies on passive bat rabies surveillance originated from Finland, France, Germany, Serbia, Slovenia, Spain, UK, Sweden, Switzerland, the Netherlands and United Kingdom covering different time periods (Table 3). Overall these studies comprised testing of 28 of the 52 different European bat species for rabies. EBLV-1 was isolated from 287 Serotine bats (Eptesicus serotinus); EBLV-2 was detected in 14 Daubenton s bats (Myotis daubentonii) and 5 Pond bats (Myotis dasycneme). A virus from a single Natterer s bat was characterized as BBLV (Table 3). Rabies cases in other bat species were not reported. Notably, only viral RNA (EBLV-1) was detected in the brains of 3 Myotis myotis, 1 Miniopterus schreibersii, 1 Myotis nattereri and 1 Plecotus ª 2012 Blackwell Verlag GmbH 25 Zoonoses and Public Health, 2013, 60, 22 34

67 Publikationen 62 Bat Rabies Surveillance in Europe J. Schatz et al. Table 3. Passive surveillance for bat rabies in Europe Bat species Region No. of bats FAT pos. Lyssavirus Reference Unknown/unspecified Finland 21 0 Jakava-Viljanen et al., 2010b France Picard-Meyer et al., 2006 Serbia 82 0 Vranješ et al., 2010 Slovenia 50 0 Presetnik et al., 2010 Swiss 14 0 Megali et al., 2010 The Netherlands 9 0 van der Poel et al., 2005 UK 47 0 Harris et al., 2006 Barbastella barbastellus Russia 3 0 Botvinkin et al., 2003; * Swiss 3 0 Megali et al., 2010 UK 6 0 Harris et al., 2006 Eptesicus isabellinus Spain 25 5 Echevarria et al., 2001 Eptesicus nilssonii Sweden 24 0 SVA 2009/2010 Swiss 13 0 Megali et al., 2010 The Netherlands 1 0 van der Poel et al., 2005 Eptesicus serotinus France Unknown 21 EBLV-1 Picard-Meyer et al., 2006 France Unknown 15 EBLV-1 Picard-Meyer et al., 2010a Spain 1 0 Serra-Cobo et al., 2002 Swiss 21 0 Megali et al., 2010 The Netherlands EBLV-1 van der Poel et al., 2005 UK 82 0 Harris et al., 2006 H. savii Swiss 1 0 Megali et al., 2010 Miniopterus schreibersii Russia 24 1 WCBV Botvinkin et al., 2003; * Spain 9 0 Serra-Cobo et al., 2002 M. bechsteinii Swiss 5 0 Megali et al., 2010 UK 2 0 Harris et al., 2006 M. brandtii/mystacinus UK Harris et al., 2006 M. brandtii Sweden 6 0 SVA 2009/2010 Myotis blythii Russia 10 0 Botvinkin et al., 2003; * Swiss 2 0 Megali et al., 2010 Myotis daubentonii Germany 45 1 EBLV-2 Freuling et al., 2008 Russia 43 0 Botvinkin et al., 2003; * Sweden 1 0 SVA 2009 Swiss 64 3 EBLV-2 Megali et al., 2010 The Netherlands van der Poel et al., 2005 UK EBLV-2 Harris et al., 2006 Myotis dasycneme The Netherlands EBLV-2 van der Poel et al., 2005 Myotis emarginatus Russia 9 0 Botvinkin et al., 2003; * Spain 2 0 Serra-Cobo et al., 2002 Myotis spp. Sweden 1 0 SVA 2009 Swiss 1 0 Megali et al., 2010 Myotis myotis Spain 15 0 Serra-Cobo et al., 2002 Spain 17 0 Amengual et al., 2007 Swiss 41 0 Megali et al., 2010 UK 1 0 Harris et al., 2006 Myotis mystacinus Sweden 6 0 SVA 2009/2010 Swiss 45 0 Megali et al., 2010 The Netherlands 18 0 van der Poel et al., 2005 Myotis nattereri Germany 65 1 Freuling et al., 2011 Spain 2 0 Serra-Cobo et al., 2002 Sweden 2 0 SVA 2009/2010 Swiss 4 0 Megali et al., 2010 The Netherlands 9 0 van der Poel et al., 2005 UK Harris et al., ª 2012 Blackwell Verlag GmbH Zoonoses and Public Health, 2013, 60, 22 34

68 Publikationen 63 J. Schatz et al. Bat Rabies Surveillance in Europe Table 3. (Continued) Bat species Region No. of bats FAT pos. Lyssavirus Reference Nyctalus noctula Russia 28 0 Botvinkin et al., 2003; * Sweden 1 0 SVA 2010 Swiss 68 0 Megali et al., 2010 The Netherlands 61 0 van der Poel et al., 2005 UK 56 0 Harris et al., 2006 N. leisleri Swiss 21 0 Megali et al., 2010 The Netherlands 3 0 van der Poel et al., 2005 UK 9 0 Harris et al., 2006 Pipistrellus kuhlii Russia 9 0 Botvinkin et al., 2003; * Swiss 57 0 Megali et al., 2010 Pipistrellus nathusii Swiss Megali et al., 2010 The Netherlands van der Poel et al., 2005 UK 33 0 Harris et al., 2006 Pipistrellus pipistrellus Russia 2 0 Botvinkin et al., 2003; * Spain 50 0 Serra-Cobo et al., 2002 Swiss Megali et al., 2010 The Netherlands van der Poel et al., 2005 P. pygmaeus Sweden 9 0 SVA 2009/2010 Swiss 11 0 Megali et al., 2010 P. pipistrellus/pygmaeus UK Harris et al., 2006 P. savii Swiss 2 0 Megali et al., 2010 Plecotus spp. Swiss 3 0 Megali et al., 2010 Plecotus auritus Sweden 20 0 SVA 2009/2010 Swiss 63 0 Megali et al., 2010 The Netherlands van der Poel et al., 2005 UK Harris et al., 2006 Plecotus austriacus Spain 4 0 Serra-Cobo et al., 2002 Sweden 4 0 SVA 2009 Swiss 5 0 Megali et al., 2010 UK 9 0 Harris et al., 2006 Pl. macrobullaris Swiss 2 0 Megali et al., 2010 Rhinolophus ferrumeqinum Russia 6 0 Botvinkin et al., 2003; * Spain 7 0 Serra-Cobo et al., 2002 UK 5 0 Harris et al., 2006 Rhinolophus hipposideros Spain 1 0 Serra-Cobo et al., 2002 UK 32 0 Harris et al., 2006 Verspertilio murinus Sweden 4 0 SVA 2010 Swiss 31 0 Megali et al., 2010 The Netherlands 6 0 van der Poel et al., 2005 *Wild bats were caught and subject of rabies diagnosis (FAT) after necropsy. austriacus (Serra-Cobo et al., 2002; Amengual et al., 2007). In Europe, wild-caught bats from selected colonies of 19 different species were the subject of active surveillance. Most studies were performed in Spain, and the most frequently sampled species was Myotis myotis, followed by Myotis daubentonii and Eptesicus serotinus. Eleven species tested serologically positive for virus neutralizing antibodies (VNAs, Table 4). Eptesicus bats (E. serotinus or E. isabellinus) had measurable levels of VNAs in Spain, Germany and France. A single Serotine bat from the UK also had VNAs, whereas all tested Serotines from Switzerland were negative. VNAs were identified in Daubenton s bats from UK, Switzerland and Sweden. Both Miniopterus schreibersii (France, Spain) and Myotis nattereri (Belgium, UK) also tested positive for VNAs (Table 4). Individual sera from Myotis myotis from Spain, France and Belgium were positive for VNAs, while all sera from Switzerland were negative. Especially, the results of one survey in Spain indicated very high seroprevalences in this bat species (Amengual et al., 2007). None of the sera from Eptesicus nilssonii, Myotis emarginatus, Nyctalus noctula, Pipistrellus kuhlii, Pipistrellus ª 2012 Blackwell Verlag GmbH 27 Zoonoses and Public Health, 2013, 60, 22 34

69 Publikationen 64 Bat Rabies Surveillance in Europe J. Schatz et al. Table 4. Sero-surveillance and detection of lyssavirus neutralizing antibodies in European bats Bat species Region N VNA pos. Seroprevalence (%) Reference Unspecified Slovenia Hostnik et al., 2010 B. barbastellus France Picard-Meyer et al., 2011 E. isabellinus Spain Vazquez-Moron et al., 2008b E. serotinus Germany unpublished data France Picard-Meyer et al., 2011 Spain (Balearic) Serra-Cobo et al., 2002 Spain Perez-Jorda et al., 1995 Switzerland Megali et al., 2010 UK (England) Harris et al., 2009 E. nilssonii Sweden SVA, 2009 M. blythii France Picard-Meyer et al., 2011 Spain (Balearic) Serra-Cobo et al., 2002 M. capaccinii Spain (Balearic) Serra-Cobo et al., 2002 M. daubentonii Switzerland Megali et al., 2010 Sweden ,39 SVA, 2009 UK (England) Harris et al., 2006 UK (Scotland) 198 (88) Brookes et al., 2005 UK (Scotland) > SNH, 2009 M. emarginatus Spain (Balearic) Serra-Cobo et al., 2002 M. myotis Belgium Klein et al., 2007 France Picard-Meyer et al., 2011 Spain (Balearic) Amengual et al., 2007 Spain (Balearic) Serra-Cobo et al., 2002 Switzerland Megali et al., 2010 M. myotis/blythii France Picard-Meyer et al., 2011 M. nattereri Belgium Klein et al., 2007 Spain (Balearic) Serra-Cobo et al., 2002 UK (Scotland) Brookes et al., 2005 UK (Scotland) Unknown 2 SNH, 2009 Mi. schreibersii France Picard-Meyer et al., 2011 Spain (Balearic) Serra-Cobo et al., 2002 N. noctula Switzerland Megali et al., 2010 P. kuhlii Spain (Balearic) Serra-Cobo et al., 2002 P. pipistrellus Spain (Balearic) Serra-Cobo et al., 2002 UK (Scotland) Brookes et al., 2005 Plecotus spp. Belgium Klein et al., 2007 Pl. austriacus Spain (Balearic) Serra-Cobo et al., 2002 R. ferrumeqinum France Picard-Meyer et al., 2011 Spain (Balearic) 58 2 Serra-Cobo et al., 2002 R. euryale Spain (Balearic) Serra-Cobo et al., 2002 R. hipposideros Spain (Balearic) Serra-Cobo et al., 2002 Tadarida teniotis Spain (Balearic) 34 2 Serra-Cobo et al., 2002 pipistrellus, Plecotus austriacus, Rhinolophus euryale and Rhinolophus hipposideros had measurable VNAs. Analyses of oro-pharyngeal swab samples were published for bats from France, Spain, UK, Switzerland, Slovenia and Serbia (Table 5). A total of 3880 oral swabs from 23 different European bat species were screened for viral RNA mostly using RT-PCR methods. Only in two bat species, that is, Serotine bats and Daubenton s bats viral RNA was found. Positive results (EBLV-1) from Eptesicus species were reported from Spain (Eptesicus isabellinus). Oral swabs from 2 Daubenton s bats from Scotland (2008) and Switzerland (2009) yielded EBLV-2 specific RNA. Viable virus could not be isolated from any oral swab sample. Discussion The understanding of lyssavirus diversity and abundance has increased over the past decades. The collection of rabies data for the RBE, including those on positive bats, started in 1977, before the discovery of the different lyssaviruses in Europe. The first human case of EBLV-2 28 ª 2012 Blackwell Verlag GmbH Zoonoses and Public Health, 2013, 60, 22 34

70 Publikationen 65 J. Schatz et al. Bat Rabies Surveillance in Europe Table 5. Active surveillance for bat rabies in Europe using oral swab samples for detection of lyssavirus-specific RNA or virus. Number of positive and no. of tested () samples per bat species is shown Bat species Picard-Meyer et al., 2011; France Picard-Meyer et al., 2011; France Vazquez-Moron et al., 2008b; Spain Echevarria et al., 2001; Spain SNH, 2009, UK - Scotland Harris et al., 2006; UK Brookes et al., 2005; UK - Scotland Megali et al., 2010; Switzerland Presetnik et al., 2010; Slovenia Hostnik et al., 2010; Slovenia Vranies et al., 2010; Serbia B. barbastellus 0 (6) 0 (7) E. isabellinus 34 (1226) 15 (71) E. serotinus 0 (18) 0 (72) 0 (327) 0 (23) 0 (145) 0 (61) 0 (8) Mi. schreibersii 0 (4) 0 (18) 0 (31) M. alcathoe 0 (1) M. bechsteinii 0 (7) 0 (5) M. blythii 0 (5) 0 (41) M. capaccinii 0 (1) 0 (33) M. daubentonii 0 (15) 0 (22) 1 (>900) 0 (416) 0 (198) 1 (148) 0 (61) 0 (21) 0 (44) M. emarginatus 0 (27) 0 (10) 0 (50) M. myotis 0 (22) 0 (36) 0 (51) 0 (57) 0 (55) 0 (33) M. myotis/blythii 0 (11) M. mystacinus 0 (3) 0 (3) 0 (15) 0 (5) M. nattereri 0 (10) 0 (7) 0 (20) 0 (1) N. noctula 0 (15) 0 (57) 0 (35) 0 (24) P. kuhlii 0 (1) 0 (19) 0 (3) P. nathusii 0 (2) P. pipistrellus 0 (11) 0 (15) P. pygmaeus 0 (13) Pl. auritus 0 (8) 0 (7) Pl. austriacus 0 (15) 0 (15) R. euryale 0 (4) 0 (5) R. ferrumeqinum 0 (11) 0 (21) R. hipposideros 0 (11) 0 (11) 0 (63) 0 (63) Methods RTCIT hnrt-pcr RT-PCR RT-PCR RT-PCR RT-PCR/RTCIT nrt-pcr RT-PCR RT-PCR RT-PCR, MIT ª 2012 Blackwell Verlag GmbH 29 Zoonoses and Public Health, 2013, 60, 22 34

71 Publikationen 66 Bat Rabies Surveillance in Europe J. Schatz et al. origin which occurred in 1985 (Lumio et al., 1986), initiated subsequent surveillance activities particularly in Germany, the Netherlands, Denmark and the UK (King et al., 2004). This may be one explanation for the increased number of bat rabies cases reported in Europe in 1986 and Following this peak, the number of positive bats per year ranged between 6 and 53 with an average number of 29 (Fig. 2a). The effect of disease awareness on number of submitted animals was also evident in the UK (Harris et al., 2006), where increase was observed after the tragic rabies death of a Scottish biologist after EBLV-2 infection (Fooks et al., 2003). The peak of positives in the third quarter (Fig. 2b), was also observed in individual European countries, for example, Germany (Müller et al., 2007) and the Netherlands (van der Poel et al., 2005). It is likely an effect of the higher activities of bat handlers, for example, the control of maternity colonies and banding of juveniles etc., and thus, a higher likelihood of contact with diseased animals. However, it may also reflect a disease-specific seasonal pattern. For instance, in Colorado, United States, it was shown that the rabies infections clearly followed the cyclic behaviour of bats (George et al., 2011). Bat rabies cases in Europe seem to concentrate in the lowlands of the Netherlands, Germany and Denmark. While a higher number of cases were also reported from Poland, bat rabies seems to be sporadic in Eastern European countries (Fig. 1). However, the data analysed indicate that the level of surveillance is very heterogeneous (Table 2). While some countries only test individual bats, in the UK for instance on average more than 1000 bats are submitted annually, through close collaboration between public and animal health authorities with other stakeholder groups. As stated in the EUROBATS agreement, the collaboration between bat biologists and rabies scientist is a prerequisite. Thus, in some European countries where the number of bat preservationists is small and where they are not well organized, any attempt to establish bat rabies surveillance is also hampered. Also, the remoteness in some parts of Europe may prevent the establishment of effective bat rabies surveillance per se. Therefore, the reasons for countries that have not submitted any data are elusive. Possibly, in some countries which are historically rabies-free the intensity of classical rabies surveillance may be low and may not cover bat rabies. In fact, Norway does not have bat rabies surveillance and Portugal intends to start bat rabies surveillance in the future. Also, the awareness for bat rabies may not be sufficient to encourage people to submit dead grounded or sick animals. To understand the epidemiology of the diverse bat lyssavirus infections, it is important to have comprehensive data on bat samples, for example, geographical origin, age, sex and species. The latter is most important as about 52 different bat species occur in Europe ( covering a diversity of biological niches. Furthermore, it seems that some bat lyssaviruses have a certain reservoir host association. Unfortunately, data submission to the RBE database only requests information on the mammal order, that is, bats (Chiroptera), as historically, the focus of this database was on classical rabies. Therefore, as part of this study, the exact bat species tested were requested from the contributors to the RBE. Since only few countries completed the respective questionnaire, it is difficult to assess whether species identification is regularly performed in the non-responding countries. Based on the information provided, it was shown that the Common pipistrelle bat (Pipistrellus pipistrellus) is the most frequently tested species. The overall proportions of bats that were tested but were not specified or the results were not submitted was 46.8%. The value of knowing the bat species is illustrated by the fact that one Greater mouse-eared bat (Myotis myotis) and one Brown longeared bat (Plecotus auritus) tested rabies positive in Poland. These species had only been associated with bat rabies in Germany before. Single rabies cases were described in a Greater mouse-eared bat (Hentschke and Hellmann, 1975) and Brown long-eared bat (Müller et al., 2007), respectively. Based on published data on passive surveillance, lyssavirus infections were detected in Eptesicus serotinus, Myotis daubentonii and Myotis dasycneme using standard FAT. Furthermore, one Natterer s bat (Myotis nattereri) also tested positive by FAT, and the isolated virus was characterized as a novel member of the lyssavirus genus (Freuling et al., 2011). According to previous publications, bat rabies cases in Europe were also found in Nyctalus noctula, Pipistrellus nathusii, Pipistrellus pipistrellus, Rhinolophus ferrumeqinum and Verspertilio murinus (King et al., 2004; Müller et al., 2007). Surprisingly, viral RNA (EBLV-1) was detected in Miniopterus schreibersii and Myotis nattereri from Spain (Serra-Cobo et al., 2002), whereas those species have also been associated with WCBV and BBLV, respectively (Table 1). While the first EBLV-2 case in Germany was detected in the frame of routine rabies diagnosis, that is, a suspect animal was submitted to the laboratory (Freuling et al., 2008), a second case was only found during a retrospective passive surveillance. In fact, the bat was stored for a year in a freezer, until it was subject of rabies testing (Freuling et al., 2012). Interestingly, some of the European bat species have never been investigated for rabies (Table 3), thus their role in the epidemiology of lyssaviruses remains elusive. The same holds true for those species where only few individuals were tested. Identifying bats to species level can be challenging 30 ª 2012 Blackwell Verlag GmbH Zoonoses and Public Health, 2013, 60, 22 34

72 Publikationen 67 J. Schatz et al. Bat Rabies Surveillance in Europe particularly as submitted samples may be in poor condition, therefore confounding reports. Standard techniques include the use of morphological keys, genetic speciation and the use of independent experts, which may lead to conflicting results. The abundance, density and availability of samples from certain bat species may also hamper higher surveillance efforts in individual countries. Therefore, comparison of incidence and or prevalence from country to country using these data is challenging, as the sampling effort and sample selection criteria and testing techniques are not uniform. Providing consistent effort is maintained, however, comparison is more valid from year to year. All bat species in Europe are strictly protected under the Flora, Fauna, Habitat Guidelines of the European Union (92/43/EEC) and the Agreement on the Conservation of Populations of European Bats ( Therefore, invasive sampling of bats similar to classical rabies in wildlife is now prohibited. In addition to the sampling of dead found bats, several studies tried to investigate lyssavirus infections in bat colonies by testing oral swabs and sera. The selection of sampling sites may be based on previous bat rabies cases notified (Echevarria et al., 2001; Picard-Meyer et al., 2010b) or randomly selected sites. Except for a study in Spain (Echevarria et al., 2001) and single RNA-positive Daubenton s bats, the outcome of these published investigations are thus far a disillusion as all other attempts to detect viable virus or viral RNA failed (Table 5), and interpretation is confounded by differences in sensitivity of assays used. This low level of detection of virus in oral swabs to some extent corroborates experimental studies in bats, where only very few animals were found to shed virus in the saliva (Franka et al., 2008; Johnson et al., 2008; Freuling et al., 2009b). One problem associated with this fact is that the transmission of virus among bat conspecifics still remains poorly understood (Vos et al., 2007; Freuling et al., 2009a). Even the discovery of EBLV-2 in Finland during active surveillance was based on a clinically suspect animal only (Jakava-Viljanen et al., 2010a). Virus neutralizing antibodies against lyssaviruses were detected in various European bat species from different countries (Table 4), of which Tadarida teniotis and Barbastella barbastellus have never been associated with bat rabies through passive surveillance. Eptesicus bats from several countries showed measurable levels of VNAs. However, in an experimental study, none of the Eptesicus serotinus infected with EBLV-1 developed VNAs (Freuling et al., 2009b), while in Eptesicus fuscus VNAs were detected in survivors and deceased animals (Franka et al., 2008). Surprisingly, blood samples from a high number of investigated Greater mouse-eared bats (Myotis myotis) in Spain were VNAs positive (Serra-Cobo et al., 2002; Amengual et al., 2007). In contrast, data of passive rabies surveillance provide currently only two rabies cases in Myotis myotis from Germany and Poland. Although none of the Daubenton s bats experimentally infected with EBLV-2 had VNAs, free living Daubenton s bat from the UK, Switzerland and Sweden showed VNAs (Table 4). Generally, seropositivity in bats cannot be attributed to specific lyssaviruses because of the cross-reactivity of antibodies to lyssaviruses within phylogroups (Horton et al., 2010). While in the Americas where only one virus species (RABV) is responsible for rabies, four different lyssavirus species may be circulating in bats in Europe. Thus, serological tests in the New World can use the homologous test virus, whereas in Europe several modifications of non-standardized serological test procedures exist that make the results of serological tests hardly comparable as discussed previously (Freuling et al., 2009a). The lack of standardized positive control sera for each assay and differences in interpretation of serological thresholds can lead to vastly different estimates of seroprevalence. For example, a minor change in detection threshold for specific neutralization can double seroprevalence estimates. Interestingly, the first bat rabies case in Europe in 1954 also led to active surveillance activities. A total of 295 sera from Myotis myotis bats were tested for VNAs, and the investigators carefully discussed their apparently positive results (Dennig, 1958). So, what is the message of positive serological results in bats? For example, VNAs in the Natterer s bat as observed in Belgium and Scotland may be the result of EBLV-1 infection, or, based on the recent discovery of BBLV, more likely associated with this novel lyssavirus. It also remains elusive, whether the detection of VNAs in Myotis blythii is attributed to EBLV-1, 2 or BBLV infection or whether this indicates the circulation of Aravan virus, which was isolated from this bat species in Central Asia (Kuzmin et al., 2003). Likewise, the discovery of VNAs in Miniopterus schreibersii from France and Spain questions the association of this species with WCBV, for which no cross-reactivity exists. Conclusions The level of bat rabies surveillance in Europe is still very heterogeneous, despite previous recommendations (Med- Vet-Net, EUROBATS). In the United States, comparatively higher numbers of bats are submitted annually (Blanton et al., 2011). Although federal and state protections also exist for threatened and endangered species in the United States, higher population densities might cause more human encounters. Also, given the fact that bat rabies was found in all parts of the United States, awareness is likely to be higher than in Europe. Another factor that could contribute to higher submission rates is the ª 2012 Blackwell Verlag GmbH 31 Zoonoses and Public Health, 2013, 60, 22 34

73 Publikationen 68 Bat Rabies Surveillance in Europe J. Schatz et al. encouragement to submit bats from the public if a person believes they may have been bitten. A similar approach is not used in Europe. Here, the EUROBATS agreement specifically stipulates that only dead bats should be submitted and tested for rabies, and currently passive surveillance is considered priority where resources are limited. The growing body of evidence also provided by active surveillance adds useful information regarding the dynamics of infection in natural populations, which will also help to inform about public and animal health risks. Standardized serological and virus detection techniques are needed, to aid comparison of those results. EURO- BATS also emphasizes that this surveillance should be in close cooperation with bat biologists. Therefore, to establish and increase bat rabies surveillance a network of bat biologists needs to be present and should be encouraged where missing. Also, as with any other disease surveillance vigilance and awareness needs to be at a high level to guarantee a submission of any dead found or grounded bats. The focus of bat rabies surveillance should be on testing of dead or moribund animals. Resulting positive FAT results should be further analysed to identify the lyssavirus species and all bats submitted for testing should be identified to species level, either by morphological or by genetic features. International harmonization of identification techniques would also allow more robust comparison between countries. The current data reporting for rabies in Europe, the WHO RBE is focused on classical rabies. Future developments should include the submission of additional data to bat rabies surveillance, for example, the virus species, bat species, geographical origin etc. Given the discovery of a novel lyssavirus in central Europe (Freuling et al., 2011) bat rabies surveillance should be maintained at a high level where already existing or should be established following recommendations to better assess the veterinary and public health impact of bat lyssaviruses in Europe. Acknowledgements The efforts of numerous European bat handlers to collect and submit bats for testing are gratefully acknowledged. The authors wish to thank two anonymous reviewers for their valuable comments. Also thanks to the contributors to the WHO RBE for their continuous data submission, and Anke Kliemt for excellent technical support. This study was partially funded by the BMBF grant 01KI1016A and Defra grants SV3500, SV3034 and SE0423. The authors are also grateful to the working group of Research and Policy for Infectious Disease Dynamics programme (RAPIDD) of the Science and Technology Directorate, Department of Homeland Security. References Amengual, B., H. Bourhy, M. Lopez-Roig, and J. Serra-Cobo, 2007: Temporal dynamics of European bat Lyssavirus type 1 and survival of Myotis myotis Bats in natural colonies. PLoS ONE 2, 1 7. Anon, 2006: Agreement on the conservation of populations of Bats in Europe (EUROBATS Annex 5: bat rabies). Badrane, H., C. Bahloul, P. Perrin, and N. Tordo, 2001: Evidence of two Lyssavirus phylogroups with distinct pathogenicity and immunogenicity. J. Virol. 75, Blanton, J. D., D. Palmer, J. Dyer, and C. E. Rupprecht, 2011: Rabies surveillance in the United States during J. Am. Vet. Med. Assoc. 239, Botvinkin, A. D., E. M. Poleschuk, I. Kuzmin, T. I. Borisova, S. V. Gazaryan, P. Yager, and C. E. Rupprecht, 2003: Novel lyssaviruses isolated from bats in Russia. Emerg. Infect. Dis. 9, Bourhy, H., B. Kissi, M. Lafon, D. Sacramento, and N. Tordo, 1992: Antigenic and molecular characterization of bat rabies virus in Europe. J. Clin. Microbiol. 30, Brookes, S. M., J. N. Aegerter, G. C. Smith, D. M. Healy, T. A. Joliffe, S. M. Swift, I. Mackie, S. Pritchard, P. A. Racey, N. P. Moore, and A. R. Fooks, 2005: European bat lyssavirus in Scottish bats. Emerg. Infect. Dis. 11, Carini, A., 1911: Sur une grande Épizootie de rage. Annales de L Institut Pasteur (Paris) 25, Calisher, C. H., J. E. Child, H. Field, K. V. Holmes, and T. Schountz, 2006: Bats: important reservoir hosts of emerging viruses. Clin. Microbiol. Rev. 19, Cliquet, F., C. Freuling, M. Smreczak, W. H. M. van der Poel, D. L. Horton, A. R. Fooks, E. Robardet, E. Picard-Meyer, and T. Müller, 2010: Development of harmonised schemes for monitoring and reporting of rabies in animals in the European Union. Scientific Report submitted to EFSA (Q ). Dacheux, L., F. Larrous, A. Mailles, D. Boisseleau, O. Delmas, C. Biron, C. Bourchier, F. Ilari, T. Lefranc, F. Raffi, M. Goudal, and H. Bourhy, 2009: European bat lyssavirus transmission among cats, Europe. Emerg. Infect. Dis., 15, Dennig, H. K., 1958: Untersuchungen über die Bedeutung der Fledermäuse für den gegenwärtigen Tollwutseuchenzug in Deutschland. Hannover. Echevarria, J. E., A. Avellon, J. Juste, M. Vera, and C. Ibanez, 2001: Screening of active lyssavirus infection in wild bat populations by viral RNA detection on oropharyngeal swabs. J. Clin. Microbiol., 39, Fooks, A. R., L. M. McElhinney, D. J. Pounder, C. J. Finnegan, K. Mansfield, N. Johnson, S. M. Brookes, G. Parsons, K. White, P. G. McIntyre, and D. Nathwani, 2003: Case report: Isolation of a European bat lyssavirus type-2a from a Fatal Human case of Rabies Encephalitis. J. Med. Virol. 71, ª 2012 Blackwell Verlag GmbH Zoonoses and Public Health, 2013, 60, 22 34

74 Publikationen 69 J. Schatz et al. Bat Rabies Surveillance in Europe Franka, R., N. Johnson, T. Muller, A. Vos, L. Neubert, C. Freuling, C. E. Rupprecht, and A. R. Fooks, 2008: Susceptibility of North American big brown bats (Eptesicus fuscus to infection with European bat lyssavirus type 1. J. Gen. Virol, 89, Freuling, C., E. Grossmann, F. Conraths, A. Schameitat, J. Kliemt, E. Auer, I. Greiser-Wilke, and T. Muller, 2008: First isolation of EBLV-2 in Germany. Vet. Microbiol., 131, Freuling, C., A. Vos, N. Johnson, A. Fooks, and T. Muller, 2009a: Bat rabies - a Gordian knot? Berl. Munch. Tierarztl. Wochenschr., 122, Freuling, C., A. Vos, N. Johnson, I. Kaipf, A. Denzinger, L. Neubert, K. Mansfield, D. Hicks, A. Nunez, N. Tordo, C. Rupprecht, A. Fooks, and T. Muller, 2009b: Experimental infection of serotine bats (Eptesicus serotinus with European bat lyssavirus type 1a. J. Gen. Virol. 90, Freuling, C., M. Beer, F. J. Conraths, S. Finke, B. Hoffmann, B. Keller, J. Kliemt, T. C. Mettenleiter, E. Muhlbach, J. P. Teifke, P. Wohlsein, and T. Muller, 2011: Novel Lyssavirus in Natterer s Bat, Germany. Emerg. Infect. Dis. 17, Freuling, C., J. Kliemt, S. Schares, D. Heidecke, R. Driechciarz, J. Schatz, and T. Müller, 2012: Detection of European bat lyssavirus 2 (EBLV-2) in a Daubenton s bat from Magdeburg, Germany. Berl. Munch. Tierarztl. Wochenschr. 125, George, D. B., C. T. Webb, M. L. Farnsworth, T. J. O Shea, R. A. Bowen, D. L. Smith, T. R. Stanley, L. E. Ellison, and C. E. Rupprecht, 2011: Host and viral ecology determine bat rabies seasonality and maintenance. Proc. Natl. Acad. Sci. U. S. A. 108, Harris, S. L., S. M. Brookes, G. Jones, A. M. Hutson, and A. R. Fooks, 2006: Passive surveillance (1987 to 2004) of United Kingdom bats for European bat lyssaviruses. Vet. Rec. 159, Harris, S. L., J. N. Aegerter, S. M. Brookes, L. M. McElhinney, G. Jones, G. C. Smith, and A. R. Fooks, 2009: Targeted surveillance for European bat lyssaviruses in English bats ( ). J. Wildl. Dis. 45, Hentschke, J., and E. Hellmann, 1975: Nachweis der Tollwut bei einer Fledermaus in Berlin. Berl. Munch. Tierarztl. Wochenschr. 88, Horton, D. L., L. M. McElhinney, D. A. Marston, J. L. N. Wood, C. A. Russell, N. Lewis, I. V. Kuzmin, R. A. M. Fouchier, A. D. M. E. Osterhaus, A. R. Fooks, and D. J. Smith, 2010: Quantifying antigenic relationships among the Lyssaviruses. J. Virol 84, Hostnik, P., D. Rihtaric, P. Presetnik, M. Podgorelec, M. S. Pavlinic, and I. Toplak, 2010: Determination of bat lyssavirus in Slovenia. Zdrav. Vestn. 79, Jakava-Viljanen, M., T. Lilley, E. M. Kyheroinen, and A. Huovilainen, 2010a: First encounter of European bat lyssavirus type 2 (EBLV-2) in a bat in Finland. Epidemiol. Infect. 138, Jakava-Viljanen, M., L. Thomas, E. M. Kyheröinen, and A. Huovilainen, 2010b: Bats rabies in Finland 2009, Berlin, 19th 21st of February Johnson, N., A. Vos, L. Neubert, C. Freuling, K. Mansfield, I. Kaipf, A. Denzinger, D. Hicks, A. Nunez, R. Franka, C. Rupprecht, T. Muller, and A. Fooks, 2008: Experimental study of European bat lyssavirus type-2 infection in Daubenton s bats (Myotis daubentonii). J. Gen. Virol. 89, Johnson, N., A. Vos, C. Freuling, N. Tordo, A. R. Fooks, and T. Müller, 2010: Human rabies due to lyssavirus infection of bat origin. Vet. Microbiol. 142, King, A. A., J. Haagsma, and A. Kappeler, 2004: Lyssavirus infections in European bats. in: King, A. A., A. R. Fooks, M. Aubert, and A. I. Wandeler (eds), Historical Perspective of Rabies in Europe and the Mediterranean Basin, pp OIE, Paris. Klein, F., L. Audry, F. J, and H. Bourhy, 2007: First clue of circulation of Lyssaviruses in bat populations. In: Proceedings of the Belgian Wildlife Disease Society. 2nd Symposium: Wildlife Diseases Environment and Man, Brussels, 13th October Kuzmin, I. V., L. A. Orciari, Y. T. Arai, J. S. Smith, C. A. Hanlon, Y. Kameoka, and C. E. Rupprecht, 2003: Bat lyssaviruses (Aravan and Khujand from Central Asia: phylogenetic relationships according to N, P and G gene sequences. Virus Res. 97, Kuzmin, I. V., G. J. Hughes, A. D. Botvinkin, L. A. Orciari, and C. E. Rupprecht, 2005: Phylogenetic relationships of Irkut and West Caucasian bat viruses within the Lyssavirus genus and suggested quantitative criteria based on the N gene sequence for lyssavirus genotype definition. Virus Res. 111, Kuzmin, I. V., A. E. Mayer, M. Niezgoda, W. Markotter, B. Agwanda, R. F. Breiman, and C. E. Rupprecht, 2010: Shimoni bat virus, a new representative of the Lyssavirus genus. Virus Res. 149, Lumio, J., M. Hillbom, R. Roine, L. Ketonen, M. Haltia, M. Valle, E. Neuvonen, and J. Lähdewirta, 1986: Human rabies of bat origin in europe. Lancet 327, Marston, D. A., D. L. Horton, C. Ngeleja, K. Hampson, L. M. McElhinney, A. C. Banyard, D. Haydon, S. Cleaveland, C. E. Rupprecht, M. Bigambo, A. R. Fooks, and T. Lembo, 2012: Ikoma Lyssavirus, Highly Divergent Novel Lyssavirus in an African Civet. Emerg. Infect. Dis. 18, Med-Vet-Net Working Group, 2005: Passive and active surveillance of bat lyssavirus infections. Rabies Bull. Euro. 29, 5. Megali, A., G. Yannic, M. L. Zahno, D. Brugger, G. Bertoni, P. Christe, and R. Zanoni, 2010: Surveillance for European bat lyssavirus in Swiss bats. Arch. Virol. 155, Meslin, F. X., 2007: Thirty years of WHO Rabies Bulletin Europe - a reflection. Rabies Bull. Eur, 31, 8 9. Mohr, W., 1957: Die Tollwut. Med. Klin. 52, Müller, T., J. Cox, W. Peter, R. Schäfer, N. Johnson, L. M. McElhinney, J. L. Geue, K. Tjornehoj, and A. R. Fooks, 2004: Spill-over of European bat lyssavirus type 1 into a stone marten (Martes foina in Germany. J. Vet. Med. B 51, ª 2012 Blackwell Verlag GmbH 33 Zoonoses and Public Health, 2013, 60, 22 34

75 Publikationen 70 Bat Rabies Surveillance in Europe J. Schatz et al. Müller, T., N. Johnson, C. M. Freuling, A. R. Fooks, T. Selhorst, and A. Vos, 2007: Epidemiology of bat rabies in Germany. Arch. Virol. 152, Perez-Jorda, J. L., C. Ibanez, M. Munozcervera, and A. Tellez, 1995: Lyssavirus in Eptesicus-Serotinus (Chiroptera, Vespertilionidae. J. Wildl. Dis. 31, Picard-Meyer, E., J. Barrat, E. Tissot, A. Verdot, C. Patron, M. J. Barrat, and F. Cliquet, 2006: Bat rabies surveillance in France, from 1989 through May Dev. Biol. Stand. 125, Picard-Meyer, E., C. Borel, D. Jouan, J. Barrat, F. Boue, M. Moinet, A. Berlioz-Arthaut, and F. Cliquet, 2010a: Discovery and monitoring of an infected serotine reproduction colony, Berlin, 19th 21st of February Picard-Meyer, E., C. Borel, M. Wasniewski, A. Servat, F. Boue, and F. Cliquet, 2010b: Discovery and monitoring of reproduction colony of Eptesicus serotinus naturally infected by EBLV-1 in France. In: Proc. XXI Rabies in Americas Meeting, Guadalajara, Mexico, October Picard-Meyer, E., M.-J. Dubourg-Savage, L. Arthur, M. Barataud, D. Bécu, S. Bracco, C. Borel, G. Larcher, B. Meme-Lafond, M. Moinet, E. Robardet, M. Wasniewski, and F. Cliquet, 2011: Active surveillance of bat rabies in France: A 5-year study ( ). Vet. Microbiol. 151, van der Poel, W. H. M., R. Van der Heide, E. R. A. M. Verstraten, K. Takumi, P. H. C. Lina, and J. A. Kramps, 2005: European bat lyssaviruses, the Netherlands. Emerg. Infect. Dis. 11, Presetnik, P., M. Pogdgorelec, P. Hostnik, D. Rihtarič, and I. Toplak, 2010: Sunny new from the sunny side of the Alps - active surveillance for lyssaviruses in bats did not reveal the presence of EBLV in Slovenia, Berlin, 19th 21st of February Scottish Natural Heritage, 2009: SNH releases latest bat lyssavirus monitoring results. Serra-Cobo, J., B. Amengual, C. Abellan, and H. Bourhy, 2002: European bat Lyssavirus infection in Spanish bat populations. Emerg. Infect. Dis. 8, SVA, National Veterinary Institute, 2009: Surveillance and Control Programmes: Domestic and Wild Animals in Sweden 2008, SVA Report series, 11, SVA, National Veterinary Institute, 2010: Surveillance of Zoonotic and Other Animal Disease Agents in Sweden 2009, SVA Report series, 22, Tjornehoj, K., A. R. Fooks, J. S. Agerholm, and L. Ronsholt, 2006: Natural and Experimental Infection of Sheep with European Bat Lyssavirus Type-1 of Danish Bat Origin. J. Comp. Pathol. 134, Vazquez-Moron, S., J. Juste, C. Ibanez, C. Aznar, E. Ruiz- Villamor, and J. E. Echevarria, 2008a: Asymptomatic rhabdovirus infection in meridional serotine bats (Eptesicus isabellinus) from Spain. Dev. Biol. (Basel) 131, Vazquez-Moron, S., J. Juste, C. Ibanez, E. Ruiz-Villamor, A. Avellon, M. Vera, and J. E. Echevarria, 2008b: Endemic Circulation of European Bat Lyssavirus Type 1 in Serotine Bats, Spain. Emerg. Infect. Dis. 14, Venters, H. D., W. R. Hoffert, J. E. Scatterday, and A. V. Hardy, 1954: Rabies in Bats in Florida. Am. J. Public Health 44, Vos, A., I. Kaipf, A. Denzinger, A. R. Fooks, N. Johnson, and T. Müller, 2007: European bat lyssaviruses - an ecological enigma. Acta Chiropt. 9, Vranješ, N., M. Paunović, V. Milićević, S. Stankov, B. Karapandža, U. Ungurović, and D. Lalošević, 2010: Passive and active surveillance of lyssaviruses in bats in Serbia. 2nd International Berlin Bat Meeting: Bat Biology and Infectious Diseases, 94, Leibnitz Institute for Zoo and Wildilfe Research (IZW), Berlin. World Health Organisation, 2005: Expert Consultation on Rabies, First report. World Health Organ. Tech. Rep. Ser. 931, Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1. Results of the questionnaire on passive surveillance. 34 ª 2012 Blackwell Verlag GmbH Zoonoses and Public Health, 2013, 60, 22 34

76 Publikationen 71 Table S1. Results of the questionnaire on passive surveillance. Numbers of bats tested and rabies positive thereof () per species are shown. Species Czech Republic Hungary Poland Serbia Spain Switzerland unknown (8) (8) B. barbastellus E. isabellinus 14 (6) 14 (6) E. nilssonii E. serotinus 1 5 (2) 8 (8) 8 4 (1) 2 28 (11) H. savii Mi. schreibersii M. alcathoe 2 2 M. aurascens 3 3 M. bechsteinii 2 2 M. blythii M. capaccinii M. daubentonii M. emarginatus M. myotis 1 (1) (1) M. mystacinus M. nattereri 3 3 Myotis spp. 1 1 N. lasiopterus 9 9 N. leisleri 4 4 N. noctula P. kuhlii P. nathusii P. pipistrellus P. pygmaeus 9 9

77 Publikationen 72 Pipistrellus spp. 8 8 Pl. auritus 1 1 (1) (1) Pl. austriacus 2 2 Pl. macrobullaris R. euryale 3 3 R. ferrumeqinum R. hipposideros 3 3 T. teniotis V. murinus (2) 431 (18) (7) (27)

78 Publikationen 73 Enhanced Passive Bat Rabies Surveillance in Indigenous Bat Species from Germany - A Retrospective Study Schatz, J.; Freuling, C. M.; Auer, E.; Goharriz, H.; Harbusch, C.; Johnson, N.; Kaipf, I.; Mettenleiter, T. C.; Mühldorfer, K.; Mühle, R.-U.; Ohlendorf, B.; Pott-Dörfer, B.; Prüger, J.; Sheikh Ali, H.; Stiefel, D.; Teubner, J.; Ulrich, R. G.; Wibbelt, G. and T. Müller PLoS Neglected Tropical Diseases 2014

79 Publikationen 74 Enhanced Passive Bat Rabies Surveillance in Indigenous Bat Species from Germany - A Retrospective Study Juliane Schatz 1., Conrad Martin Freuling 1. *, Ernst Auer 2, Hooman Goharriz 3, Christine Harbusch 4, Nicholas Johnson 3, Ingrid Kaipf 5, Thomas Christoph Mettenleiter 1, Kristin Mühldorfer 6, Ralf-Udo Mühle 7, Bernd Ohlendorf 8,Bärbel Pott-Dörfer 9, Julia Prüger 10, Hanan Sheikh Ali 11, Dagmar Stiefel 12, Jens Teubner 13, Rainer Günter Ulrich 11, Gudrun Wibbelt 14, Thomas Müller 1 1 Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, WHO Collaborating Centre for Rabies Surveillance and Research, Greifswald - Insel Riems, Germany, 2 Arbeitskreis Fledermäuse Bodensee-Oberschwaben, Naturschutzbund Deutschland e.v., Überlingen, Germany, 3 Wildlife Zoonoses and Vector Borne Diseases Research Group, Animal Health and Veterinary Laboratories Agency (AHVLA), Weybridge, Surrey, United Kingdom, 4 Naturschutzbund Saarland e.v., Arbeitsgemeinschaft Fledermausschutz, Perl-Kesslingen, Germany, 5 Eberhard Karls Universität Tübingen, Tübingen, Germany, 6 Freie Universität Berlin, Berlin, Germany, 7 University of Potsdam, Department of Animal Ecology, Potsdam, Germany, 8 Biosphärenreservat Karstlandschaft Südharz, Landesreferenzstelle für Fledermausschutz Sachsen-Anhalt, Robla, Germany, 9 Niedersächsischer Landesbetrieb für Wasserwirtschaft, Küsten- und Naturschutz, Hannover, Germany, 10 Interessengemeinschaft für Fledermausschutz und -forschung in Thüringen e.v., Schweina, Germany, 11 Friedrich-Loeffler-Institut, Institute for Novel and Emerging Infectious Diseases, Greifswald - Insel Riems, Germany, 12 Staatliche Vogelschutzwarte für Hessen, Rheinland-Pfalz und Saarland, Frankfurt am Main, Germany, 13 Landesamt für Umwelt, Gesundheit und Verbraucherschutz Land Brandenburg, Naturschutzstation Zippelsförde, Zippelsförde, Germany, 14 Leibniz-Institute for Zoo- und Wildlife Research, Berlin, Germany Abstract In Germany, rabies in bats is a notifiable zoonotic disease, which is caused by European bat lyssaviruses type 1 and 2 (EBLV-1 and 2), and the recently discovered new lyssavirus species Bokeloh bat lyssavirus (BBLV). As the understanding of bat rabies in insectivorous bat species is limited, in addition to routine bat rabies diagnosis, an enhanced passive surveillance study, i.e. the retrospective investigation of dead bats that had not been tested for rabies, was initiated in 1998 to study the distribution, abundance and epidemiology of lyssavirus infections in bats from Germany. A total number of 5478 individuals representing 21 bat species within two families were included in this study. The Noctule bat (Nyctalus noctula) and the Common pipistrelle (Pipistrellus pipistrellus) represented the most specimens submitted. Of all investigated bats, 1.17% tested positive for lyssaviruses using the fluorescent antibody test (FAT). The vast majority of positive cases was identified as EBLV-1, predominately associated with the Serotine bat (Eptesicus serotinus). However, rabies cases in other species, i.e. Nathusius pipistrelle bat (Pipistrellus nathusii), P. pipistrellus and Brown long-eared bat (Plecotus auritus) were also characterized as EBLV-1. In contrast, EBLV-2 was isolated from three Daubenton s bats (Myotis daubentonii). These three cases contribute significantly to the understanding of EBLV-2 infections in Germany as only one case had been reported prior to this study. This enhanced passive surveillance indicated that besides known reservoir species, further bat species are affected by lyssavirus infections. Given the increasing diversity of lyssaviruses and bats as reservoir host species worldwide, lyssavirus positive specimens, i.e. both bat and virus need to be confirmed by molecular techniques. Citation: Schatz J, Freuling CM, Auer E, Goharriz H, Harbusch C, et al. (2014) Enhanced Passive Bat Rabies Surveillance in Indigenous Bat Species from Germany - A Retrospective Study. PLoS Negl Trop Dis 8(5): e2835. doi: /journal.pntd Editor: Charles E. Rupprecht, The Global Alliance for Rabies Control, United States of America Received November 20, 2013; Accepted March 16, 2014; Published May 1, 2014 Copyright: ß 2014 Schatz et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was undertaken in the frame of a lyssavirus research network financially supported by the German Ministry for Education and Research (BMBF, grant no. 01KI1016A). The authors are also grateful to the Adolf and Hildegard Isler- Stiftung, Germany for their continued support. HSA acknowledges support for a scholarship from the German Academic Exchange Service (DAAD) desk number 413, Eastern and southern Africa, code number A/09/ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * Conrad.Freuling@fli.bund.de. These authors contributed equally to this work. Introduction Lyssaviruses are non-segmented negative-strand RNA viruses of the order Mononegavirales, family Rhabdoviridae and causative agents of rabies in bats and other mammals as well as in humans [1]. While rabies in dogs and other carnivores has been known since antiquity, the first evidence of rabies in haematophagous and insectivorous bats was reported from the Americas in the first half of the 20th century [2]. Since 1954, bat rabies cases have also been reported from other continents. Antigenic and genetic analyses revealed the diversity of different lyssavirus species, and to date, besides classical rabies virus (RABV), thirteen additional lyssaviruses have been discovered, mostly in bats [3]. Beyond Europe, Lagos bat virus (LBV), Mokola virus (MOKV), Duvenhage virus (DUVV), Shimoni bat virus (SHBV), and Ikoma lyssavirus (IKOV) were found in Africa. In Asian bat species, Aravan virus (ARAV), Khujand virus (KHUV), and Irkut virus (IRKV) were isolated. With the exception of MOKV and IKOV, all of those viruses were detected in bats [3]. In Australia, which has a long history of freedom from classical rabies, Australian bat lyssavirus (ABLV) is found in insectivorous and pteropid bats [4]. In Europe, bat rabies is also caused by several lyssavirus species. Between 1977 and 2012, a total of 1039 bat rabies cases were reported from European countries ( PLOS Neglected Tropical Diseases 1 May 2014 Volume 8 Issue 5 e2835

80 Publikationen 75 Enhanced Bat Rabies Surveillance, Germany Author Summary According to the World Health Organization rabies is considered both a neglected zoonotic and a tropical disease. The causative agents are lyssaviruses which have their primary reservoir in bats. Although bat rabies is notifiable in Germany, the number of submitted bats during routine surveillance is rarely representative of the natural bat population. Therefore, the aim of this study was to include dead bats from various sources for enhanced bat rabies surveillance. The results show that a considerable number of additional bat rabies cases can be detected, thus improving the knowledge on the frequency, geographical distribution and reservoir-association of bat lyssavirus infections in Germany. The overall proportion of positives was lower than during routine surveillance in Germany. While the majority of cases were found in the Serotine bat and characterized as European bat lyssavirus type 1 (EBLV-1), three of the four EBLV-2 infections detected in Germany were found in Myotis daubentonii during this study. bulletin.org). The majority was characterized as European bat lyssavirus type 1 (EBLV-1) isolated from Eptesicus bat species (E. serotinus, E. isabellinus) [5]. Genetically, EBLV-1 can be divided in two subtypes, EBLV-1a and 1b [6,7]. While the EBLV-1a subtype is predominantly found in Central and Eastern Europe (France, The Netherlands, Denmark, Germany and Poland), EBLV-1b has been reported from Spain, France, Southern Germany, and central Poland [8 11]. European bat lyssavirus type 2 (EBLV-2) has been isolated from Daubenton s bats in the UK, Switzerland, Finland and Germany, and from Pond bats (M. dasycneme) in The Netherlands [12]. As of today, three Natterer s bats (Myotis nattereri) infected with the novel Bokeloh bat lyssavirus (BBLV) have been found in Germany and France [13 15]. A single detection of the West Caucasian bat virus (WCBV) in a Schreiber s bent-winged bat (Miniopterus schreibersii) has been reported from Western Caucasus Mountains [16]. Interestingly, specific RNA from a putative new lyssavirus named Lleida bat lyssavirus (LLEBV) was detected in brain material from the same bat species collected in Spain [17]. The public health relevance of bat rabies in general is highlighted by the fact that most of the bat associated lyssaviruses have caused human rabies [18]. In Europe, both EBLV-1 and EBLV-2 were responsible for four confirmed human casualties [19]. Also, sporadic spill-over infections of EBLV-1 to terrestrial mammals have been reported, i.e. in sheep in Denmark, two cats in France and a stone marten (Martes foina) in Germany [20 22]. Because of the zoonotic character of bat lyssaviruses knowledge about distribution, abundance and epidemiology is important to estimate and subsequently reduce the public health risk posed by bat rabies. Guidelines for the surveillance of bat lyssaviruses in Europe were established by the European research consortium Med-Vet-Net [23] and supported by EUROBATS [24]. The investigation of sick or dead bats for lyssavirus antigen in brain samples (passive surveillance) and testing of oro-pharyngeal swab samples and serum samples from free-living indigenous bats (active surveillance) for the presence of viral RNA or virus neutralizing antibodies, respectively, were recommended. However, the levels of active and passive bat rabies surveillance in Europe are still very heterogeneous despite previous recommendations [5]. Based on published data, active surveillance provides only limited information and cannot replace passive bat rabies surveillance [25]. Comprehensive passive bat rabies surveillance was conducted in The Netherlands [26], the United Kingdom [27], France [28] and Germany [10]. With the exception of Germany, passive surveillance in these countries is realized by only one or two cooperating departments investigating all bats submitted from the whole country. In contrast, rabies diagnosis in Germany is the responsibility of the sixteen federal states [10]. Dead or diseased bats with symptoms suggestive of rabies, particularly after contact with humans (bites and scratches) have to be submitted and tested for lyssavirus infection in the regional veterinary laboratories. While cases of this notifiable disease in carnivores and bats were reported to the National Reference Laboratory for Rabies at the WHO Collaborating Centre for Rabies Surveillance and Research (FLI Riems, Germany), the number of bats tested negative was only sporadically submitted. Furthermore, the identification of bats to species level is generally missing as in some other European countries [5]. Therefore, routine bat rabies surveillance in Germany has relied on limited and opportunistic sampling which may not be representative of the true epidemiological situation [10]. To overcome these limitations and to obtain further information on the epidemiology of bat rabies in Germany an enhanced passive retrospective surveillance study was started at FLI in In this study, the focus was on dead bats excluded from routine diagnostic testing. This included bats obtained from (private) collections from different parts of Germany. Each sample was identified to species level, partly by molecular tools and tested for lyssavirus infection. Here, we present the data from this study and compare it with published data from routine diagnostic screening. Material and Methods Ethics statement Dead bats were submitted under the prevailing laws of the respective federal states and following EUROBATS guidelines [24]. Because this study was in the frame of a surveillance programme conducted by the national reference laboratory for rabies no further permits were necessary. Sample collection Starting in 1998, on a federal state level bat conservationists, as well as various institutions and authorities (e.g. Nature and Biodiversity Conservation Union (NABU, Germany), Museum of Natural Science, wildlife care centers) were requested and encouraged to submit dead bats for rabies diagnosis irrespective of the circumstances of acquisition. Archived or newly acquired bats were submitted from all 16 German federal states by local bat biologists during long-time monitoring or routine inspection of maternity roosts, wintering grounds or were killed by cats, wind turbines or unintentional removal of roosts. All bats were stored frozen prior to submission in a chilled state. Bat identification Usually, bat carcasses were submitted with additional information, e.g. geographical origin, date found, sex, age and species identification. Bats without species information were determined to genus or even to species level using external morphological features [29]. Bat carcasses which were degraded or damaged and those suspected to represent cryptic bat species (e.g. Myotis mystacinus, M. brandtii and M. alcathoe) were identified by a mitochondrial cytochrome b (cyt b) gene specific PCR [30] if not restricted by museum specific preservation requirements. For this purpose, wing membrane samples were collected and stored separately in Eppendorf tubes at 280uC until analysis. For DNA PLOS Neglected Tropical Diseases 2 May 2014 Volume 8 Issue 5 e2835

81 Publikationen 76 Enhanced Bat Rabies Surveillance, Germany preparation a small piece ( mm) of each sample was lysed overnight (56uC, 400 rpm) using 3 ml proteinase K (10 mg/ml) and 300 ml lysis buffer (50 mm KCL, 10 mm TRIS-HCL (ph 9.0), 0.45% nonidet NP 40 and 0.45% Tween 20). After centrifugation (1 min, rpm) the supernatant was stored at 220uC. For PCR amplification two primer pairs (CytB Uni fw: 59- CATCMTGATGAAAYTTYGG-39 and CytB Uni rev: 59- ACTGGYTGDCCBCCRATTCA-39 [30]; HG for: 59-CACTA- CACATCAGAYAC-39 and HG rev: 59-AAGGCGAA- GAATCGRGT-39) were used to obtain fragments of about 950 bp and 400 bp, respectively. The latter primer mix was developed based on reference material submitted to the AHVLA to identify all bat species indigenous to the UK (data not shown). The PCR reaction mix (total volume of 25 ml) consisted of RNase-free water (17.65 ml), 25 mm of each dntp (0.5 ml), 50 mm MgCl2 (0.75 ml), 10 pmol/ml of each primer (0.5 ml), 10x PCR RxN Buffer (2.5 ml), (0.1 ml) Platinum-Taq DNA Polymerase (Invitrogen, Darmstadt, Germany) and 2.5 ml template DNA. The amplification was performed with the following temperature profile: 3 min at 94uC (initial denaturation), followed by 50 cycles of 30 s at 94uC (denaturation), 30 s at 47uC (annealing), 1 min at 72uC (elongation) and a final extension at 72uC for 10 min. Amplification of the expected products was confirmed in a 1% agarose gel stained with ethidium bromide or SYBR safe DNA gel stain. PCR products were then purified (NucleoSpin Gel and PCR Clean-up kit, Macherey-Nagel, Düren, Germany) and sequenced using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems/Life Technologies, Carlsbad, CA, USA). The cytochrome b sequences were compared with published sequences of European bat species (GenBank) using the Basic Local Alignment Search Tool (BLAST, and the species determination was finalized by identification of the species of the highest nucleotide sequence similarity ($90%). Fluorescent antibody test (FAT) Rabies diagnosis was performed on bat brain samples which were removed either by opening of cranium or, in case of natural scientific collections, by puncture of foramen occipitale magnum using a 26-gauge needle. Lyssavirus antigen was detected by standard fluorescent antibody test (FAT) using commercially available polyclonal fluorescein isothiocyanate (FITC)-labelled anti-rabies conjugates (Behring, Marburg; SIFIN, Berlin, Germany) following standard protocols [31]. Additional tests included virus isolation in cell culture, reverse-transcription quantitative real-time polymerase chain reaction (RT-qPCR) and sequencing following RT-PCR was performed to confirm positive FAT results. Rabies Tissue Culture Infection Test (RTCIT) For virus isolation, FAT positive or inconclusive bat brain samples were homogenized in a volume of 1000 ml sterile minimum essential medium (MEM-10, with 2% Streptomycin). The resulting brain suspensions (500 ml) were subjected to the RTCIT [32], using a mouse neuroblastoma cell line (MNA 42/13, No. 411, cell culture collection for veterinary medicine, FLI). Infected cells were incubated for three days at 37uC and 5% CO 2 and then tested using FAT. A result was confirmed negative after the third consecutive cell passage. Detection of lyssavirus RNA using Polymerase Chain Reaction (PCR) RNA was extracted from 200 ml brain suspension or RTCIT supernatant using TRIzol Reagent (Invitrogen, Darmstadt, Germany)/peqGOLD TriFast (peqlab Biotechnologie GmbH, Erlangen, Germany) method. The RNA pellet was re-suspended in a volume of 20 ml bidistilled water. Samples were analysed for the presence of viral RNA using quantitative real-time PCR (RTqPCR) specific for EBLV-1/-2 as described [25]. In cases of inconclusive FAT results a conventional panlyssavirus RT-PCR was additionally performed [33]. Sequence and phylogenetic analysis All EBLV-isolates were further characterized by sequence analysis [34]. RNA was subjected to one-step RT-PCR using primers JW12 and JW6 E [33] followed by sequencing. Briefly, after amplification, PCR-products were run in a 1% agarose gel stained with ethidium bromide, excised and purified essentially as for the molecular bat species identification. Sequences were manually checked for quality, trimmed to the first 400 bp using SeqMan (Lasergene, DNASTAR, Madison, WI, USA)) and submitted to NCBI GenBank (Table S1). Sequence alignment and subsequent phylogenetic analysis was performed using MEGA 5. Further representatives of EBLV-1 and 2 were derived from GenBank for comparison (Table S2). Results From 1998 to June 2013 a total of 5478 bats from all German federal states (N = 16, Figure 1b) were investigated. The annual number of submissions to FLI of obtained specimens varied between 30 and 1200 individuals. The bats encompassed specimens from the entire study period and before, with the oldest sample originating from Among all samples, 21 out of the 23 indigenous bat species in Germany were included (Table 1), although the proportion of bat species differed per federal state. The majority of bat samples originated from Lower Saxony (N = 1252), followed by Baden- Wuerttemberg (N = 736) and Saxony-Anhalt (N = 692). In contrast, in three and two of the remaining federal states the sample size was less than 90 and 15, respectively. With the exception of a single carcass of the Lesser horseshoe bat (Rhinolophus hipposideros), all other species investigated belonged to the family Vespertilionidae. Among those, the most frequently tested bat species were the Common pipistrelle and Noctule bat followed by Serotine bat and Brown long-eared bat (Table 1). A total of 330 bats could not be identified to species level using external morphological criteria. Cyt b sequences were obtained from 119 bats, representing 15 different species (Table 1). The sequence similarity ranged between 92% and 100% when compared to publicly available sequences. Wing membrane samples from the remaining 211 individuals from natural scientific collections were not available. Most positive specimens were found in bats from Lower Saxony (N = 27), Saxony-Anhalt (N = 10) and Berlin (N = 5) (Figure 1d). Bat rabies was detected in animals from additional 10 German federal states although only sporadically (1 3 cases). No lyssavirus infection was found in bats originating from Rhineland-Palatinate (N = 108), Baden-Wuerttemberg (N = 736) and Bavaria (N = 252) (Figure 1b d). Except for a single Serotine bat for which sufficient brain material was not available, lyssaviruses were successfully isolated and sequenced from 54 and 55 bats, respectively, which had been tested FAT-positive (Table 1). The presence of EBLVs was confirmed in five different bat species (E. serotinus, P. pipistrellus, P. nathusii, Pl.auritus and M. daubentonii). The majority of viruses were identified as EBLV-1, predominately isolated from E. serotinus (N = 48). Single lyssavirus infections in other species were also characterized as EBLV-1 (Table 1). The phylogenetic analysis of PLOS Neglected Tropical Diseases 3 May 2014 Volume 8 Issue 5 e2835

82 Publikationen 77 Enhanced Bat Rabies Surveillance, Germany Figure 1. Map showing federal states of Germany (a) and geographical origin of all bat specimens coming from Schleswig-Holstein (SH, N = 362); Bremen (HB, N = 4), Hamburg (HH, N = 10), Mecklenburg-Western Pomerania (MWP, N = 131), Lower Saxony (LS, N = 1252), Berlin (B, N = 484), Brandenburg (BRB, N = 644), Saxony-Anhalt (ST, N = 692), Saxony (SN, N = 247), North Rhine Westphalia (NRW, N = 76), Hesse (HE, N = 89), Thuringia (TH, N = 296), Rhineland-Palatinate (RP, N = 108), Saarland (SL, N = 53), Baden-Wuerttemberg (BW, N = 736), Bavaria (BY, N = 252) (b) and of E. serotinus (c) collected in the study described here, and of the bat rabies cases (dot (N = 46): E. serotinus, triangle (N = 3): M. daubentonii, square (N = 3): P. pipistrellus, P. nathusii and Pl. auritus (d). doi: /journal.pntd g001 the N gene derived sequences identified the two lineages of EBLV- 1, i.e. five out of the 52 available sequences were characterized as EBLV-1b found in Serotine bats originating from Saarland (N = 1), Saxony-Anhalt (N = 3) and Saxony (N = 1) (Figure 2a). Some clustering was observed for EBLV-1a isolates from the same or from neighbouring federal states, with occasional exceptions. PLOS Neglected Tropical Diseases 4 May 2014 Volume 8 Issue 5 e2835

83 Publikationen 78 Enhanced Bat Rabies Surveillance, Germany The nucleotide sequence divergence within the EBLV-1a group was,1%. Of 160 Daubenton s bats tested, three (1.88%) individuals were rabies positive, and EBLV-2 was isolated in each case (Table 1, Figure 2b). Those infected bats were submitted from Saxony- Anhalt [35], Thuringia and Hesse. Overall, in 47 smears from different bat species investigated using the FAT small fluorescing structures indicative for lyssavirus antigen was found, but the infection could not be confirmed by other methods, e.g. RTCIT, EBLV-1/-2 specific RT-qPCR and conventional RT-PCR. Furthermore, 13.1% (N = 718) of all submitted bats could not be investigated because the carcasses were mummified or organs had autolysed (Table 1). Of all animals tested by FAT and with a reference to a date (month, N = 3714) the peak of bat finds were in July, August and September, with a second peak in February and March (Figure 3). Of those, the percentage of bats tested EBLV-positive was highest in July (N = 11, 1.95%) and August (N = 12, 1.96%). Altogether, 50 Serotine bats tested rabies positive by FAT, of which 18 were males and 11 females. Four of the positive cases were juvenile animals whereas the remaining animals were sub-adults or adults. Discussion In Germany, routine bat rabies surveillance has been reliant on limited and opportunistic sampling as a result of international, national and federal state specific legislation that often restricts the handling, submission and even testing of bats [10]. Because the current knowledge about distribution, abundance and epidemiology of bat lyssaviruses is rather fragmentary, we initiated longterm enhanced passive bat rabies surveillance in Germany. When this study was started in 1998 it was a prerequisite to collect samples through extensive lobbying, education and awareness training of local bat biologists at a federal state level to encourage submissions of bat carcasses. Only with the 2006 Agreement on the Conservation of Populations of Bats in Europe by EURO- BATS [24], which for the first time established a basis for legitimized bat rabies surveillance in Europe, the collection, submission and testing of indigenous dead bats was enabled. Within 15 years of this retrospective study (1998-June 2013) with more than 5000 bats, a six fold higher number of indigenous bats was tested for lyssavirus infections, compared to the number of bats examined during 50 years of routine surveillance in Germany [10]. We could therefore demonstrate that enhanced passive surveillance can generate an increase in submissions. Comparable studies were also conducted in The Netherlands ( , N = 3873), the UK ( , N = 4883), France ( , N = 934), and Switzerland ( , N = 837) [5], although we were able to sample more bats in a shorter period of time. Together with routine surveillance (data not shown) the passive bat rabies surveillance in Germany appears to be more intense than in most other European countries [5]. Table 1. Number of bat samples per species investigated using FAT, RTCIT, RT-qPCR and RT-PCR. Bat brain samples tested for lyssaviruses using: Number of bats FAT RTCIT RT-qPCR (positive) RT-PCR Bat species submitted sequenced (cyt b) not analysable negative positive inconclusive positive EBLV-1 EBLV-2 positive Barbastella barbastellus Eptesicus nilssonii Eptesicus serotinus Myotis bechsteinii Myotis brandtii Myotis dasycneme Myotis daubentonii Myotis emarginatus 1 1 Myotis myotis Myotis mystacinus Myotis nattereri Nyctalus leisleri Nyctalus noctula Pipistrellus kuhlii 9 9 Pipistrellus nathusii Pipistrellus pipistrellus Pipistrellus pygmaeus Plecotus auritus Plecotus austriacus Rhinolophus hipposideros 1 1 Vespertilio murinus unknown total doi: /journal.pntd t001 PLOS Neglected Tropical Diseases 5 May 2014 Volume 8 Issue 5 e2835

84 Publikationen 79 Enhanced Bat Rabies Surveillance, Germany Figure 2. Evolutionary relationships of EBLV-1 (a) and EBLV-2 strains (b) with a focus on 400 nucleotides long N-gene sequences (nt positions 1 400, numbering according to EF157976) derived from this study (boldface). The Neighbor-Joining method (p-distance, 1000 pseudoreplicates) as implemented in MEGA 5 was used. Sequence number 998 LS represents the identical sequences 959, 5300, 5304, 7471, 7467, 11647, 15730, 16902, 16908, 18720, 21836, 24525, 24529, 24832, 25495, doi: /journal.pntd g002 In this enhanced passive surveillance bats were submitted which had rarely been included in routine surveillance because they have a low likelihood of human contact (e.g. bats from caves, forests etc.) or bats from the countryside. Samples from e.g. private bat collections were included that had been stored in freezers for up to 25 years. Despite this long period of storage it was still possible to isolate lyssavirus from those brain tissues. In this retrospective study, 56 additional bat rabies cases were detected that otherwise would have been missed. Together with the number of positive cases from routine surveillance ( , N = 243) ( Germany is one of the countries in Europe with the highest number of reported bat rabies cases. Evidently, the high level of surveillance contributes to this fact. However, the influence of other factors such as abundance of reservoir species and virus prevalence needs to be studied further. To date three different bat lyssaviruses have been reported from Germany. While the presence of EBLV-1 has been known for a considerable period of time [10], EBLV-2 [33] and BBLV [13] were first isolated in 2007 and 2010, respectively, during routine bat rabies surveillance. In this retrospective study we confirm both the circulation of EBLV-1 and EBLV-2 in Germany. However, samples included in this study comprise almost all bat species indigenous in Germany. Depending on the geographical distribution, population density and their habitat use the number of submissions varied considerably per bat species. Similar to the UK, the Netherlands and Switzerland the Common pipistrelle was the most frequently submitted bat species [26,27,36]. In fact, this synanthropic species is also one of the most abundant bat species in Europe. Although rabies in this species had been reported before [37,38], in this study we confirmed an EBLV-1 infection for the first time by RTCIT, RT-qPCR and sequencing. EBLV-1 infections in species other than the Serotine bat (E. serotinus) was also found in a single Nathusius pipistrelle bat and a Brown longeared bat. All those viruses were identified as EBLV-1 and showed geographical clustering thus indicating that they resemble spillover infections from infected Serotine bats [10]. In contrast to North America, where RABV is found in most bat species with distinct lineages [39], this pattern was not found for EBLV-1 in European bats. A total of 49 Serotine bats tested EBLV-1 positive confirming that this bat species is the main reservoir for EBLV-1. Surprisingly, despite testing of individuals of this bat species originating from various regions in Germany, the majority of EBLV-1 cases was found in Serotine bats from the northwest of Germany, supporting previous studies [10]. Although the Serotine bat is abundant all over Germany, the density is higher in the northern lowlands of Germany [40], suggesting that the intraspecies transmission rate is higher so that more cases are detected, both in routine as well as in enhanced surveillance. While the situation appears similar in the Netherlands [26], the distribution of positive EBLV-1 cases in France differs insofar as those infections were detected in many parts of the country irrespective of the altitude [28]. PLOS Neglected Tropical Diseases 6 May 2014 Volume 8 Issue 5 e2835

85 Publikationen 80 Enhanced Bat Rabies Surveillance, Germany Figure 3. Number of bat specimens tested (N = 3714, black) and rabies cases (N = 46, grey) per month during 1998 until June doi: /journal.pntd g003 The majority of lyssaviruses were characterized as EBLV-1a. Similar to previous studies from the Netherlands and Germany [10,26,41], EBLV-1a sequences showed a very high level of identity. However, genetic clusters appear to be linked to defined geographic regions (Figure 2a). In the past, EBLV-1b had been sporadically detected in the German federal state of Saarland close to the French border [10,41]. Surprisingly, we could confirm the presence of the EBLV-1b subtype also in central and eastern parts of Germany. Genetically, those isolates are more closely related to an EBLV-1b isolate from Poland than with the other Saarland isolate (Figure 2a). Since Serotine bats generally do not migrate, the sporadic occurrence of EBLV-1b variants in Germany and Poland remains puzzling. However, our results could reflect a recent eastward spread of EBLV-1b although this needs further investigation. Whilst during routine surveillance in Germany only a single Daubenton s bat was found to be infected with EBLV-2 [33], we report three additional cases. Because Daubenton s bats are associated with forest habitat, detection of grounded bats by the public is limited. This is reflected by the low number of Daubenton s bats tested for lyssavirus infections in other European studies [5]. In our study a total of 160 Daubenton s bats were tested for bat lyssaviruses resulting in an estimated prevalence of 1.88% for EBLV-2. This is comparable to estimates for Switzerland (4.6%) and the UK (3.6%). The pond bat was associated with EBLV-2 infection in the Netherlands [26]. We were only able to test seven individuals of this species, and thus cannot properly assess whether this species serves as a true reservoir host or represent a spill-over infection from Daubenton s bat. Generally, irrespective of the low number of tested bats, the prevalence of EBLV-2 in Daubenton s bats seems to be lower than EBLV-1 in Serotine bats. In our study we found EBLV-1 in 13.28% of all tested Serotine bats, whilst in Spain (E. isabellinus) and in the Netherlands this proportion of positives was 20% and 21%, respectively [26,42]. Overall, 47 brain smears of 11 bat species, including the reservoir bat species E. serotinus, M. daubentonii and M. nattereri, showed a particulate staining pattern morphologically similar to anti-rabies staining in FAT. This could be regarded as typical but lyssavirus infection could not be confirmed with further tests e.g. RT-qPCR, RT-PCR or RTCIT. False positive results have been shown to occur in diagnosis of classical rabies, but at a very low percentage [43]. Degradation of samples and microbial contamination may lead to certain cross-reactions with the anti-rabies conjugates. Furthermore, cross-reactions with other viral encephalites, such as West Nile and Powassan flavivirus infection cannot be excluded [44]. Besides in reservoir species, a large proportion of these unspecific results were found in the Noctule bat. Previously, bat rabies cases had been reported sporadically in this species [45], although cases were not confirmed by virus isolation and/or sequence analysis. Further investigations are needed to establish the cause of this observation. While in this retrospective study none of the 159 Natterer s bats tested positive for BBLV, during an enhanced passive bat rabies study performed in the German federal state Bavaria BBLV was isolated from a single Natterer s bat [15]. Although with more than captures per year this is the most handled bat of all reservoir bats species (M. nattereri, E. serotinus, M. daubentonii, M. dasycneme) known to exist in Germany [D. Brockmann, Bat Marking Centre Dresden, Germany, pers. communication], this bat species is clearly underrepresented in passive surveillance due to its sylvatic mode of life making it difficult to find large numbers of dead bats of this species. PLOS Neglected Tropical Diseases 7 May 2014 Volume 8 Issue 5 e2835

86 Publikationen 81 Enhanced Bat Rabies Surveillance, Germany As stated before, EBLV-1 infections were not only detected in E. serotinus but also in three other indigenous bat species. In contrast to this study, during routine surveillance only about half of FAT positive bats were determined to species level where the majority of cases in Serotine bats were identified [10]. Thus, it cannot be excluded that more bat species are affected by lyssavirus infections. This demonstrates the importance of species identification for epidemiological evaluation as previously shown for the UK [46]. In cases where morphological species identification was not possible due to either the quality of the specimens (e.g. damaged, degraded) or the absence of morphological criteria, (i.e. cryptic bat species), samples were genetically characterized. By this we were able to characterize more than 100 bat specimens which helped to complete the dataset. Given the increasing diversity of lyssaviruses and reservoir bat species, lyssavirus positive specimens, i.e. both bat and virus need to be confirmed by molecular techniques. For example, the bat species originally described as associated with KHUV and ARAV may be incorrect [4]. Similarly, SHBV isolated from Hipposideros vittatus in Kenya, was initially described as Hipposideros commersonii [47]. Furthermore, genetic information on hosts may allow for a comparison with the viral evolution as shown for North America [39] and Eastern Europe [48]. Based on the experience gained in this project, we propose that enhanced passive surveillance for bat rabies should be continued to complement routine diagnosis. Thus, it is a prerequisite to collect dead bats as fresh as possible and freeze them as soon as possible. To this end, a close cooperation with all stakeholders involved in bat handling, monitoring and research is essential. Those dead bats should eventually be transferred to a central point where rabies diagnosis can be performed. In parallel, bats involved in human contact have to be tested by the responsible regional veterinary laboratories, to allow for prompt veterinary and human public health response. All bats need to be identified to species level by morphological and/or molecular techniques. Finally, it is of eminent importance that all data are combined into a comprehensive evaluation. Research activities, particularly surveillance efforts to gain insights into the epidemiology of bat lyssaviruses, can be regarded References 1. Kuzmin IV, Novella IS, Dietzgen RG, Padhi A, Rupprecht CE (2009) The rhabdoviruses: Biodiversity, phylogenetics, and evolution. Infect Genet Evol 9: Constantine DG, Blehert DS (2009) Bat rabies and other lyssavirus infections. Reston, VA: U. S. Geological Survey. 68 p. 3. WHO (2013) Expert Consultation on Rabies, Second report. World Health Organ Tech Rep Ser 982: Banyard AC, Hayman D, Freuling CM, Müller T, Fooks AR, et al. (2013) Bat rabies. In: Jackson AC, Wunner W, editors. Rabies. New York: Academic Press. pp Schatz J, Fooks AR, McElhinney L, Horton D, Echevarria J, et al. (2013) Bat Rabies Surveillance in Europe. Zoonoses Public Health 60: Amengual B, Whitby JE, King A, Cobo JS, Bourhy H (1997) Evolution of European bat lyssaviruses. J Gen Virol 78: Davis PL, Holmes EC, Larrous F, van der Poel WH, Tjornehoj K, et al. (2005) Phylogeography, population dynamics, and molecular evoluation of European Bat Lyssaviruses. J Virol 79: Vazquez-Moron S, Juste J, Ibanez C, Berciano JM, Echevarria JE (2011) Phylogeny of European bat Lyssavirus 1 in Eptesicus isabellinus bats, Spain. Emerg Infect Dis 17: Picard-Meyer E, Barrat J, Tissot E, Barrat MJ, Bruyere V, et al. (2004) Genetic analysis of European bat lyssavirus type 1 isolates from France. Vet Rec 154: Müller T, Johnson N, Freuling CM, Fooks AR, Selhorst T, et al. (2007) Epidemiology of bat rabies in Germany. Arch Virol 152: Smreczak M, Orlowska A, Trebas P, Zmudzinski JF. The first case of European bat lyssavirus type 1b in bats (Eptesicus serotinus) in Poland in retrospective study. Bull Vet Inst Pulawy 53: McElhinney LM, Marston DA, Leech S, Freuling CM, van der Poel WH, et al. (2013) Molecular epidemiology of bat lyssaviruses in europe. Zoonoses Public Health 60: as a true bat conservation effort, since a greater understanding of this zoonosis can help to reduce unjustified fear and misconceptions. Conclusions With enhanced passive surveillance 56 additional bat rabies cases were detected also in federal states where rabies in bats had not been found previously. Considering the large number of animals tested the prevalence was lower than in routine surveillance and likely represents the true level of lyssavirus infections in indigenous bats in Germany. Although the vast majority of cases were found in the known reservoir species Eptesicus serotinus, spill-over cases were also observed. In conclusion, all bat species need to be sampled and identified, and, since some bat species are still underrepresented, the enhanced surveillance should be maintained. Supporting Information Table S1 (DOCX) Details of EBLV isolates from Germany. Table S2 Details of additional EBLV N-gene sequences included in the phylogenetic analysis. (DOCX) Acknowledgements This study would not have been possible without the continued support and assistance of numerous bat biologists and bat conservationists. The excellent technical assistance by J. Kliemt, D. Junghans (diagnostics) and P. Wysocki (GIS) is gratefully acknowledged. Author Contributions Conceived and designed the experiments: TM CMF RUM TCM. Performed the experiments: JS TM CMF. Analyzed the data: JS TM CMF. Contributed reagents/materials/analysis tools: GW KM BO JP DS JT IK CH HSA HG BPD EA RGU NJ. Wrote the paper: JS TM CMF. 13. Freuling CM, Beer M, Conraths FJ, Finke S, Hoffmann B, et al. (2011) Novel Lyssavirus in Natterer s Bat, Germany. Emerg Infect Dis 17: Picard-Meyer E, Servat A, Robardet E, Moinet M, Borel C, et al. (2013) Isolation of Bokeloh bat lyssavirus in Myotis nattereri in France. Arch Virol 158: Freuling CM, Abendroth B, Beer M, Fischer M, Hanke D, et al. (2013) Molecular diagnostics for the detection of Bokeloh bat lyssavirus in a bat from Bavaria, Germany. Virus Res 177: Botvinkin AD, Poleschuk EM, Kuzmin I, Borisova TI, Gazaryan SV, et al. (2003) Novel lyssaviruses isolated from bats in Russia. Emerg Infect Dis 9: Ceballos NA, Moron SV, Berciano JM, Nicolas O, Lopez CA, et al. (2013) Novel lyssavirus in bat, Spain. Emerg Infect Dis 19: Johnson N, Vos A, Freuling C, Tordo N, Fooks AR, et al. (2010) Human rabies due to lyssavirus infection of bat origin. Vet Microbiol 142: Fooks AR, Brookes SM, Johnson N, McElhinney LM, Hutson AM (2003) European bat lyssaviruses: an emerging zoonosis. Epidemiol Infect 131: Müller T, Cox J, Peter W, Schäfer R, Johnson N, et al. (2004) Spill-over of European bat lyssavirus type 1 into a stone marten (Martes foina) in Germany. J Vet Med Ser B 51: Ronsholt L (2002) A New Case of European Bat Lyssavirus (EBL) Infection in Danish Sheep. Rabies Bull Europe 26: Dacheux L, Larrous F, Mailles A, Boisseleau D, Delmas O, et al. (2009) European bat lyssavirus transmission among cats, Europe. Emerg Infect Dis 15: Med Vet Net Working Group (2005) Passive and active surveillance of bat lyssavirus infections. Rabies Bull Euro 29: Anon (2006) Agreement on the Conservation of Populations of Bats in Europe (EUROBATS) Annex 5: bat rabies. PLOS Neglected Tropical Diseases 8 May 2014 Volume 8 Issue 5 e2835

87 Publikationen 82 Enhanced Bat Rabies Surveillance, Germany 25. Schatz J, Ohlendorf B, Busse P, Pelz G, Dolch D, et al. (2013) Twenty years of active bat rabies surveillance in Germany: a detailed analysis and future perspectives. Epidemiol Infect. doi: /s Poel WHM van der, Van der Heide R, Verstraten ERAM, Takumi K, Lina PHC, et al. (2005) European bat lyssaviruses, the Netherlands. Emerg Infect Dis 11: Harris SL, Brookes SM, Jones G, Hutson AM, Fooks AR (2006) Passive surveillance (1987 to 2004) of United Kingdom bats for European bat lyssaviruses. Vet Rec 159: Picard-Meyer E, Barrat J, Tissot E, Verdot A, Patron C, et al. (2006) Bat rabies surveillance in France, from 1989 through May Dev Biol (Basel) 125: Dietz C, von Helversen O (2004) Identification key to the bats of Europe - electronical publication, version 1.0. URL: Kontakt/mitarbeiter_seiten/dietzhtm. 30. Schlegel M, Ali HS, Stieger N, Groschup MH, Wolf R, et al. (2012) Molecular identification of small mammal species using novel cytochrome B gene-derived degenerated primers. Biochem Genet 50: Dean DJ, Abelseth MK, Athanasiu P (1996) The fluorescence antibody test In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies. 4th ed. Geneva: World Health Organization. pp Webster WA, Casey GA (1996) Virus isolation in neuroblastoma cell culture. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies. 4th ed. Geneva: World Health Organization. pp Heaton PR, Johnstone P, McElhinney LM, Cowley R, O Sullivan E, et al. (1997) Heminested PCR assay for detection of six genotypes of rabies and rabiesrelated viruses. J Clin Microbiol 35: Freuling C, Grossmann E, Conraths F, Schameitat A, Kliemt J, et al. (2008) First isolation of EBLV-2 in Germany. Vet Microbiol 131: Freuling C, Kliemt A, Schares S, Heidecke D, Driechciarz R, et al. (2012) Detection of European bat lyssavirus 2 (EBLV-2) in a Daubenton s bat (Myotis daubentonii) from Magdeburg, Germany. Berl Munch Tierarztl Wochenschr 125: Megali A, Yannic G, Zahno ML, Brugger D, Bertoni G, et al. (2010) Surveillance for European bat lyssavirus in Swiss bats. Arch Virol 155: Kappeler A (1989) Bat rabies surveillance in Europe. Rab Bull Eur 13: Picard-Meyer E, Barrat J, Wasniewski M, Wandeler A, Nadin-Davis S, et al. (2004) Epidemiology of rabid bats in France, 1989 to Vet Rec 155: Streicker D, Turmelle AS, Vonhof MJ, Kuzmin I, McCracken GF, et al. (2010) Host Phylogeny Constrains Cross-Species Emergence and Establishment of Rabies Virus in bats. Science 329: Boye P, Dietz M, Weber M (1998) Bats and Bat Conservation in Germany. Bonn: Bundesamt für Naturschutz. 41. Freuling C, Johnson N, Marston DA, Selhorst T, Geue L, et al. (2008) A random grid based molecular epidemiological study on EBLV isolates from Germany. Dev Biol (Basel) 131: Echevarria JE, Avellon A, Juste J, Vera M, Ibanez C (2001) Screening of active lyssavirus infection in wild bat populations by viral RNA detection on oropharyngeal swabs. J Clin Microbiol 39: Hostnik P, Strancar M, Barlic-Maganja D, Grom J (2001) Doubtful and discordant results in fluorescent antibody test for rabies diagnosing. Veterinarski Arhiv 71: Rudd RJ, Appler KA, Wong SJ (2013) The Rabies Indirect Fluorescent Antibody Test: Presence of Cross Reactions with Other Viral Encephalitides. J Clin Microbiol. doi: /jcm King AA, Haagsma J, Kappeler A (2004) Lyssavirus infections in European bats. In: King AA, Fooks AR, Aubert M, Wandeler AI, editors. Historical perspective of rabies in Europe and the Mediterranean Basin. Paris: OIE. pp Harris SL, Johnson N, Brookes SM, Hutson AM, Fooks AR, et al. (2008) The application of genetic markers for EBLV surveillance in European bat species. Dev Biol (Basel) 131: Kuzmin IV, Mayer AE, Niezgoda M, Markotter W, Agwanda B, et al. (2010) Shimoni bat virus, a new representative of the Lyssavirus genus. Virus Res 149: Bogdanowicz W, Lesinski G, Sadkowska-Todys M, Gajewska M, Rutkowski R (2013) Population genetics and bat rabies: a case study of Eptesicus serotinus in Poland. Acta Chiropt 15: PLOS Neglected Tropical Diseases 9 May 2014 Volume 8 Issue 5 e2835

88 Publikationen 83 Supplementary table 1. Details of EBLV isolates from Germany. ID. No. Genotype Bat species Year Location Federal state GenBank accesion no. Reference 905 EBLV-1a E. serotinus n. i. Zippelsförde Brandenburg KF this study 915 EBLV-1a E. serotinus 1996 Osnabrück Lower Saxony KF this study; Freuling et al., EBLV-1a E. serotinus 1991 Breddenburg Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1993 Oldendorf Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1997 Osnabrück Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1988 Aurich Lower Saxony KF this study; Müller et al., EBLV-1a P. nathusii 1992 Marienhafe Lower Saxony KF this study; Freuling et al., EBLV-1a E. serotinus n. i. Aurich Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1998 Moordorf Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1997 Emden Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1997 Plate M.-W.-Pomerania KF this study; Freuling et al., EBLV-1a E. serotinus 2000 Hitzhausen Lower Saxony KF this study; Freuling et al., EBLV-1a Pl. auritus 1996 Lingen Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus n. i. Bremen Bremen KF this study; Freuling et al., EBLV-1a P. pipistrellus 1994 Hannover Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus n. i. Osterode Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1999 Emden Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 1999 Emden Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 2000 Emden Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 2000 Emden Lower Saxony KF this study; Müller et al., EBLV-1a E. serotinus 2005 Kyritz Brandenburg KF this study; Freuling et al., EBLV-1a E. serotinus 2005 Lübbenau Brandenburg KF this study; Freuling et al., EBLV-1a E. serotinus n. i. Aurich Lower Saxony KF this study EBLV-1a E. serotinus 2004 Stedesdorf Lower Saxony KF this study EBLV-1a E. serotinus 2002 Thedinghausen Lower Saxony KF this study EBLV-1a E. serotinus 2007 Magdeburg Saxony-Anhalt KF this study EBLV-1b E. serotinus 2005 Magdeburg Saxony-Anhalt KF this study EBLV-2 M. daubentonii 2006 Magdeburg Saxony-Anhalt JQ Freuling et al EBLV-1a E. serotinus 2008 Nordhorn Lower Saxony KF this study EBLV-1a E. serotinus 2008 Halle/Saale Saxony-Anhalt KF this study EBLV-1a E. serotinus 2008 Halle/Saale Saxony-Anhalt KF this study EBLV-1b E. serotinus 2008 Magdeburg Saxony-Anhalt KF this study EBLV-1a E. serotinus 2010 Bergen M.-W.-Pomerania KF this study EBLV-1a E. serotinus 2007 Halle/Saale Saxony-Anhalt KF this study EBLV-1a E. serotinus 2009 Halle/Saale Saxony-Anhalt KF this study EBLV-1a E. serotinus 2006 Moisburg Lower Saxony KF this study EBLV-1a E. serotinus n. i. Verden Lower Saxony KF this study EBLV-1a E. serotinus 2000 n. i. Lower Saxony KF this study EBLV-1b E. serotinus 2009 Dillingen/ Saar Saarland KF this study EBLV-1a E. serotinus n. i. Berlin Berlin KF this study EBLV-1a E. serotinus n. i. Berlin Berlin KF this study EBLV-1a E. serotinus 2003 Langenhagen Lower Saxony KF this study EBLV-1a E. serotinus 2010 Hamburg Hamburg KF this study EBLV-2 M. daubentonii 2006 Schwansee Thuringia KF this study

89 Publikationen EBLV-1b E. serotinus 2011 Magdeburg Saxony-Anhalt KF this study EBLV-1a E. serotinus 2011 Halle/Saale Saxony-Anhalt KF this study EBLV-1a E. serotinus 2012 Chemnitz Saxony KF this study EBLV-1a E. serotinus 2010 Rehburg-Loccum Lower Saxony KF this study EBLV-1a E. serotinus 2010 Hameln Lower Saxony KF this study EBLV-1a E. serotinus 2010 Bad Segeberg Schleswig-Holstein KF this study EBLV-1a E. serotinus 2011 n. i. North Rhine-Westphalia KF this study EBLV-1a E. serotinus 2011 Hamminkeln North Rhine-Westphalia KF this study EBLV-2 M. daubentonii 2013 Gießen Hesse KF this study EBLV-1a E. serotinus 2012 Berlin Berlin KF this study EBLV-1a E. serotinus 2012 Berlin Berlin KF this study

90 Publikationen 85 Supplementary Table 2. Details of additional EBLV N-gene sequences included in the phylogenetic analysis. GenBank accesion no. Virus species Bat species Year Location Country Reference AY EBLV-2 M. dasycneme 1989 Andijk Netherlands [7] AY EBLV-2 Human 1985 Helsinki Finland [49] AY EBLV-2 M. daubentonii 1992 Plaffeien Switzerland [36] AY EBLV-2 M. daubentonii 1993 Versoix Switzerland [7] AY EBLV-2 M. daubentonii 2002 Lancashire England [50] AY EBLV-2 M. dasycneme 1993 Roden Netherlands [7] AY EBLV-2 M. daubentonii 2002 Geneva Switzerland [7] EF EBLV-2 Human 2002 Angus, Scotland UK [51] EU EBLV-2 M. dasycneme 1987 Wommels Netherlands [7] GU EBLV-2 M. daubentonii 2009 Turku Finland [52] JQ EBLV-2 M. daubentonii 2009 West Lothian, UK [53] Scotland JQ EBLV-2 M. daubentonii 2004 Surrey, England UK [54] JQ EBLV-2 M. daubentonii 2003 Lancashire, England UK [55] JQ EBLV-2 M. daubentonii 2006 Oxfordshire, England UK [56] JQ EBLV-2 M. daubentonii 2007 Shropshire, England UK [57] JQ EBLV-2 M. daubentonii 2008 Surrey, England UK [58] JQ EBLV-2 M. daubentonii 2008 Shropshire, England UK [59] EF EBLV-1 E. serotinus 1968 Hamburg Germany [60] AY EBLV-1 E. serotinus 2003 Angers France [7] AY EBLV-1 E. serotinus 2001 Presov Slovakia [7] AY EBLV-1 E. serotinus 1993 Apeldoorn Netherlands [7] AY EBLV-1 E. serotinus 1997 Apeldoorn Netherlands [7] AY EBLV-1 E. isabellinus 1987 Granada Spain [7] AY EBLV-1 E. isabellinus 1994 Granada Spain [7] AY EBLV-1 E. serotinus 1989 Briey France [7] AY EBLV-1 E. serotinus 1989 Bainville-sur-Madon France [7] AY EBLV-1 E. serotinus 1995 Morlaix Finiste`re France [7] AY EBLV-1 E. serotinus 2000 Premilhat France [7] AY EBLV-1 V. murinus 1987 Volyn region Ukraine [7] AY EBLV-1 Human 1985 Belgorod Russia [7] AY EBLV-1 E. serotinus 1994 Dziekanow Poland [7] EU EBLV-1 E. serotinus Poland unpublished AY EBLV-1 E. serotinus 1987 Bellingwolde Netherlands [7] AY EBLV-1 E. serotinus 1987 Christiansfeld Denmark [7] UK : United Kingdom

91 Publikationen 86 Twenty Years of Active Bat Rabies Surveillance in Germany: A Detailed Analysis and Future Perspectives Schatz, J.; Ohlendorf, B.; Busse, P.; Pelz, G.; Dolch, D.; Teubner, J.; Encarnação, J. A.; Mühle, R.-U.; Fischer, M.; Hoffmann, B.; Kwasnitschka, L.; Balkema- Buschmann, A.; Mettenleiter, T. C.; Müller, T. and C. M. Freuling Epidemiology and Infection 2013

92 Publikationen 87 Epidemiol. Infect. (2014), 142, Cambridge University Press 2013 doi: /s Twenty years of active bat rabies surveillance in Germany: a detailed analysis and future perspectives J. SCHATZ 1,B.OHLENDORF 2,P.BUSSE 3,G.PELZ 4,D.DOLCH 5, J. TEUBNER 5,J.A.ENCARNAÇÃO 6, R.-U. MÜHLE 7,M.FISCHER 1, B. HOFFMANN 1,L.KWASNITSCHKA 1,A.BALKEMA-BUSCHMANN 1, T. C. METTENLEITER 1, T. MÜLLER 1 AND C. M. FREULING 1 * 1 Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Institute of Molecular Biology, WHO Collaborating Centre for Rabies Surveillance and Research, Greifswald Insel Riems, Germany 2 Biosphärenreservat Karstlandschaft Südharz, Landesreferenzstelle für Fledermausschutz Sachsen-Anhalt, Roßla, Germany 3 Arbeitskreis Fledermäuse Sachsen-Anhalt e.v., Stolberg, Germany 4 Landesfachausschuss Säugetierkunde Berlin-Brandenburg, Potsdam, Germany 5 Landesamt für Umwelt, Gesundheit und Verbraucherschutz Land Brandenburg, Naturschutzstation Zippelsförde, Zippelsförde, Germany 6 Justus-Liebig-University of Giessen, Mammalian Ecology Group, Department of Animal Ecology and Systematics, Giessen, Germany 7 University of Potsdam, Department of Animal Ecology, Potsdam, Germany Received 27 May 2013; Final revision 31 July 2013; Accepted 14 August 2013; first published online 6 September 2013 SUMMARY In Germany, active bat rabies surveillance was conducted between 1993 and A total of 4546 oropharyngeal swab samples from 18 bat species were screened for the presence of EBLV-1-, EBLV-2- and BBLV-specific RNA. Overall, 0 15% of oropharyngeal swab samples tested EBLV-1 positive, with the majority originating from Eptesicus serotinus. Interestingly, out of seven RT PCR-positive oropharyngeal swabs subjected to virus isolation, viable virus was isolated from a single serotine bat (E. serotinus). Additionally, about 1226 blood samples were tested serologically, and varying virus neutralizing antibody titres were found in at least eight different bat species. The detection of viral RNA and seroconversion in repeatedly sampled serotine bats indicates long-term circulation of the virus in a particular bat colony. The limitations of random-based active bat rabies surveillance over passive bat rabies surveillance and its possible application of targeted approaches for future research activities on bat lyssavirus dynamics and maintenance are discussed. Key words: Bat rabies, epidemiology, lyssavirus, surveillance. INTRODUCTION Rabies is one of the most important zoonotic diseases in the world [1]. The causative agents are * Author for correspondence: Dr C. M. Freuling, Institute of Molecular Biology, Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Südufer 10, Greifswald-Insel Riems, Germany. ( conrad.freuling@fli.bund.de) negative-strand RNA viruses of the genus Lyssavirus of the family Rhabdoviridae [2]. Today, 15 different lyssavirus species are known to occur worldwide and except for Mokola virus (MOKV) and Ikoma virus (IKOV) all of them were found in bats suggesting that species from the order Chiroptera represent the true reservoir hosts for lyssaviruses [3]. While rabies in carnivores has been known for millennia and was the subject of intensive research, our

93 Publikationen J. Schatz and others understanding of rabies in bats concerning, e.g. epidemiology, prevalence, distribution and pathogenicity is still incomplete [4]. This is due to the fact that in contrast to terrestrial rabies, bat rabies has only been known for the past 100 years [3]. In addition, bat rabies may be driven by different mechanisms [3]. Furthermore, the nocturnal and often cryptic activity of bats limited studies on the occurrence of lyssavirus infections and their dynamics and maintenance in relation to bat biology [5]. So far, five out of the 15 known bat-associated lyssavirus species have been detected in Europe. The great majority of European bat rabies cases detected between 1977 and 2012 (n = 1033, Rabies Bulletin Europe, were caused by European bat lyssavirus type 1 (EBLV-1) and type 2 (EBLV-2) (for review see [6]). While EBLV-1 is associated with Eptesicus spp. (Serotine bat E. serotinus, Isabelline Serotine bat E. isabellinus), EBLV-2 has been isolated from Myotis spp. (Daubenton s bat M. daubentonii, Pond bat M. dasycneme). Consequently, these bat species were considered as the only reservoir hosts for bat-associated lyssaviruses in Europe. However, recently novel bat lyssaviruses have been detected in other European insectivorous bats. Bokeloh bat lyssavirus (BBLV) was detected in Natterer s bats (M. nattereri) in Germany and France in 2010 and 2012 [7, 8], whereas West Caucasian bat lyssavirus (WCBV) and Lleida bat lyssavirus (LLEBV) were found in Schreiber s bent-winged bats (Miniopterus schreibersii) in the West Caucasian Mountains and on the Iberian Peninsula in 2003 and 2012, respectively [9, 10]. It is unknown whether the latter two viruses use the same bat species as a reservoir, or whether the geographically distant populations represent two distinct sibling species of Mi. schreibersii. In contrast to other parts of the world, all 52 European bat species are classified as endangered and, therefore, are protected by the regulations of Council Directive 92/43/EEC of the European Union on the Conservation of Bats in Europe [11] or by national legislation, which limits surveillance efforts. Although guidelines for active and passive bat rabies surveillance have been established by the European research consortium, Med-Vet-Net [12], and were later adopted by EUROBATS [13], the level of bat rabies surveillance in Europe is still very heterogeneous [6]. Passive surveillance as the method of choice focuses on investigations of bats which were found with suspicious clinical symptoms or dead, whereas active surveillance for bat lyssavirus infections consisting of collecting and investigating micro-samples of blood and saliva from free-living indigenous bat populations as pioneered in North America [14 16] is considered valuable for obtaining additional information. As a consequence, active bat rabies surveillance in free-ranging bat populations was implemented in the UK [17, 18], France [19], Spain [20 24], Switzerland [25], Sweden [26], Slovenia [27, 28], Serbia [29] and Belgium [30]. While in some countries results from passive surveillance were confirmed by active surveillance, the detection of virus neutralizing antibodies (VNA) in sera of insectivorous bats indicated the presence of lyssaviruses in countries where bat rabies cases had not yet been reported [6] resulting in speculation as to whether bat lyssavirus infections are in fact more frequent and more widely distributed than assumed from passive surveillance data. Since Germany is among the countries with the highest frequency of bat rabies cases in Europe ([6], Rabies Bulletin Europe, org) active bat rabies surveillance was initiated in order to yield additional data on the distribution of bat lyssaviruses known to circulate in German bat populations, e.g. EBLV-1, EBLV-2, and BBLV [6, 7]. The objective of this study was to test whether active bat rabies surveillance can (i) complement passive surveillance, (ii) assist in generating new data/ information on the occurrence of bat-associated lyssavirus infections in indigenous bat populations, and (iii) become a tool for wider application. Here, we present the data and conclusions from two decades of active bat rabies surveillance in Germany. MATERIAL AND METHODS Sampling From 1993 until 2012, free-ranging bats of different species were captured at 42 different locations in seven German federal states, i.e. Bavaria, Berlin, Brandenburg, Hesse, Mecklenburg-Western Pomerania, Saxony and Saxony-Anhalt, during routine mark capture recapture studies in close collaboration with local bat biologists (see Supplementary Fig. S1, available online). Capture sites were selected either randomly or based on established long-time monitoring of indigenous bat species. None of the colonies had a history of confirmed bat rabies cases. Bats were caught between May and September, either during night-time using mist nets or harp traps at the

94 Publikationen 89 Active bat rabies surveillance in Germany 1157 cave entrances of swarming sites, maternity roosts in buildings and hunting areas over bodies of flowing or standing water, or during routine inspection of artificial maternity roosts in forests. Occasionally, bats were also sampled during hibernacula (October February). Species of bats were identified by bat biologists using morphological features [31, 32], and data on sex, age, reproductive status, forearm length, and weight were collected. Prior to release, bats were marked with a uniquely numbered bat ring for individual identification (Fledermausmarkierungszentrale Sächsisches Landesamt für Umwelt und Geologie, Dresden, Germany; Beringungszentrale Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany). To detect viral RNA or infectious virus in the saliva of bats, oropharyngeal swab samples were taken using dry sterile cotton swabs (Nerbe plus GmbH, Germany). Swabs were placed into 500 μl sterile minimum essential medium (MEM-10, with 2% streptomycin). Blood of sub-adult and adult bats was taken by puncture of the antebrachial vein [33] or the vein in the uropatagium using a 26-gauge needle and collected with a pipette into a 1 ml Eppendorf tube. For animal welfare reasons bleeding of bats was omitted in the case of small bats, poor general health conditions, and signs of weakness or malnutrition. Moreover, if no blood could be obtained after venepuncture further attempts were abandoned. After sampling bats were offered 10% glucose solution as replenishment. All samples were instantly stored at 4 C in cool boxes in the field and transferred the same day to the laboratory. Here, oropharyngeal swabs were spun down at 1000 rpm to retrieve absorbed medium from the cotton swab. Serum was extracted from blood samples after centrifugation at 1000 rpm for 10 min. Subsequently, oropharyngeal swabs and serum samples were stored at 80 C until testing. Capturing, handling, ringing, and sampling of bats was done under supervision of bat biologists following guidelines approved by the respective competent authorities. Laboratory tests Polymerase chain reaction (PCR) RNA from oropharyngeal swab samples (250 μl) was extracted either using commercial guanidinethiocyanate-based RNA extraction followed by column-based purification (RNeasy Mini kit, Qiagen, Germany), TRIzol (Invitrogen ) or peqgold TriFast (Peqlab Biotechnologie GmbH, Germany) according to manufacturers recommendations. RNA was re-suspended in a volume of 20 μl distilled water and stored at 80 C until testing. Amplification and detection of viral RNA was undertaken using two different reverse transcriptase polymerase chain reaction (RT PCR) methods specific for EBLV-1 and EBLV-2. While from 1993 to 2004 oropharyngeal swab samples were tested by nested RT PCR as described previously [34], between 2005 and 2012 samples were investigated by a TaqMan-based quantitative real-time PCR (qrt PCR) using primers and probes as shown in Supplementary Table S1 (available online). For the duplex EBLV-1 and EBLV-2 assay, a master mix consisting of 3 25 μl RNase-free water, 12 5 μl 5 QuantiTect Virus NR master mix, 0 25 μl 100 QuantiTect Virus RT mix (Qiagen, Germany), 2 0 μl specific primer-probe mix each for EBLV-1 and EBLV-2 (10 pmol EBLV-specific primers +5 pmol EBLV-specific probes) for one reaction was prepared and 5 μl RNA template was added. For amplification the following temperature profile was used: 30 min at 50 C (reverse transcription), 15 min at 95 C (inactivation reverse transcriptase/activation Taq polymerase), followed by 42 cycles of 30 s at 95 C (denaturation), 30 s at 55 C (annealing) and 30 s at 72 C (elongation). Following the discovery of BBLV in 2010 [7], remaining samples of Myotis species (e.g. M. nattereri) were additionally tested using a BBLV-specific qrt PCR as described previously [35] (Supplementary Table S1). Positive control and negative control (water) samples were analysed in parallel in each PCR run. For the real-time PCRs C t values >35 were considered negative. RNA samples from oropharyngeal swabs were pooled (n=4) and, in case of positive results, individual RNA samples were retested separately. Rabies tissue culture infection test (RTCIT) Virus isolation was only performed from RT PCRpositive oropharyngeal swab samples using RTCIT [36]. Briefly, mouse neuroblastoma cells (MNA 42/ 13; Friedrich-Loeffler-Institut, Germany) were inoculated with 200 μl of the remaining oropharyngeal swab medium and incubated for 3 days at 37 C and 5% CO 2. A result was confirmed negative after the third consecutive cell passage.

95 Publikationen J. Schatz and others Sequence analysis RTCIT-positive samples were further characterized using sequence analysis of the N-coding region. Sequencing of the nucleoprotein gene was performed with a panel of IRD-800-labelled forward and reverse primers as described previously [37]. Sequence analysis was performed using the Lasergene 6 package (DNAstar Inc., USA). Rapid fluorescent focus inhibition test (RFFIT) Individual serum samples (25 μl) were tested for the presence of VNA using a modified RFFIT as described previously [38] with an EBLV-1 isolate as test virus [39]. In general, sera were tested in twofold serial dilutions on mouse neuroblastoma cells (MNA 42/13) with a starting dilution of 1:10. If there was not a sufficient amount of serum available, sera were tested with a starting dilution of 1:20. A heterologous WHO international standard immunoglobulin (second human rabies immunoglobulin preparation, National Institute for Standards and Control, UK) adjusted to 1 5 IU/ml served as a positive control. The VNA titre was expressed as the reciprocal of the serum dilution showing a 50% reduction in fluorescent foci of the EBLV-1 test virus in vitro. RESULTS From 1993 until 2012, bats were caught at 42 different locations (Supplementary Fig. S1). In four capture sites in Brandenburg and Saxony-Anhalt sampling was conducted repeatedly (up to six times) on an annual basis, while at the remaining locations capturing was only conducted once. During the study period, a total of 4546 oropharyngeal swabs were taken from 18/24 bat species indigenous to Germany. The majority of samples were collected in Saxony-Anhalt (n = 3118) and Brandenburg (n = 530). The most frequently sampled species were the noctule bat (Nyctalus noctula) and Natterer s bat (M. nattereri), followed by Daubenton s bat (M. daubentonii) and Nathusius pipistrelle bat (Pipistrellus nathusii) (Table 1). Of the 4546 oropharyngeal swabs taken, 1628 (35 8%) were screened using RT PCR on the presence of all three European bat lyssaviruses known to exist in Germany (EBLV-1, EBLV-2, BBLV), while 2312 (50 9%) samples were tested for viral RNA of both types of EBLVs. A total of 304, 269 and 33 oropharyngeal swabs were investigated exclusively for EBLV-1-, EBLV-2- and BBLV-specific RNA, respectively. This resulted in a total of 4277, 4209 and 1661 individual EBLV-1-, EBLV-2-, and BBLV-specific RT PCR tests (Table 1). EBLV-2- and BBLV-specific RNA was not detected in 4209 and 1661 tested swabs, respectively, whereas by RT PCR EBLV-1-specific amplicons were obtained in seven of 4277 samples representing five serotine bats (E. serotinus), one Natterer s bat (M. nattereri) and one Western barbastelle bat (Barbastella barbastellus) (Table 1). Of those seven RT PCR-positive oropharyngeal swab samples tested by RTCIT, viable EBLV-1 was isolated from a single serotine bat that was captured in a maternity roost in the village of Tornow, Brandenburg, in Sequence analysis of this particular EBLV-1 isolate (laboratory no , GenBank accession no. KF042302) showed a 99 9% identity in a 1356 bp fragment of the N gene to another EBLV-1 isolate (laboratory no , GenBank accession no. KF042303) from a rabid serotine bat obtained during passive bat rabies surveillance in 2005 from the city of Kyritz, Brandenburg, <10 km from the first sampling site. Attempts to obtain larger nucleoprotein gene-specific amplicons of the remaining six qrt PCR-positive samples using conventional RT PCR for subsequent sequencing failed. Of the 4546 bats sampled during the study period, a total of 1736 (36 2%) blood samples from 13 different bat species were collected with volumes usually ranging from 3 μl to 200 μl, equalling μl of serum. From individuals of the larger bat species, e.g. E. serotinus, M. myotis and N. noctula, up to 500 μl of blood (250 μl serum) could be obtained. For 510 (29 4%) bats, the amount of serum was insufficient (25 μl) to be serologically analysed (Table 1). Of the 1226 sera tested against EBLV-1 using modified RFFIT, 85 6% of samples had VNA titres of <1:10. Virus neutralizing activity against EBLV-1 with titres 51:10 was detected in 146 (11 9%) sera from eight bat species, while 31 (2 5%) sera from four bat species, e.g. E. serotinus, M. myotis, B. barbastellus, N. noctula, exhibited titres 51:20 (Table 1). Three qrt PCR-positive oropharyngeal swabs and 18 sera with VNA titres 51:10 originated from an E. serotinus maternity colony in the village of Hartmannsdorf, Brandenburg, consisting of about individuals (Supplementary Fig. S1, Table 2). Of the 83 bats captured from this colony at six different time points between 2002 and 2007, a total of 27 individuals were recaptured and resampled twice (n =11) or three times (n = 6). Overall, 17 individuals

96 Publikationen 91 Active bat rabies surveillance in Germany 1159 Table 1. Screening results of 18 indigenous bat species sampled in Germany between 1993 and 2012 for the presence of lyssavirus-specific RNA (oropharyngeal swabs) and VNAs (serum samples) using RT PCR and modified RFFIT, respectively Oral swab samples tested for Serum samples tested for EBLV-1 EBLV-1 EBLV-2 BBLV Sampled Tested VNA titre Bat species N Pos. N N N N <1:10 <1:20 51:10 51:20 51:40 51:80 B. barbastellus E. nilssonii E. serotinus M. alcathoe M. bechsteinii M. brandtii M. dasycneme 1 1 M. daubentonii M. myotis M. mystacinus M. nattereri N. leisleri N. noctula P. nathusii P. pipistrellus P. pygmaeus Pl. auritus Pl. austriacus Total VNA, Virus neutralization antibody; RT PCR, reverse transcriptase polymerase chain reaction; RFFIT, rapid fluorescent focus inhibition test. were either qrt PCR positive or had VNA titres 51:10. Two qrt PCR-positive bats (A 42019, A42 039) exhibited VNA titres <1:10 at the time of first sampling, of which one showed a substantial increase in neutralizing activity 1 year later. The serotine bat with ID A was the only individual that had an initial VNA titre of 1:10 in 2003 which increased fourfold when testing qrt PCR positive 1 year later. In five individuals a decline in VNA titres was observed over time, whereas in three bats titres increased (Table 2). DISCUSSION Although during the past 35 years >1000 bat rabies cases were reported in Europe [6], bat rabies surveillance is still very heterogeneous in terms of existing networks of bat biologists, the number of bat species submitted and individual bats investigated. Some European bat species have never been investigated for rabies, thus their role in the epidemiology of lyssaviruses remains elusive [6]. The discovery of the novel lyssavirus species BBLV and LLEBV in Natterer s bats (M. nattereri) and Schreiber s bent-winged bats (Mi. schreibersii), respectively [7, 9], highlights that besides Serotine (E. serotinus, E. isabellinus), Daubenton s (M. daubentonii) and Pond (M. dasycneme) bats, additional bat species could serve as reservoirs for known or still unknown lyssavirus species in Europe. To obtain more information on the occurrence of bat-associated lyssaviruses, active bat rabies surveillance has been initiated in the Americas [14 16]. Following successful detection of rabies virus (RABV)- specific antigen and VNAs in free-ranging American bat populations, active bat rabies surveillance was also initiated in Europe to obtain a better picture of the actual incidence and prevalence of bat rabies. The use of molecular techniques, e.g. RT PCR, for the detection of bat lyssavirus-specific RNA was first applied in Europe [24]. So far, active bat rabies surveillance has been conducted in eight European countries (for review see [6]) including Germany, which implemented active bat rabies surveillance of free-ranging bat colonies in addition to the already

97 Publikationen J. Schatz and others Table 2. Results of RT PCR and serological testing of 17 individual serotine bats (E. serotinus) originating from a maternity colony in Hartmannsdorf, Brandenburg, that were either qrt PCR positive (oropharyngeal swabs) or had VNA titres 51:10 by RFFIT when captured or recaptured between 2002 and (July) 2003 (July) 2004 (May) 2004 (July) 2005 (July) Ring ID RT PCR VNA RT PCR VNA qrt PCR VNA qrt PCR VNA qrt PCR VNA A :80 A :80 51:40 <1:10 A :20 A <1:20 + <1:10 <10 A :10 1:10 A <1:20 1:10 A :10 <1:10 A <1:10 51:40 A :10 <1:10 <1:10 A <1:10 51:80 A :10 <1:10 n.a. A :10 A : :40 A :10 A :10 A :10 A :10 1:10 <1:10 RT PCR, Reverse transcriptase polymerase chain reaction; qrt PCR, quantitative real-time PCR; VNA, virus neutralization antibody; RFFIT, rapid fluorescent focus inhibition test. established passive bat rabies surveillance system in 1993 [40]. In previous field studies a total of 23/52 known European bat species were tested for lyssavirus infections [6]. During active bat rabies surveillance in Germany, 18/24 indigenous bat species were screened for the presence of EBLV- and BBLV-specific RNA, some of which were underrepresented by both routine and retrospective passive surveillance ([40], J. Schatz et al., unpublished data). While studies in the UK and Spain had mainly focused on reservoir species, i.e. Daubenton s bat (M. daubentonii), and Eptesicus bat species [17, 20], others screened the greater mouse-eared bat (M. myotis) [23], while only in France, Slovenia and in one study from Spain was a similarly high number of different bat species sampled [19, 21, 27]. With more than 4000 oropharyngeal swabs and 1200 blood samples tested by RT PCR and RFFIT, respectively, this is one of the most extensive active bat rabies surveillance studies ever conducted in Europe. While in several European studies no EBLVspecific RNA was detected in oropharyngeal swabs [6], we found seven oropharyngeal swab samples positive for EBLV-1 by RT PCR which is in accordance with previous reports from Spain, UK and Switzerland [13, 20, 24, 25]. The majority of RT PCR-positive results were associated with E. serotinus bats, the natural reservoir host of EBLV-1. Of serotine bats, 1 7% of all oropharyngeal swabs tested positive for viral RNA. Similarly, during a 5-year study in Spain, 2 8% of oropharyngeal swab samples from E. isabellinus yielded viral RNA [20]. At the serotine bat colony level (Hartmannsdorf, Brandenburg) the percentage of qrt PCR-positive swabs reached 4 7%. In contrast, up to 21% RT PCR-positive results were reported from a Spanish serotine bat colony targeted after the detection of a bat rabies case during passive surveillance [24]. In our study, repeated detection of viral RNA in saliva swabs from recaptured serotine bats (E. serotinus) was not observed. In Spain, an initially EBLV-1-positive E. isabellinus was negative on recapturing [20], thus supporting observations in experimentally infected serotine bats [41, 42]. However, unlike in other studies, not only serotine bats but also a single Natterer s bat and Western barbastelle bats tested positive for EBLV-1-specific RNA. Interestingly, EBLV-1 RT PCR-positive brain tissue was reported from a Natterer s bat from Spain [21]. However, repeated detection of the novel BBLV in Natterer s bats in Germany and France [7, 8, 35] suggests that this species may act as reservoir host for this proposed new lyssavirus species and, thus, EBLV-1

98 Publikationen 93 Active bat rabies surveillance in Germany 1161 infections in this bat species may represent spillover events. In Germany, E. serotinus, M. nattereri and B. barbastellus hibernate together, e.g. in basement vaults or different types of caves [31]. Additionally, during passive surveillance, EBLV-1 spillover infections were also detected in other bat species in Germany which co-hibernate with E. serotinus [40]. Generally, albeit already a high specificity of the RT PCR is given through hybridization probes, in the future sequencing of RT PCR amplicons can confirm the presence of known lyssaviruses or may detect yet unknown variants or novel lyssaviruses. The isolation of viable bat lyssaviruses during active surveillance appears to be difficult. During capture studies in Spain and Finland, for example, EBLVs were isolated from brain tissue of individual bats that had shown clinical signs suggestive of rabies before dying during handling [24, 43]. Markedly, in our study infectious virus could be isolated from a single RT PCR-positive serotine bat. Despite the detection of EBLV-specific RNA in very few oropharyngeal swab samples as reported previously [6], to our knowledge, this is the only EBLV-1 isolation from an oropharyngeal swab of a bat obtained during active surveillance in Europe. Interestingly, the bat did not show any clinical symptoms suggestive of rabies at the time of sampling. The low number of RT PCR-positive animals corroborates results obtained in experimental studies of EBLV infection in European bats (E. serotinus, M. daubentonii) and in North American big brown bats (E. fuscus), in which virus shedding was rarely detected [41, 42, 44]. However, active bat rabies surveillance studies are considerably biased by random sampling, and samples do not necessarily represent the entire populations of each indigenous bat species. Other reasons for the low number of RT PCRpositive animals could be the unknown infectious status of the targeted bat colonies, and the fact that not all animals of a colony can be captured at the same time point. Furthermore, bat lyssaviruses are causative agents considered to cause non-persistent infections [4, 5]. While RT PCR assays generally have a high analytical sensitivity, a dilution effect of viral RNA in the oropharyngeal swab sample and possible degradation of RNA cannot be completely excluded. Although the latter could have been avoided using RNA stabilizing chemicals, virus isolation attempts would then be impossible. Another limitation is the diversity of lyssaviruses circulating in European bats. At the time this study was initiated, only EBLV-1 was known to be present in Germany. In the meantime EBLV-2 and BBLV were detected by passive surveillance [7, 45]. While the presence of EBLV-2 was also analysed using a combined EBLV-1/ -2 assay, only the more recently collected samples from this study were screened for BBLV-specific RNA. However, this study could not provide further evidence for the presence of BBLV infections in indigenous bats (Table 1). Broader reacting pan-lyssavirus PCR assays with high sensitivity as described, e.g. by Hayman et al. [46], should improve the detection of lyssavirus species during active surveillance. In our study, 1226 blood samples from 10/18 bat species sampled during the observation period were investigated for the presence of EBLV-specific VNA. In other European efforts, a total of 22 bat species were the subject of serosurveillance with the number of bat species and bats tested in individual studies ranging from 1 14 and , respectively (Table 3). Similar to previous studies from other European countries, neutralizing activity suggesting the presence of EBLV-specific VNAs was found in eight bat species with a percentage of positives ranging from 7 5% [95% confidence interval (CI) ] to 78 6% (95% CI ) at a cut-off of 51:10 (Table 1). When the higher cut-off was chosen VNAs were only found in four or two bat species, respectively (Table 1). Highest VNA titres against EBLV-1, however, were found in its known reservoir host, i.e. E. serotinus (Table 1). Interestingly, 28 6% (95% CI ) of 56 tested individuals from a single maternity colony in the municipality of Hartmannsdorf, a roosting site with several EBLV-1-positive RNA in oral swabs, had VNA titres of 51:10, resulting in a seroprevalence of % (95% CI ) per year. Our data indicate the presence of a significant dynamic in virus transmission and serological response with increasing and decreasing VNA titres in bats in this particular colony (Table 2). This supports findings from serological studies on Lagos bat virus which postulated that acute transmission of bat lyssaviruses in adapted bat hosts occurs at a far higher rate than the occurrence of disease [47]. Our results further support previous experimental studies that although lyssaviruses have the ability to cause clinical disease in bats, they may not necessarily be fatal [41, 42, 44]. Unlike in other mammalian species where antibodies against RABV are only detectable in the final stage of infection, shortly before the animal s death, we were able to observe seroconversion in repeatedly captured bats (Table 2).

99 Publikationen J. Schatz and others Table 3. Comparison of previous serosurveillance studies conducted in Europe with the study from Germany using different modified versions of virus neutralization assays (modified after Schatz et al. [6]) Spain UK Slovenia Belgium Switzerland France Sweden Germany Cut-off value >1:27 (>1:5) >1:27 unknown unknown >1:25 (>1:125) >1:27 unknown not defined Bat species N pos pos in % N pos pos in % N pos pos in % N pos pos in % N pos pos in % N pos pos in % N pos pos in % N pos pos in % Unspecified B. barbastellus E. isabellinus E. nilssonii E. serotinus 274* Mi. schreibersii M. alcathoe M. bechsteinii M. blythii M. blythii/myotis M. brandtii M. capaccinii M. daubentonii M. dasycneme M. emarginatus M. myotis M. mystacinus M. nattereri N. leisleri N. noctula P. kuhlii P. nathusii P. pipistrellus P. pygmaeus Pl. auritus Pl. austriacus Plecotus spp R. euryale R. ferrumeqinum R. hipposideros T. teniotis References [19, 20, 22, 23] [17, 18, 49] [27] [30] [25] [19] [26] This study * Originally described as E. serotinus [22], according to present knowledge on the phylogeography of genus Eptesicus in Europe, these results could be attributed to E. isabellinus.

100 Publikationen 95 Active bat rabies surveillance in Germany 1163 Interestingly, evidence for the presence of VNAs against EBLV-1 was also found in M. myotis. Ata cut-off of 51:10, 9 9% (95% CI ) of the sera are considered positive, while with a cut-off of >1:20, comparable to previous studies, the percentage declines to 2 6% (95% CI ). This is in contrast to reports in which seroprevalences between 22 3% and 45 0% were found in Spanish M. myotis colonies [21, 23]. EBLV-1 neutralizing activity was also detected in a single M. myotis from both France and Belgium [19, 30]. In total, 1 1% (95% CI ) of N. noctula had VNA titres 51:20, whereas a surprising 19 4% (95% CI ) of B. barbastellus sera exhibited high VNA activity. If a cut-off of 51:10 was chosen, the seroprevalence even increased to 50% (95% CI ) (Table 1). Besides our study in which an oropharyngeal swab sample of a Western barbastelle bat (B. barbastellus) also tested EBLV-1 positive, in France a single bat from this species was found to have VNAs [19]. With the detection of EBLV-1 RNA in oropharyngeal swabs, the observed seroconversion probably resulted from spillover infections from the EBLV-1 reservoir host E. serotinus. Another possibility is the circulation of as yet unknown EBLV-1-like virus(es). However, since both in active and passive surveillance the number of investigated individuals of B. barbastellus is low [6], this species needs to be further investigated. Sporadic rabies cases in N. noctula were reported in Europe, although further information on the virus species is not available [6]. For various reasons it is rather difficult to compare results of serological testing between published studies. Unfortunately, serological testing offers limited insights into past exposures of clinically unsuspicious bats as it is critically dependent on the cut-off values used for the test [48]. Moreover, the serum dilution is a critical point for VNA titre determination. In previous surveys, either three- or fivefold serial dilutions were applied while we used a twofold dilution series. Furthermore, the cut-off values often resembled the starting dilution of sera to be tested; in general a cut-off value of 51:27 was considered the threshold of positivity (Table 3). In our study we did not define a cut-off value, but instead established the VNA titres as the reciprocal of the serum dilution showing a 50% reduction of the test virus, as done in a study in Spain [22]. Although in general high VNA titres tend to be specific more often, low titres rather tend to be unspecific by resembling non-humoral neutralization or virucidal effects. Even if high VNA titres were specific, the extraordinary high seroprevalences found in Spanish M. myotis colonies [21, 23], compared to ours, raise further questions. This could be a true representation of regional differences in virus circulation and dynamics; however, an influence of the various neutralization test methods applied cannot be excluded. Further, evidence of natural infections in this particular species in Spain is still lacking [6]. Another critical point is the test virus. As in a previous study [19] we used a modified RFFIT with EBLV-1 as test virus. While this seems appropriate for the established reservoir species E. serotinus and E. isabellinus, it is much more difficult to decide which test virus to use in non-reservoir species. Generally, seropositivity cannot be attributed to a specific lyssavirus, because of cross-reactivity of antibodies to lyssaviruses within phylogroups [49]. In particular, the recent detection of BBLV in M. nattereri exemplifies that the presence of as yet unknown lyssavirus species could account for the observed neutralizing activity in certain bat species other than the assumed reservoir species (Tables 1 and 3). In fact, different test viruses were used in other serosurveillance studies. In UK, serum samples of serotine bats and Daubenton s bats were separately tested against EBLV-1 (E. serotinus) and EBLV-2 (Myotis spp.) [17]. VNAs in two Natterer s bats using EBLV-1 as test virus [50] may indicate the presence of EBLV-1, BBLV or an as yet undiscovered virus from phylogroup I. In Spain, sera of different bat species were investigated using EBLV-1 as test virus. Selected positive sera were additionally tested against challenge virus standard (CVS) and EBLV-2 and because of no neutralization regarded as specific [21]. In Switzerland, serum samples of bats were tested with CVS and/or EBLV-2 as challenge virus. Of three positive Daubenton s bats (reciprocal titre of 527) only one serum tested positive using CVS, while the other two seropositive samples (EBLV-2) tested negative against CVS [25]. The latter results exemplify that even though crossreactivity is assumed for members of one phylogroup, different neutralization activities may be observed, depending on the specificity of VNAs, the titre, and the test viruses used. For instance, when sera of EBLV-1 and EBLV-2 experimentally infected ferrets [34] were serologically investigated against EBLV-1 and EBLV-2, sera had lower neutralizing activity using the heterologous test virus (T. Müller et al., unpublished data). Similar reactions were reported from serological tests with Aravan virus (ARAV)

101 Publikationen J. Schatz and others and Khujand virus (KHUV) [51]. In this respect we are aware of the fact that by using one test virus only we may have missed seroconversion in other bat species, in particular in Myotis species. Another problem associated with serological testing of bats is often small volume of serum obtained during bleeding. Even from bigger species, e.g. noctule bats (N. noctula), it was often a challenge to obtain sufficient blood for testing. In our opinion, from an animal welfare point of view, serological investigations of small bat species, e.g. Pipistrellus spp., should be reconsidered. Micro-neutralization assays have been used in several studies to cope with limited serum volume [41, 52]; however, unless those tests have been thoroughly validated for routine use, which is often not the case, multiple testing of samples with different challenge viruses is not practicable. Furthermore, the lack of standardized protocols including arbitrary cut-off values, issues of pooling samples, comparability of serological results, and crossneutralization represent a continuing dilemma for lyssavirus serosurveillance in European bats [6, 53, 54]. CONCLUSIONS Although active bat rabies surveillance has been recommended for years [12, 13], based on our experience it provides only limited information. Given their aetiopathology the detection of bat lyssaviruses based on RT PCR and virus isolation using an active random search in free-living populations of bats is coincidental. Except for the serological results the low number of RT PCR-positive animals including the EBLV-1 isolate obtained in our study originated from regions in Germany where the presence of bat rabies had already been identified through wellestablished passive surveillance. Serological data with all its current uncertainties, however, may assist in generating new data/information on the occurrence of bat-associated lyssavirus infections in indigenous bat populations and hence, could be useful in complementing passive surveillance. However, the detection of cross-neutralization in bat species other than the known reservoir species raises numerous questions that need urgent clarification; among which is specificity against different known bat lyssaviruses. Based on its current limitations and significant logistic efforts required, random-based active bat rabies surveillance is not likely to become a tool to be applied more widely and therefore cannot replace missing passive bat rabies surveillance. Instead targeted sampling of bat colonies with confirmed bat rabies through passive surveillance may assist in gaining deeper insights into bat lyssavirus dynamic and maintenance. SUPPLEMENTARY MATERIAL For supplementary material accompanying this paper visit ACKNOWLEDGEMENTS This study would not have been possible without the continued support and assistance of numerous bat biologists and bat conservationists. We would like to especially thank the members of the Arbeitskreis Fledermäuse Sachsen-Anhalt e.v. for including us in their group and sharing their enthusiasm with us about these fantastic animals. Special thanks go to Jeannette Kliemt, Doris Junghans and Martina Steffen for their skilful technical assistance during all these years. This study was undertaken within the frame of a lyssavirus research network financially supported by the German Ministry for Education and Research (BMBF, grant no. 01KI1016A). The authors are also grateful to the Adolf and Hildegard Isler- Stiftung, Germany, and the Research and Policy for Infectious Disease Dynamics (RAPIDD) programme of the Science and Technology Directorate, US Department of Homeland Security, at the Fogarty International Center, National Institutes of Health. DECLARATION OF INTEREST None. REFERENCES 1. World Health Organisation. Expert consultation on rabies, first report. World Health Organisation: Technical Report Series 2005; 931, Dietzgen RG, et al. Family Rhabdoviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, eds. Virus Taxonomy: Classification and Nomenclature of Viruses Ninth Report of the International Committee on Taxonomy of Viruses. San Diego: Elsevier, 2012, pp Banyard AC, et al. Bat rabies. In: Jackson AC, Wunner W, eds. Rabies. New York: Academic Press, Vos A, et al. European bat lyssaviruses an ecological enigma. Acta Chiropterologica 2007; 9:

102 Publikationen 97 Active bat rabies surveillance in Germany Banyard AC, et al. Bats and lyssaviruses. In: Jackson AC, ed. Advance in Virus Research. Amsterdam: Elsevier, 2011, pp Schatz J, et al. Bat rabies surveillance in Europe. Zoonoses and Public Health 2013; 60: Freuling CM, et al. Novel lyssavirus in Natterer s bat, Germany. Emerging Infectious Diseases 2011; 17: Picard-Meyer E, et al. Isolation of the novel BBLV lyssavirus in Natterer s bat in France. Bulletin epidemiologique 2012; 55: Ceballos NA, et al. Novel lyssavirus in bat, Spain. Emerging Infectious Diseases 2013; 19: Botvinkin AD, et al. Novel lyssaviruses isolated from bats in Russia. Emerging Infectious Diseases 2003; 9: Anon. Agreement on the conservation of populations of European bats (EUROBATS), Med Vet Net Working Group. Passive and active surveillance of bat lyssavirus infections. Rabies Bulletin Europe 2005; 29: Anon. Agreement on the conservation of populations of bats in Europe (EUROBATS), Annex 5: bat rabies, Trimarchi CV, Debbie JG. Naturally occurring rabies virus and neutralizing antibody in two species of insectivorous bats of New York State. Journal of Wildlife Diseases 1977; 13: Constantine DG, et al. Rabies in New Mexico cavern bats. Public Health Reports 1968; 83: Steece R, Altenbach JS. Prevalence of rabies specific antibodies in the Mexican free-tailed bat (Tadarida brasiliensis mexicana) at Lava cave, New Mexico. Journal of Wildlife Diseases 1989; 25: Harris SL, et al. Targeted surveillance for European bat lyssaviruses in English bats ( ). Journal of Wildlife Diseases 2009; 45: Brookes SM, et al. European bat lyssavirus in Scottish bats. Emerging Infectious Diseases 2005; 11: Picard-Meyer E, et al. Active surveillance of bat rabies in France: a 5-year study ( ). Veterinary Microbiology 2011; 151: Vazquez-Moron S, et al. Endemic circulation of European bat lyssavirus type 1 in serotine bats, Spain. Emerging Infectious Diseases 2008; 14: Serra-Cobo J, et al. European bat lyssavirus infection in Spanish bat populations. Emerging Infectious Diseases 2002; 8: Perez-Jorda JL, et al. Lyssavirus in Eptesicus-Serotinus (Chiroptera, Vespertilionidae). Journal of Wildlife Diseases 1995; 31: Amengual B, et al. Temporal dynamics of European bat lyssavirus type 1 and survival of Myotis myotis bats in natural colonies. PLoS ONE 2007; 2: Echevarria JE, et al. Screening of active lyssavirus infection in wild bat populations by viral RNA detection on oropharyngeal swabs. Journal of Clinical Microbiology 2001; 39: Megali A, et al. Surveillance for European bat lyssavirus in Swiss bats. Archives in Virology 2010; 155: National Veterinary Institute. Surveillance and control programmes: domestic and wild animals in Sweden 2008, Hostnik P, et al. Determination of bat lyssavirus in Slovenia. Zdravniski Vestnik 2010; 79: Presetnik P, et al.. Sunny new from the sunny side of the Alps active surveillance for lyssaviruses in bats did not reveal the presence of EBLV in Slovenia. In: 2nd International Berlin Bat Meeting: Bat Biology and Infectious Diseases. Berlin, February 2010: Leibniz Institute for Zoo and Wildlife Research, Vranies N, et al. Passive und active surveillance of lyssavirus in bats in Serbia. In: 2nd International Berlin Bat Meeting: Bat Biology and Infectious Diseases. Berlin, February 2010: Leibniz Institute for Zoo and Wildlife Research, 2010, p Klein F, et al. First clue of circulation of lyssaviruses in bat populations. In: 2nd Symposium: Wildlife Diseases Environment and Man. Belgian Wildlife Disease Society, Brussels, 13 October 2007, p Dietz C, Helversen O. von, Nill D. Handbuch der Fledermäuse Europas und Nordwestafrikas. Biologie, Kennzeichen, Gefährdung. Stuttgart: Kosmos, Schober W, Grimmberger E. Die Fledermäuse Europas Kennen, bestimmen, schützen, 2nd edn. Stuttgart Franckh-Kosmos Verlags-GmbH, Kunz TH, Nagy KA. Methods of energy budget analysis. In: Ecological and Behavioral Methods for the Study of Bats. Washington, DC: Smithsonian Institution Press, 1988, pp Vos A, et al. Susceptibility of ferrets (Mustela putorius furo) to experimentally induced rabies with European bat lyssaviruses (EBLV). Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health 2004; 51: Freuling CM, et al. Molecular diagnostics for the detection of Bokeloh bat lyssavirus in a bat from Bavaria, Germany. Virus Research. Published online: 7 August doi: /j.virusres Webster WA, Casey GA. Virus isolation in neuroblastoma cell culture. In: Meslin FX, Kaplan MM, Koprowski H, eds. Laboratory Techniques in Rabies, 4th edn. Geneva: World Health Organization, 1996, pp Freuling C, et al. A random grid based molecular epidemiological study on EBLV isolates from Germany. Developments in Biologicals (Basel) 2008; 131: Smith JS, Yager PA, Baer GM. A rapid reproducible test for determining rabies neutralizing antibody. Bulletin of the World Health Organization 1973; 48: Cox JH, Schneider LG. Prophylactic immunization of humans against rabies by intradermal inoculation of human diploid cell culture vaccine. Journal of Clinical Microbiology 1976; 3: Müller T, et al. Epidemiology of bat rabies in Germany. Archives of Virology 2007; 152: Franka R, et al. Susceptibility of North American big brown bats (Eptesicus fuscus) to infection with

103 Publikationen J. Schatz and others European bat lyssavirus type 1. Journal of General Virology 2008; 89: Freuling C, et al. Experimental infection of serotine bats (Eptesicus serotinus) with European bat lyssavirus type 1a. Journal of Genral Virology 2009; 90: Jakava-Viljanen M, et al. First encounter of European bat lyssavirus type 2 (EBLV-2) in a bat in Finland. Epidemiology and Infection 2010; 138: Johnson N, et al. Experimental study of European bat lyssavirus type-2 infection in Daubenton s bats (Myotis daubentonii). Journal of General Virology 2008; 89: Freuling CM, et al. First isolation of EBLV-2 in Germany. Veterinary Microbiology 2008; 131: Hayman DTS, et al. A universal real-time assay for the detection of lyssaviruses. Journal of Virological Methods 2011; 177: Hayman DTS, et al. Endemic Lagos bat virus infection in Eidolon helvum. Epidemiology and Infection 2012; 140: Bowen RA, et al. Prevalence of neutralizing antibodies to rabies virus in serum of seven species of insectivorous bats from colorado and new Mexico, United States. Journal of Wildlife Diseases 2013; 49: Horton DL, et al. Quantifying antigenic relationships among the lyssaviruses. Journal of Virology 2010; 84: SNH. Scottish Natural Heritage releases latest bat lyssavirus monitoring results. ( detailasp?id= ). 51. Hanlon CA, et al. Efficacy of rabies biologics against new lyssaviruses from Eurasia. Virus Research 2005; 111: Andrulonis JA, et al. A micromethod for measuring rabies-neutralizing antibody. Journal of Wildlife Diseases 1976; 12: Freuling C, et al. Bat rabies a Gordian knot? Berliner und Münchener Tierärztliche Wochenschrift 2009; 122: Gilbert AT, et al. Deciphering serology to understand the ecology of infectious diseases in wildlife. Ecohealth. Published online: 6 August doi: /s

104 Publikationen 99 Supplementary Fig. S1. Map of Germany showing the locations from which bats were sampled during 1993 and 2012, maternity colonies of Serotine bats ((E. E. serotinus) serotinus from Tornow, Brandenburg (star) and Hartmannsdorf, Brandenburg (triangle) are highlighted. Supplementary Table S1. Sequence information of primers and probes for TaqMan real realtime qrt qrt-pcrs. PCRs. Name Sequence (5'--3') Position* EBLV EBLV-1 f GAAAGGGGACAAGATAACACC EBLV EBLV-1 r AGAGAAGAAGTCCAACCAGAG EBLV EBLV-1 probe FAM-CTCAAACAGGAGGTCAAGATCTCACTCGGGAC CTCAAACAGGAGGTCAAGATCTCACTCGGGAC-TAMRA CTCAAACAGGAGGTCAAGATCTCACTCGGGAC TAMRA EBLV EBLV-2 f GGTGTCTGTAAAGCCAGAAG EBLV EBLV-2 r TTATAAGCTCTGTTCAAGTCCG EBLV EBLV-2 probe FAM-TCGGAAAAAACCCAGCATAACCCT TCGGAAAAAACCCAGCATAACCCT TCGGAAAAAACCCAGCATAACCCT-TAMRA TAMRA BBLV BBLV- F CCTTGGTGAACATTCAGAGAACG BBLV BBLV- R GGCCACAGTTGGATCCCTTG BBLV probe FAM-GGCAACTGGGCCTTGACCGGAGGA GGCAACTGGGCCTTGACCGGAGGA GGCAACTGGGCCTTGACCGGAGGA- BHQ * According to EF (EBLV-1), (EBLV 1), EF (EBLV (EBLV-2) 2) and JF (BBLV

105 Publikationen 100 Lyssavirus Distribution in Naturally Infected Bats from Germany Schatz, J.; Teifke, J. P.; Mettenleiter, T. C.; Aue, A.; Stiefel, D.; Müller, T. and C. M. Freuling Veterinary Microbiology 2014

106 Publikationen 101 Veterinary Microbiology 169 (2014) Contents lists available at ScienceDirect Veterinary Microbiology jo u rn al ho m epag e: ww w.els evier.c o m/lo cat e/vetmic Lyssavirus distribution in naturally infected bats from Germany J. Schatz a, J.P. Teifke b, T.C. Mettenleiter a, A. Aue c, D. Stiefel d, T. Müller a, C.M. Freuling a, * a Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Institute of Molecular Biology, WHO Collaborating Centre for Rabies Surveillance and Research, Greifswald, Insel Riems, Germany b Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Department of Experimental Animal Facilities and Biorisk Management, Greifswald, Insel Riems, Germany c Landeslabor-Berlin-Brandenburg, Fachbereich Infektionsdiagnostik, Berlin, Germany d Niedersächsischer Landesbetrieb für Wasserwirtschaft, Küsten- und Naturschutz, Hannover, Germany A R T I C L E I N F O Article history: Received 10 September 2013 Received in revised form 4 December 2013 Accepted 5 December 2013 Keywords: Bat rabies Lyssavirus Infection RT-PCR Immunohistochemistry A B S T R A C T In Germany, to date three different lyssavirus species are responsible for bat rabies in indigenous bats: the European Bat Lyssaviruses type 1 and 2 (EBLV-1, EBLV-2) and the Bokeloh Bat Lyssavirus (BBLV) for which Eptesicus serotinus, Myotis daubentonii and Myotis nattereri, respectively, are primary hosts. Lyssavirus maintenance, evolution, and epidemiology are still insufficiently explored. Moreover, the small number of bats infected, the nocturnal habits of bats and the limited experimental data still hamper attempts to understand the distribution, prevalence, and in particular transmission of the virus. In an experimental study in E. serotinus a heterogeneous dissemination of EBLV-1 in tissues was detected. However, it is not clear whether the EBLV-1 distribution is similar in naturally infected animals. In an attempt to further analyze virus dissemination and viral loads within naturally infected hosts we investigated tissues of 57 EBLV-1 positive individuals of E. serotinus from Germany by RT-qPCR and compared the results with those obtained experimentally. Additionally, tissue samples were investigated with immunohistochemistry to detect lyssavirus antigen in defined structures. While in individual animals virus RNA was present only in the brain, in the majority of E. serotinus viral RNA was found in various tissues with highest relative viral loads detected in the brain. Interestingly, viral antigen was confirmed in various tissues in the tongue including deep intralingual glands, nerves, muscle cells and lingual papillae. So, the tongue appears to be a prominent site for virus replication and possibly shedding. ß 2013 Elsevier B.V. All rights reserved. 1. Introduction Rabies is the oldest known zoonotic disease and has been the first recognized bat-associated infection in humans. The causative agents of rabies infections are * Corresponding author at: Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Institute of Molecular Biology, WHO Collaborating Centre for Rabies Surveillance and Research, Südufer 10, Greifswald, Insel Riems, Germany. Tel.: address: Conrad.Freuling@fli.bund.de (C.M. Freuling). different lyssavirus species of the family Rhabdoviridae. Except for Mokola virus (MOKV) and Ikoma lyssavirus (IKOV), all of the 13 recognized and 2 tentative known lyssavirus species were detected in the order of Chiroptera (World Health Organisation, 2013). In Europe, the majority of bat rabies cases classified as European bat lyssavirus type 1 (EBLV-1) were isolated from Eptesicus bats (E. serotinus, E. isabellinus). In contrast, European bat lyssavirus type 2 (EBLV-2) was only sporadically detected in Myotis species (M. daubentonii, M. dasycneme) (Schatz et al., 2013a). Recently, the Bokeloh /$ see front matter ß 2013 Elsevier B.V. All rights reserved.

107 Publikationen J. Schatz et al. / Veterinary Microbiology 169 (2014) bat lyssavirus (BBLV) was isolated from Natterer s bats (M. nattereri) in Germany and France (Freuling et al., 2011, 2013; Picard-Meyer et al., 2013). Single detections of West Caucasian bat lyssavirus (WCBV) and Lleida bat lyssavirus (LLEBV) in regions of the Western Caucasian Mountains and Iberian Peninsula, respectively, indicate that Schreiber s bent-winged bats (Miniopterus schreibersii) may act as virus reservoirs. LLEBV has only been detected by molecular methods; unfortunately, the virus has not been isolated yet (Ceballos et al., 2013; Kuzmin et al., 2005). Since the first detection of bat rabies in Europe in 1954 in Hamburg, Germany (Müller et al., 2007), four laboratoryconfirmed human bat rabies cases associated with both EBLV-1 and EBLV-2 have been reported (Fooks et al., 2003). Together with the spill-over infections of EBLV-1 in cats in France (Dacheux et al., 2009) and sheep in Denmark (Ronsholt, 2002) as well as in a stone marten in Germany (Müller et al., 2004), this exemplifies the relevance of bat rabies for veterinary and human public health. Generally, virus transmission among bats follows the route similar to classical terrestrial rabies, i.e. direct contact through saliva by bites, licking or scratches (Banyard et al., 2013). For rabies virus (RABV), inhalation of aerosolized saliva, transplacental transmission, or ingestion of virus-infected milk from a lyssavirus-infected mother was also discussed as possible routes (Allendorf et al., 2012). Experimentally, it was shown that mice could be infected via aerosolized RABV but not with EBLV-2, suggesting a lower risk of airborne transmission for this lyssavirus (Johnson et al., 2006a). Lyssavirus maintenance, evolution, and epidemiology in European bat species are still insufficiently understood (Vos et al., 2007), and particularly little is known on the transmission and pathogenesis of European bat lyssaviruses in their natural hosts. Few data from active surveillance showed the detection of viral RNA in oropharyngeal swabs from reservoir species (Schatz et al., 2013a), while viable virus was isolated only once from a free-living Serotine bat in Germany (Schatz et al., 2013b), indicating virus transmission via saliva. When a rabid Serotine bat was dissected EBLV-1 was found in the brain, tongue and lung (Bourhy et al., 1992). In an experimental study in E. serotinus a rather heterogeneous dissemination of EBLV-1 RNA in organs was observed. Additionally, antigen was detected in nerves in salivary glands and in the tongue again. In the latter, besides demonstration in nerves, virus antigen was also present in more than 50% of papillae (Freuling et al., 2009). However, it is not clear whether these findings are similar to naturally infected E. serotinus. Therefore, the aim of this comprehensive study was to investigate virus dissemination and viral loads of EBLVs in naturally infected animals from Germany collected between 1998 and 2013 using different molecular and histopathological techniques and to compare it with published data. 2. Materials and methods 2.1. Sample collection Between 1998 and 2013, carcasses of 57 Serotine bats (E. serotinus), one Nathusius pipistrelle bat (Pipistrellus nathusii) and two Daubenton s bats (M. daubentonii) with confirmed bat rabies infection (EBLV-1 and -2) were collected during passive bat rabies surveillance in Germany. This passive surveillance consists of routine bat rabies surveillance by regional veterinary laboratories and an additional retrospective study established at the WHO Collaborating Centre for Rabies Surveillance and Research at the Friedrich-Loeffler-Institut (FLI), Insel Riems, Germany. Bats originated from various cities of 13 different federal states (Berlin, Brandenburg, Bremen, Hamburg, Hesse, Lower-Saxony, Mecklenburg-Western Pomerania, North Rhine-Westphalia, Rhineland-Palatinate, Saarland, Saxony-Anhalt, Schleswig-Holstein and Thuringia), and were identified to species level using morphological criteria (Dietz and von Helversen, 2004). Initial rabies diagnosis was performed using the standard fluorescent antibody test (FAT) on bat brain samples following standard protocols (Dean et al., 1996). Bat organ samples (brain, tongue, salivary glands, pectoral muscle, heart, lung, liver, kidney, spleen, and bladder) were taken using separate, sterile instruments to avoid cross contamination. Depending on the condition of carcasses different organs were taken. From 26 Serotine bats all organs of interest were tested. Specimens of tongue, heart, lung and kidney were divided into parts for investigation using several different methods Rabies tissue culture infection test Pieces of organ samples ( mg) were homogenized in a volume of 1000 ml sterile minimum essential medium (MEM-10, with 2% streptomycin). Organ suspensions (500 ml) were subject of the rabies tissue culture inoculation test (RTCIT, Webster and Casey, 1996) using a mouse neuroblastoma cell line (MNA 42/13, Friedrich- Loeffler-Institut culture collection of veterinary medicine no. 411). Infected cells were incubated for three days at 37 8C and 5% CO 2 and then tested using FAT. A result was confirmed negative after the third consecutive cell passage Polymerase chain reaction RNA was extracted from 200 ml organ suspension using TRIzol 1 Reagent (Invitrogen TM, Darmstadt, Germany)/peq- GOLD TriFast TM (Peqlab Biotechnologie GmbH, Erlangen, Germany) method. The RNA pellet was re-suspended in a volumeof20 mlbidistilledwaterandtotalrnaextractswere stored at 70 8C until further use. Samples were individually analyzed for the presence of viral RNA using quantitative real-time PCR (RT-qPCR) as described elsewhere (Schatz et al., 2013b). The threshold of detection (cycle threshold (ct) = 35) was determined by preparing 7-fold dilutions of positive controls. Samples with cycle threshold 35 were considered negative for EBLV-specific RNA Histopathology For histological analysis organ samples were fixed in 4% phosphate-buffered formaldehyde, embedded in paraffin

108 Publikationen 103 J. Schatz et al. / Veterinary Microbiology 169 (2014) wax (FFPE), and cut at 3 mm. Sections were dewaxed and stained with haematoxylin and eosin (H.E.). Immunohistochemistry (IHC) for antigen detection in FFPE tissues was performed essentially as described before (Brookes et al., 2007). Briefly, sections were mounted on SuperFrost1 plus microscope slides (Menzel, Braunschweig, Germany), dewaxed, rehydrated and pre-treated by incubation for 10 min at 110 8C in 0.01 M citric acid buffer (ph 6.0) in a decloaking chamber (Biocare Medical, Concord, USA). Then, sections were blocked with normal goat serum for 30 min and incubated for 1 h with the monospecific, polyclonal rabbit serum N161-5 at a dilution of 1:2000 in Tris-buffered-saline (TBS, 0.1 M Tris-base, 0.9% NaCl, ph 7.6) (Orbanz and Finke, 2010). After washing a 30 min incubation with a biotinylated goat anti-rabbit IgG1 (Vector, Burlingame, CA) followed. The avidin biotincomplex (ABC) immunoperoxidase method (Vectastain Elite ABC Kit, Vector) was conducted with AEC substrate chromogen system (Dako, Carpinteria, CA, USA). As negative control serum a non-immunized rabbit was used. Finally, sections were counterstained with Mayer s haematoxylin and sealed with aqueous medium (Aquatex; Merck, Darmstadt, Germany). To verify the origin of viral RNA in tongue tissue in situ hybridization (ISH) was also performed with EBLV-1 and -2 antisense and sense N gene riboprobes. For this method, a 370 bp fragment for EBLV-1, and a 191 bp fragment for EBLV-2, respectively, was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). To this end, primers EBLV-1 fwd. (5 0 -aag agc tac agg att acg agg-3 0 [nucleotides ]), EBLV-1 rev. (5 0 -gac aaa gat ctt gct cat ga-3 0 [nucleotides ]), EBLV-2 fwd. (5 0 -tca tgg tca atg ggg gaa ag-3 0 [nucleotides ]), and EBLV-2 rev. (5 0 -ttg gga tgg agc agg aa gag-3 0 [nucleotides , all positions according to GenBank EF and EF157977]) were used. The DNA was cloned into the pgem-t-easy vector (Promega Corporation, Madison, WI) and in vitro transcription was performed according to the manufacturer s instructions (Maxiscript in vitro transcription kit, Ambion Inc., Austin, TX, USA). Contamination with RNase was carefully avoided by using autoclaved material and RNase free water. Sections (3 mm) of paraffin wax embedded tissues were dewaxed, dehydrated and washed in 0.1 M phosphate buffered saline, ph 7.4 (PBS), denatured with 0.2 M HCl for 20 min, and washed twice with 2 SSC for 1 min each. The slides were then digested with proteinase K 20 mg/ml at 37 8C for 30 min. Refixation was performed using 4% PFA for 5 min. After washing with 2 SSC, the sections were acetylated for 10 min in 0.1 M triethanolamine, ph 8.0, and containing acetic anhydride, washed in 2 SSC. Prehybridization for 1 h at 50 8C was performed in buffer containing formamide 50%, 4 SSC, 2 Denhardt s solution. DIG-labelled RNA probes were diluted 1:100 in hybridization buffer, which contains formamide 50%, 4 SSC, 2 Denhardt s solution, dextran sulphate 10%, and yeast RNA 500 mg/ml. The sections were hybridized at 50 8C over night. After hybridization the sections were washed twice with 2 SSC for 30 min each. To remove nonhybridized RNA probe RNase digest was conducted. To detect the hybridized probes an incubation with anti-dig antibodies conjugated with alkaline phosphatase was performed. Colour reaction, i.e. distinct brown/black staining, resulted from incubation with nitrotetrazolium blue chloride (NBT) and X-phosphate according to manufacturer s instructions (Roche, Germany) Statistical analysis Data, i.e. ct-values of tested organ samples from Serotine bats (E. serotinus) were statistically compared using nonparametric tests. For analyzing the distribution in various organs, two datasets were analyzed. In one, all investigated samples were included. In the other dataset, only those bats were included where all organ samples (exclusive brain) were tested (N = 26). The Friedman test for combined data was used to detect global differences (Friedman Chisquared = , df = 9, p-value = 7.227e 05). Significance in values between groups was assessed using the Wilcoxon Mann Whitney-U-test with the Sidak-correction (p ). All calculations were performed using R (R Foundation for Statistical Computing, Vienna, Austria), version ( ). 3. Results A total of 33 lyssavirus positive Serotine bats (E. serotinus) originating from regional veterinary laboratories (Berlin, Brandenburg, Lower-Saxony, Mecklenburg-Western Pomerania, North Rhine-Westphalia and Saarland) were submitted to FLI, Germany for further virus characterization. Additionally, 24 Serotine bats (E. serotinus) and a single Nathusius pipistrelle bat (P. nathusii) originating from Berlin, Brandenburg, Bremen, Hamburg, Lower Saxony, North Rhine-Westphalia, Saarland, Saxony- Anhalt and Schleswig-Holstein also tested positive during a retrospective study, and were included. Among rabies positives, the virus was identified as EBLV-1 (N = 58) using RT-qPCR. EBLV-2 was detected from two Daubenton s bats (M. daubentonii) submitted from Thuringia and Hesse in the frame of a retrospective study. In the majority of Serotine bats viral RNA was found in various organs. The percentage of EBLV-1 positive organ samples from E. serotinus (N = 57) using RT-qPCR was as follows: brain (100%), salivary glands (85.0%), tongue (65.3%), pectoral muscle (61.5%), heart (59.3%), lung (48.1%), liver (50.9%), kidney (68.5%), spleen (41.2%), and bladder (55.6%) (Table 1). In two Serotine bats submitted from veterinary laboratories and in eight individuals found during retrospective study, respectively, all organs tested EBLV-1 positive. In contrast, six individuals submitted from veterinary laboratories tested positive in the brain exclusively. The lowest ct-values representing highest viral loads were observed in brains and salivary glands, followed by tongues and kidneys (Fig. 1). Statistically, salivary glands had significantly lower ct-values (p 0.001) than all other organ samples except brain. When analyzing the condensed data set, the same significance was found. Additionally, kidneys had significantly lower ct-values (p 0.001) compared to pectoral muscle, lung and spleen. Also, compared to spleen samples RNA from heart samples had significantly lower ct-values.

109 Publikationen J. Schatz et al. / Veterinary Microbiology 169 (2014) Table 1 Investigation of organ samples from three different bat species with confirmed lyssavirus infection (EBLV-1, EBLV-2) using quantitative real-time PCR (RTqPCR), immunohistochemistry (IHC) and rabies tissue culture inoculation test (RTCIT). Sample EBLV-1 EBLV-2 Eptesicus serotinus Pipistrellus nathusii Myotis daubentonii RT-qPCR IHC RTCIT RT-qPCR IHC RTCIT RT-qPCR IHC RTCIT N Pos N Pos N Pos N Pos N Pos N Pos N Pos N Pos N Pos Brain Salivary gland Tongue Pectoral muscle Heart Lung Liver Spleen Kidney Bladder From Nathusius pipistrelle bat (P. nathusii) all organs were investigated except for the bladder and besides brain, EBLV-1 specific RNA was detected only in the heart (ct = 31.2) (Table 1). Additionally to the brain samples, eight other organ samples (salivary gland, tongue, pectoral muscle, heart, lung, liver, kidney and spleen) of each of the two Daubenton s bats were investigated using RT-qPCR (Table 1). EBLV-2 specific RNA was detected in two (salivary gland ct = 17.1 and heart ct = 26.1) and four (salivary gland ct = 29.0, tongue ct = 31.8, kidney ct = 29.1 and pectoral muscle ct = 30.5) different organ samples, respectively. Viable virus was successfully isolated from a total of 54 individuals of E. serotinus, one P. nathusii, and two Daubenton s bats, from brain and/or salivary gland and tongue (Table 1). Organs from six Serotine bats of which all organs tested EBLV-1 positive by RT-qPCR were additionally investigated using RTCIT. The proportion of RTCIT positive samples to the number of tested samples was as Fig. 1. Virus load (ct-value) of different organs from EBLV-1 infected Serotine bats (E. serotinus) investigated using RT-qPCR. follows: brain (6/6), salivary glands (2/6), tongue (4/6), pectoral muscle (1/6), heart (3/6), lung (0/6), liver (0/6), kidney (0/6), spleen (0/6), and bladder (1/2). Particularly attempts to cultivate EBLV-1 from liver and kidney failed because of cytotoxicity of these samples. In order to morphologically characterize viral distribution, cross-sections of two heads of Serotine bat were investigated immunohistochemically. Viral antigen was found in the central nervous system (i.e. parts of cerebrum, optic nerves, autonomic ganglia), salivary glands (i.e. parotid and mandibular gland; Fig. 2) and within the tongue. Tongue samples from a total of 42 Serotine bats, two Daubenton s bats and from a single Nathusius pipistrelle bat were studied by immunohistochemistry (IHC). Despite advanced autolysis in numerous tongue samples, virus specific labelling was detected in 20 out of 42 tongues from E. serotinus, whereby in the majority of cases EBLV-1 antigen was found in epithelial cells of acini and ducts of deep intralingual glands (von Ebner). Furthermore, lyssavirus antigen was also observed in a low number of nerve fibres, scattered striated skeletal muscle cells and in rare occasions within lingual papillae (Fig. 3). In tongues from infected Daubenton s bats antigen was also detected and EBLV-2 was confirmed using ISH in glandular cells and in glossal nerves (Fig. 4). Parallel investigation of tongue samples using RT-qPCR and immunohistochemistry was conducted in 39 E. serotinus, in two M. daubentonii and in the tongue sample of P. nathusii (Table 1). Using both methods positive results were obtained in 15 specimens of E. serotinus, whereas in 11 cases neither viral RNA nor viral antigen was found. EBLV-1 specific RNA was detected in 10 tongues in which viral antigen were not confirmed using IHC. In three specimens that tested RTqPCR negative, positive staining was observed in small regions in the lingual epithelium. Additionally, heart, lung and kidney samples from seven Serotine bats and one Daubenton s bat were screened for the presence of viral antigen. In none of the tested organ samples specific immunolabelling was found with the exception of the heart from one Serotine bat. Here, lyssavirus antigen was detected in a subepicardial ganglion

110 Publikationen 105 J. Schatz et al. / Veterinary Microbiology 169 (2014) Fig. 2. Salivary glands: EBLV-1 infected Serotine bats (E. serotinus) with anti-nucleoprotein immunohistochemistry (IHC). Distribution of lyssaviral antigen (red stain) within the cytoplasm of epithelial cells of ducts and acini of (a) mandibular gland, and (b) parotid gland (bar = 50 mm). innervating the myocardium (Fig. 5). When available samples of those bats (N = 4) were tested with RT-qPCR, viral RNA was detected in hearts (N = 4), lungs (N = 2) and kidneys (N = 2). During dissection of an EBLV-1 positive Serotine bat a foetus was removed using separate, sterile instruments, cut sagittal at body axis, fixed in 4% formaldehyde, and was immunohistologically investigated. The age of the foetus was estimated as a later stage of embryogenesis by means of external morphological characteristics. Neither in brain nor in any other foetal tissues was lyssavirus antigen detected. 4. Discussion Despite the large geographic distribution of EBLV-1 throughout Europe and the high number of naturally infected Serotine bats reported, a detailed investigation of virus distribution within the reservoir host was missing. Experimental studies and a case report only partly investigated virus distribution in organ samples (Bourhy et al., 1992; Freuling et al., 2009). Here, we analyzed a total of 57 Serotine bats and one Nathusius pipistrelle bat with confirmed EBLV-1 infection collected between 1998 and Additionally, two EBLV-2 infected Daubenton s bats were also investigated. Results of RT-qPCR show that in naturally infected Serotine bats besides in the brain, specific lyssavirus RNA was detected in a variety of organs (Table 1), thus corroborating previous experimental studies (Freuling et al., 2009). Virus antigen and nucleic acid were distributed heterogeneously. As could be expected from the neurotropism of lyssaviruses, highest viral loads were detected in the brain. The detection of EBLV-1 in different Fig. 3. Tongue: EBLV-1 infected Serotine bats (E. serotinus) with anti-nucleoprotein immunohistochemistry (IHC). Immunolabelling within (a) multiple acini and ducts of deep intralingual glands (von Ebner s glands) (bar = 100 mm), (b) intralingual nerve fibres (bar = 100 mm), (c) striated skeletal muscle fibres (bar = 50 mm), and (d) lingual papilla (bar = 50 mm).

111 Publikationen J. Schatz et al. / Veterinary Microbiology 169 (2014) Fig. 4. Tongue: EBLV-2 infected Daubenton s bat (M. daubentonii). (a) Deep within the tongue there are numerous glands of compound acinar or alveolar type (von Ebner s glands): H.E. (bar = 100 mm), (b) except for slight autolysis no lesions, especially no Negri bodies are present: H.E. (bar = 50 mm), (c) immunohistochemical detection of lyssavirus (i.e., EBLV-2) antigen in serous deep intralingual (von Ebner s) glands (bar = 50 mm), and (d) in situ hybridization (ISH) detects N-gene specific RNA within the same areas as IHC (bar = 50 mm). tissues suggests centrifugal virus spread from central nervous system into the periphery along nerves that innervate the tissues. There is no empirical evidence yet to suggest whether the virus was transported by a retro- or anterograde axonal transport via the vagus or other motoric nerves. The fact that more organs were found positive in animals from the retrospective study compared to those from regional veterinary laboratories where the majority of animals tested positive exclusively in the brain is interesting. A possible explanation is that in animals which were euthanized at an early stage of disease (routine surveillance) virus distribution into peripheral tissues had not begun, thus only the brain was infected. On the opposite, in dead found bats (i.e. retrospective study) the centrifugal spread of virus lead to numerous infected tissues. Another possibility is that dysfunctions in the blood brain barrier in the final stage of infection lead to viral dispersal via the blood circuit into peripheral organs. Although viral RNA was found in blood samples from freeliving Myotis myotis bats (Amengual et al., 2007), given the absence of apparent clinical signs this finding remains questionable. Human bat rabies cases, experimental studies and active bat rabies surveys of reservoir host bat species indicate that bat lyssaviruses are shed and transmitted through saliva (Fooks et al., 2003; Freuling et al., 2009; Schatz et al., 2013a,b). In this study, in 85% of tested salivary glands from E. serotinus EBLV-1 specific RNA was Fig. 5. Heart: EBLV-1 infected Serotine bat (E. serotinus) (a) H.E., (b) immunohistochemistry for lyssaviral nucleoprotein within one subepicardial autonomic ganglion (bar = 50 mm).