Neue Ansätze für die in situ Regeneration und das Tissue Engineering von Knochen

Größe: px
Ab Seite anzeigen:

Download "Neue Ansätze für die in situ Regeneration und das Tissue Engineering von Knochen"


1 ÜBERSICHT Knochen In situ Regeneration und Tissue Engineering Janicki P, Richter W Neue Ansätze für die in situ Regeneration und das Tissue Engineering von Knochen New Approaches for In Situ Regeneration and Tissue Engineering of Bone Forschungszentrum für Experimentelle Orthopädie, Orthopädische Universitätsklinik Heidelberg Zusammenfassung Bis zu 5 % aller Knochenbrüche weisen eine gestörte Frakturheilung auf und die Überbrückung großer Knochendefekte stellt nach wie vor eine Herausforderung für den Chirurgen dar. Methoden zur Förderung der in situ Regeneration basierend auf avitalen Komponenten wie Knochenersatzmaterialien und Wachstumsfaktoren haben inzwischen in vielfältiger Weise erfolgreichen Eingang in die Klinik gefunden. Die Anwendung von Tissue Engineering-Produkten hingegen, also die Regeneration von Knochen unter Verwendung von vitalen Komponenten, wie gezüchteten Zellen mit Hilfe unterstützender Trägerstrukturen und/oder Biomolekülen, ist im Knochen dagegen bislang weniger verbreitet. Da Knochen, im Gegensatz zum Knorpel, sehr zellreich und gut durchblutet ist, ist das Zusammenspiel von osteokonduktiven Knochenersatzmaterialien, osteoinduktiven Stimuli und osteogenen Zellen für die Rekonstruktion großer Knochendefekte besonders wichtig und notwendig. In Anbetracht einer immer älter werdenden Bevölkerung mit eingeschränkter Spontanregeneration, sowie im Leistungssport, wo eine möglichst schnelle Ausheilung und vollständige Belastungsfähigkeit des wiederhergestellten Gewebes essentiell ist, könnte die zusätzliche Bereitstellung einer großen Zahl autologer Stammzellen im Kontext von Tissue Engineering- Verfahren vielversprechend sein. Der Artikel fasst spenderabhängige Aspekte humaner mesenchymaler Stammzellen, ihre Eignung für das Tissue Engineering von Knochengewebe, sowie neue Ansätze der in situ Regeneration zusammen und informiert über relevante Aspekte der Zulässigkeit im Rahmen der Einstufung von Tissue Engineering-Produkten in Europa als Arzneimittel. Schlüsselwörter: Sprunggelenksverletzungen, sensomotorisches Training, Verletzungsprävention, neuromuskuläres Training, propriozeptives Training. SummAry Up to 5 % of all bone fractures show impaired healing and the bridging of large bony defects still represents a challenge for the orthopedic surgeon. In recent years, methods to promote in-situ regeneration based on non-vital components like bone substitute materials and growth factors have found successful entrance to the clinic. However, the application of vital components such as in-vitro cultured cells in combination with supporting carriers and/or biomolecules, thus tissue-engineered products, is less common for the regeneration of bone. In contrast to cartilage, bone tissue represents a cell-rich and well-vascularized tissue. Consequently, a functional interplay of supporting osteoconductive bone graft substitutes, osteoinductive stimuli and osteogenic cells is important and necessary for the regeneration of large bone defects. The additional provision of high quantities of autologous stem cells for bone tissue engineering strategies may be promising for a steadily aging population as well as for high-performance sports, where fast regeneration and full load-bearing capacity of the reconstructed bone are required. The article summarizes donor-dependent aspects of human mesenchymal stem cells and their suitability for bone tissue engineering. Additionally, new approaches for the in-situ regeneration of bone and relevant regulatory statutes due to the classification of tissue-engineered products as pharmaceuticals in Europe will be discussed. Key words: In-situ regeneration, tissue engineering, bone substitute material, growth factor, mesenchymal stem cells. Ursachen gestörter Knochenheilung Gesunder Knochen ist normalerweise in der Lage gut zu regenerieren, wobei die Reparaturmechanismen je nach Lage, Ausmaß und Art des Knochenbruchs variieren (14,34,45). Falls während der Knochenheilung die Kallusbildung (mechanisch) unterbrochen oder verzögert wird, kann es zur Entstehung eines nicht überbrückten Knochendefektes kommen. In ca. 5-10% der Fälle kann dies zum Ausbleiben der Kallusmineralisierung und dadurch zur Entstehung einer nicht heilenden Pseudarthrose führen (36,40,41). Auch komplizierte Knochenbrüche (z.b. Trümmerbrüche), pathologische Frakturen (z.b. bei Osteoporose-Patienten) oder große Knochendefekte (z.b. nach Tumorresektionen) führen häufig dazu, dass der betroffene Knochen nicht mehr in der Lage ist, sich selbst genügend zu stabilisieren und zu regenerieren. Ungenügende Blutversorgung und Infektionen des Kallusgewebes oder auch systemische Krankheiten (wie z.b. Diabetis mellitus) können ebenfalls einen negativen Einfluss auf die Knochenheilung haben. Für den Chirurgen stellt die Überbrückung großer Knochendefekte nach wie vor eine große Herausforderung dar. Konventionelle Therapiemöglichkeiten gestörter Knochenheilung Eine der ältesten und bewährtesten Methoden, um nicht-heilende Knochendefekte zu regenerieren, ist der Ersatz des fehlenden Knochens durch Transplantation von autogenem Knochengewebe. accepted: December 2011 published online: February 2012 DOI: /dzsm Janicki P, Richter W: Neue Ansätze für die in situ Regeneration und das Tissue Engineering von Knochen. Dtsch Z Sportmed 63 (2012) deutsche Zeitschrift für Sportmedizin Jahrgang 63, Nr. 2 (2012)

2 Knochen In situ Regeneration und Tissue Engineering ÜBERSICHT Der Vorteil einer autogenen Knochentransplantation liegt darin, dass der eingesetzte Knochen vital ist und folglich alle erforderlichen Eigenschaften für das Wachstum eines neuen Knochens mitbringt (21,27,34). Er induziert keine Immunreaktionen und enthält alle erforderlichen Zellen und Komponenten, die die Integration des Transplantats und eine schnelle Knochenneubildung ermöglichen (osteogene Eigenschaften). Das autogene Transplantat dient zudem als Gerüst und bietet Anheftungsmöglichkeiten für knochenbildende Zellen und Blutgefäße (osteokonduktive Eigenschaften), die die Knochenheilung ermöglichen. Gleichzeitig verfügt das Transplantat über osteoinduktive Eigenschaften, da es undifferenzierte Stammzellen und Osteoprogenitor-Zellen z.b. über die Sezernierung von Wachstumsfaktoren zur Differenzierung zu reifen Knochenzellen anregt. Die Verwendung autogener Transplantate erfordert die Entnahme von gesundem Knochengewebe an einer anderen Stelle des Organismus. Das hat zur Folge, dass nicht nur die Menge des Materials limitiert ist, sondern auch der Patient zusätzliche Schmerzen erleidet und, bedingt durch mehrfache chirurgische Eingriffe, die Gefahr von Infektionen leicht aufsteigt (1,2). Eine Alternative zur autogenen Transplantation ist die Verwendung allogener Transplantate von Spendern derselben Spezies. Diese stehen in ausreichender Menge zur Verfügung und verhindern die Entnahmemorbidität beim Patienten. Da die Transplantate jedoch meist aus Leichen gewonnen werden, besteht ein minimales Risiko, Krankheiten von Spender zu Empfänger zu übertragen und Immunreaktionen hervorzurufen (4,52). Das Infektionsrisiko wird vermindert, indem die Transplantate durch z. B. Gefriertrocknung oder den Einsatz unterschiedlicher Sterilisationsverfahren (z.b. Gamma-Bestrahlung, Behandlung mit Ethylenoxid) vorbehandelt werden. Diese Methoden haben jedoch zur Folge, dass alle zur Knochenbildung wichtigen Faktoren (wie Wachstumsfaktoren, Proteine und andere bioaktive Stoffe) zerstört werden und das Transplantat dadurch nicht nur seine osteoinduktiven Eigenschaften verliert, sondern auch biologisch getötet wird (27). Alternative, nicht-invasive Behandlungsmethoden zur Regeneration des Knochens stellen die elektrische Stimulation, der Einsatz von elektromagnetischen Feldern, extrakorporalen Stoßwellen oder auch gepulstem Ultraschall dar (42), wobei die Wirksamkeit dieser Methoden kontrovers diskutiert wird. Konzepte der Regenerativen Medizin Die Regenerative Medizin beinhaltet sowohl neuartige Konzepte zur Regeneration der Morphologie und der biologischen Funktion von beschädigtem Gewebe, als auch neue Strategien zur Rekonstruktion der mechanischen Eigenschaften und der chemischen Zusammensetzung des Gewebes (39). Neuere Therapiemöglichkeiten für nichtheilende Knochenbrüche lassen sich hauptsächlich den Gebieten der in situ Regeneration (Geweberegeneration) und dem Tissue Engineering (Gewebeersatz) zuordnen. Bei der In situ-regeneration liegt das Hauptaugenmerk auf der Stimulation endogener Reparaturmechanismen, wobei das geschädigte Gewebe durch Transplantation von Knochenersatzmaterialien mit/ohne Wachstumsfaktoren, jedoch ohne Zugabe vitaler Komponenten, stimuliert wird. Das Tissue Engineering hingegen basiert auf der Wiederherstellung, Erhaltung und Verbesserung biologischer Gewebe mit Hilfe von Ansätzen, die stets eine vitale Komponente enthalten. Meist besteht ein Tissue Engineering-Präparat aus Biomaterialien, die entweder mit Signalmolekülen angereichert und/oder mit Zellen besiedelt werden, die das Gewebe neu aufbauen sollen. Im Gegensatz zu Knorpel, der dünnes, avaskuläres Gewebe darstellt und durch Tissue Engineering-Ansätze weitgehend erfolgreich restauriert werden kann (11), ist die Wiederherstellung des Knochens mit Hilfe von Tissue Engineering-Konstrukten insofern komplizierter, als es sich hier um zellreiches, stark durchblutetes Gewebe handelt. Eine erfolgreiche Rekonstruktion wird damit, besonders bei großen Knochendefekten, durch mangelnden Nährstofftransport und unzureichende Durchblutung des Transplantats limitiert. Dabei ist ebenfalls die Sicherstellung des Überlebens der transplantierten Zellen von großer Bedeutung. Stimulation endogener Reparaturmechanismen durch In situ Regeneration Für den Ersatz des fehlenden Knochens und für dessen biomechanische Stabilität ist der Einsatz von biologischen bzw. synthetischen Knochenersatzmaterialien unerlässlich. Dabei sind neben der osteokonduktiven Eigenschaften, auch die chemische Zusammensetzung, Form, Beschaffenheit, Porosität, Porengröße, -verteilung und -form für die Integration des Transplantats und für den Heilungserfolg des Knochens ausschlaggebend. Wachstumsfaktoren Die Anreicherung von Knochenersatzstoffen durch Wachstumsfaktoren, die die Knochenregeneration fördern bzw. in der Lage sind Knochen zu bilden, kann additiv die osteokonduktiven Eigenschaften des Materials verstärken. Wachstumsfaktoren sind Proteine, die natürlicherweise von Zellen sekretiert werden und entweder direkt auf Zielzellen wirken oder eine spezifische Reaktion hervorrufen. Prinzipiell können sie auch mit einem Trägermaterial verabreicht werden. Zu den Wachstumsfaktoren, die während unterschiedlicher Heilungsphasen experimentell induzierter Knochenbrüche exprimiert werden, zählen z.b. Mitglieder der Transforming Growth Factor Beta (TGF- )-Superfamilie (TGF- Bone Morphogenetic Protein (BMP), Growth/Differentiation Faktor (GDF), Fibroblast Growth Factor (FGF), Platelet-derived Growth Factor (PDGF) und Insulin-like Growth Factor (IGF) (29). TGF- ist besonders für das Wachstum und die Differenzierung der Zellen und die Bildung der extrazellulären Matrix notwendig. In Tiermodellen wurde gezeigt, dass TGF- Periostzellen zur endochondralen Differenzierung stimuliert (20) oder auch die Bildung des Kallus verstärkt (30). Da es jedoch zusätzlich einen positiven Einfluss auf die Proliferation diverser Zellen hat, wird es nur eingeschränkt zur Knochenheilung eingesetzt. BMPs hingegen eignen sich zur Knochenregeneration, da sie mesenchymale Zellen zur osteochondroblastären Differenzierung anregen (18,57). In experimentell induzierten Knochendefekten am besten untersucht sind BMP-2 (3,13,43,58) und BMP-7 (7,8). Die klinische Anwendung von BMPs wurde in einigen Studien beschrieben und beschränkt sich hauptsächlich auf die Behandlung von Tibiafrakturen oder Pseudarthrosen (zusammengefasst in (12)). Neben dem Knochenaufbau ist die Versorgung des Transplantats mit Blut und Nährstoffen essentiell, weshalb Wachstumsfaktoren, die zusätzlich Angiogenese-fördernde Eigenschaften besitzen, in Tiermodellen getestet wurden. Zu diesen zählt z.b. der Vascular Jahrgang 63, Nr. 2 (2012) Deutsche Zeitschrift für Sportmedizin 31

3 ÜBERSICHT Knochen In situ Regeneration und Tissue Engineering Abbildung 1: Schematische Darstellung der in vitro Analysen zum Multidifferenzierungspotenzial, der Wachstumseigenschaften und der Genexpression von MSC und der Untersuchung der ektopen Knochenbildung von MSC nach Kombination mit Knochenersatzmaterialien im Tiermodell. Endothelial Growth Factor (VEGF). In experimentell induzierten Knochendefekten von Maus und Kaninchen wurde gezeigt, dass die optimierte Freigabe und lokale Applikation von VEGF (51) oder auch die Transplantation von VEGF-expirimierenden Fibroblasten (28) die Gefäßbildung während der Knochenheilung verstärkte. Der kombinierte Einsatz von osteogenen und angiogenen Wachstumsfaktoren wie z.b. BMP-2 und TGF- 3 in Alginat-Hydrogelen zeigte sowohl im ektopen Modell (49) als auch im Defektmodell (35) eine verstärkte Knochenbildung. Die Kombination von BMP-2 und VEGF erwies sich hingegen als nicht signifikant besser in der Knochenbildung bzw. beim Gefäßaufbau im orthotopen Modell als der jeweilige Wachstumsfaktor alleine (24). Designer-Wachstumsfaktoren Verbesserte Angiogenese mit gleichzeitigem Knochenaufbau kann durch die Entwicklung von sogenannten Designer-Wachstumsfaktoren erreicht werden. BMP-2 und GDF-5 beispielsweise vermitteln ihre osteoinduktive Wirkung u. a. über den BMP-Ia Rezeptor, wobei BMP-2 mit 17-fach stärkerer Affinität an den Rezeptor bindet. Durch die Angleichung definierter Aminosäuren innerhalb der Rezeptor-Bindungsregion von GDF-5 an BMP-2 ist es gelungen eine mutierte Form von GDF-5 (GDF-5 V453/V456 ) herzustellen, die ein gleichbleibend angiogenes und verstärkt osteogenes Potential aufwies. Im Defektmodell am Kaninchen, in den mit GDF-5 V453/V456 angereicherte Kollagenschwämme transplantiert wurden, fanden wir eine Überbrückung aller behandelten Defekte bereits vier Wochen post OP und es bildeten sich signifikant mehr Knochen und Blutgefäße als in Defekten mit BMP-2 alleine (Kleinschmidt et al., Holschbach et al., Manuskripte in Vorbereitung). Hypoxie-assoziierte Signalwege Die gezielte Aktivierung von Schlüsselmolekülen, die während des Knochenaufbaus die Vaskularisierung regulieren, könnte einen neuen therapeutischen Ansatz zur Förderung der Knochenheilung ermöglichen. Unter anderem wurde gezeigt, dass der Hypoxia Inducible Factor (HIF )-Signalweg eine Verbindung zwischen Osteogenese und Angiogenese herstellt. HIF-I ist ein Transkriptionsfaktor, der unter hypoxischen Bedingungen Angiogenese und Osteogenese durch die Hochregulation von VEGF stimuliert. Unter normoxischen Bedingungen wird er jedoch von Prolylhydroxylasen (PHD) abgebaut. Durch Anwendung von PHD-Inhibitoren bei Mäusen konnte das HIF-I Signal so verstärkt werden, dass deutlich mehr Angiogenese induziert und damit die Knochenregeneration signifikant erhöht werden konnte (46,54). Mesenchymale Stammzellen für die Knochenregeneration Mesenchymale Stammzellen (MSC) eignen sich aufgrund ihres mesodermalen Ursprungs ideal zum Wiederaufbau des Knochens. Postnatal sind MSC zwar aus vielen Geweben isolierbar, allerdings ist das Knochenmark bislang die am häufigsten verwendete Quelle für osteogen potente MSC. Ex vivo zeichnen sich MSC durch ihre Plastikadhärenz, ihre Multipotenz und durch die kombinierte Expression ausgewählter Oberflächenmarker aus (10). Die klinische Anwendung humaner autologer MSC für die Regeneration von Knochengewebe stellt den Mediziner jedoch vor einige Herausforderungen. Zum einen ist die Anzahl der MSC im 32 deutsche Zeitschrift für Sportmedizin Jahrgang 63, Nr. 2 (2012)

4 Knochen In situ Regeneration und Tissue Engineering ÜBERSICHT Knochenmark sehr gering (7-33 MSC pro Million nukleäre Zellen (5, 6,17,22,37,56)), sodass die Zellen ex vivo expandiert werden müssen, um genügend MSC für die Therapie zu erhalten. Zum anderen sind MSC-Populationen sehr heterogen, was zu einer erheblichen Variabilität in der Knochenbildungsfähigkeit zwischen den einzelnen Spendern führt (25, 26, 32, 47, 48). Das osteogene Potential der MSC kann sowohl in vitro durch spezielle Induktionsmedien, als auch in vivo in Kombination mit Knochenersatzmaterialien in ektopen Tiermodellen abgefragt werden. Jüngste Ergebnisse zeigen jedoch, dass die Fähigkeit humaner MSC aus dem Knochenmark in Zellkultur zu Osteoblasten zu differenzieren keineswegs mit ihrer in vivo Knochenbildungsfähigkeit korreliert (19). Folglich sind Methoden, die die Osteogenese humaner MSC in vitro beurteilen, als Tests für die Prädiktion der Knochenbildungsfähigkeit der Zellen in vivo untauglich. Ein wichtiger Faktor, der bei der Knochenbildungsfähigkeit humaner MSC eine Rolle spielt, ist das Alter des Spenders. Unsere Arbeiten konnten zeigen, dass aus Knochenmark von älteren Spendern nicht grundsätzlich weniger MSC isoliert werden können als von jungen Menschen, die Reaktivierbarkeit der Zellen zu schnellem Wachstum jedoch bei älteren Spendern eingeschränkt war (9). Keineswegs bevorzugten MSC von älteren Spendern jedoch eine Differenzierung zu Fettzellen gegenüber der zu Osteoblasten (9) wie man aus der mit dem Alter zunehmenden Menge an Fettmark im Knochen annehmen könnte. Allerdings erwies sich eine schlechtere Wachstumsrate von MSC grundsätzlich als ein so entscheidender Parameter für den Erfolg der in vivo Knochenbildung (19), dass wir durch Ermittlung der Verdopplungszeit von MSC unmittelbar vor Transplantation korrekt vorhersagen konnten, ob die Knochenbildung gelingen wird oder nicht. Damit liegt nahe, dass die altersabhängige Verringerung der MSC-Vermehrung zur Verschlechterung der Knochenregeneration beim alten Menschen beiträgt. In der Tat konnten wir durch irreversible Blockierung der Proliferationsfähigkeit von MSC zum Zeitpunkt der Transplantation die Knochenbildung unterbinden, während wachstumsfähige Zellen aus der korrespondierenden unbehandelten MSC-Population Knochen bilden konnten. Durch die gezielte Beschleunigung der Wachstumsgeschwindigkeit langsam wachsender MSC (z.b. von älteren Spendern) konnten wir eine erfolgreiche Knochenbildung im ektopen Mausmodell erreichen (19). Dies stellt in Aussicht, dass auch für ältere Spender geeignete Herstellungsbedingungen für MSC gefunden werden können, die eine Therapie von Knochendefekten vielversprechend erscheinen lassen können und das Alter kein Ausschlusskriterium für stammzellbasierte Therapiestrategien darstellen muss. Klinische Studien mit autologen MSC aus Knochenmark Bis heute gibt es nur wenige aussagekräftige klinische Studien über die Anwendung autologer MSC bei Knochendefekten. Berichte über erfolgreiche Wiederherstellung des Knochengewebes zeigen Fallstudien, bei denen z.b. Kieferknochen mit Hilfe boviner Spongiosa, BMP-7 und Knochenmark regeneriert wurde (55) oder Knochendefekte mit Hilfe von Keramiken und osteogen induzierten MSC behandelt wurden (23,33). Einzelne Studien berichteten, dass auch durch die direkte Injektion frisch entnommenen Knochenmarks in Pseudarthrosen bei 68 von 72 Patienten (50) bzw. bei 15 von 20 Patienten (15) eine Knochenregeneration möglich war. Hernigou und Kollegen berichteten gar über eine standardisierte Behandlung von Knochendefekten an der Tibia mit Hilfe einer Methode, die darauf abzielte das Knochenmark des Patienten mittels eines geschlossenen Zentrifugationssystems im Operationssaal zu konzentrieren und das Konzentrat direkt in den Knochendefekt zu applizieren (16,17). Der Vorteil dieser Methode liegt darin, dass nur ein operativer Eingriff für die Therapie genügt und Kosten gespart werden könnten. Zuvor wurde mit Hilfe dieser Technik bei 53 von 60 Patienten nach 3 bis 8 Wochen post OP eine Kallusbildung beobachtet (17), allerdings wird nicht von einer signifikanten Verbesserung im statistischen Sinne der Knochenheilung gesprochen, da gar keine Kontrollgruppe ohne MSC-Behandlung in dieser Studie eingeschlossen worden war. Die Autoren um Hernigou berichteten lediglich, dass bei den 7 Patienten, bei denen der Knochen nicht heilte, signifikant weniger Progenitoren injiziert wurden (16). Auffallend ist, dass bislang über einen Zeitraum von 6 Jahren noch keine Folgestudien anderer Gruppen vorliegen, die einen solchen Erfolg bestätigen könnten. Expandierte autologe MSC in Kombination mit einem HA- Träger wurden ebenfalls zur Behandlung von 4-7cm großen Defekten eingesetzt und zeigten bereits zwei Monate post OP eine gute Integration des Transplantats und Kallusbildung, was bei einer Standardbehandlung in der Regel etwa Monate dauern würde (31,38). Zulassungsrelevante Aspekte Die Verwendung von biotechnologisch bearbeiteten Gewebeprodukten, also von Tissue Engineering-Produkten, ist seit Dezember 2008 durch die zentrale Verordnung (EC) Nr. 1394/2007, auch Verordnung über Arzneimittel für neuartige Therapien (Advanced Therapy Medicinal Product, ATMP) genannt, europaweit strikt reguliert (59). Aufgrund dieser Verordnung müssen Zulassungsanträge für potentielle Produkte in diversen Behörden bewertet und eingestuft werden. Bei Kombinationsprodukten, die aus Medizinprodukten und Zellen bestehen, überschneiden sich die Zuständigkeiten der deutschen Bundesbehörden, da das Medizinprodukt in die Zuständigkeit des Bundesinstituts für Arzneimittel und Medizinprodukte (BfArM) fällt, zelluläre Komponenten jedoch vom Paul-Ehrlich-Institut (PEI) bewertet werden (53). Zusätzlich zum bürokratischen Aufwand müssen bei der Aufarbeitung und Herstellung von Tissue Engineering-Produkten hohe GMP-Standards (EU-Richtlinie 2003/94/ EC, für MSC: (44)) eingehalten werden, die Zellvitalität, Sterilität der Komponenten und hohe Sicherheitsanforderungen sicherstellen. Die Anwendung autologer MSC erfordert auch die Feststellung der exakten Identität der Zellen mittels eindeutiger in vivo MSC-Marker. Hinzu kommen die Sicherstellung der Reproduzierbarkeit der Aufarbeitung der Zellen und der Herstellung des Produktes. Zudem stellt sich die Frage nach dem genauen Wirkungsmechanismus des ATMP, da sowohl Erfahrungswerte als auch klinische Studien noch sehr begrenzt sind. Damit gibt es aufgrund dieser Gegebenheiten bislang kein zugelassenes und kommerziell erwerbliches Tissue Engineering-Produkt für die Knochenregeneration. Fazit Die Behandlung nicht-heilender Knochendefekte mittels klassischer Methoden wie autogener oder allogener Transplantation von Knochengewebe hat sich bislang zwar bewährt, birgt jedoch Jahrgang 63, Nr. 2 (2012) Deutsche Zeitschrift für Sportmedizin 33

5 ÜBERSICHT Knochen In situ Regeneration und Tissue Engineering einige Risiken und Nachteile für den Patienten. Neue Konzepte der Regenerativen Medizin hingegen bieten vielversprechende patientenfreundliche Möglichkeiten wie die Geweberegeneration mittels in situ Regeneration oder den vollständigen Gewebeersatz mittels Tissue Engineering-Methoden. Dabei kann der endogene Reparaturmechanismus mit Hilfe von geeigneten Knochenersatzmaterialien, multifunktionellen Designer-Wachstumsfaktoren und bestimmten Transkriptionsfaktoren wie HIF-I stimuliert werden, oder aber das fehlende Knochengewebe durch potente Vorläuferzellen gänzlich ersetzt werden. Erste klinische Studien demonstrierten den erfolgreichen Einsatz autologer MSC zum Wiederaufbau des Knochens, jedoch sind prospektive, randomisierte Studien mit standardisierten Protokollen zur Zellgewinnung notwendig, um valide Aussagen über die Anwendbarkeit von MSC-basierten Tissue Engineering-Produkten und ihren Langzeitfolgen machen zu können. Die hohen regulatorischen Hürden verbunden mit der bislang nicht vollständig verstandenen Biologie mesenchymaler Stammzellen machen noch viele weitere methodische und funktionelle Untersuchungen notwendig. Angaben zu finanziellen Interessen und Beziehungen, wie Patente, Honorare oder Unterstützung durch Firmen: Keine. Literatur 1. Arrington ED, Smith WJ, Chambers HG, Bucknell AL, Davino NA: Complications of iliac crest bone graft harvesting. Clin Orthop Relat Res (1996) doi: / Banwart JC, Asher MA, Hassanein RS: Iliac crest bone graft harvest donor site morbidity. A statistical evaluation. Spine 20 (1995) doi: / Bostrom M, Lane JM, Tomin E, et al: Use of bone morphogenetic protein-2 in the rabbit ulnar nonunion model. Clin Orthop Relat Res (1996) doi: / Boyce T, Edwards J, Scarborough N: Allograft bone. The influence of processing on safety and performance. Orthop Clin North Am 30 (1999) doi: /s (05) Bruder SP, Fink DJ, Caplan AI: Mesenchymal stem cells in bone development, bone repair, and skeletal regeneration therapy. J Cell Biochem 56 (1994) doi: /jcb Campagnoli C, Roberts IA, Kumar S, Bennett PR, Bellantuono I, Fisk NM: Identification of mesenchymal stem/progenitor cells in human first-trimester fetal blood, liver, and bone marrow. Blood 98 (2001) doi: /blood.v Cook SD, Baffes GC, Wolfe MW, Sampath TK, Rueger DC: Recombinant human bone morphogenetic protein-7 induces healing in a canine long-bone segmental defect model. Clin Orthop Relat Res (1994) Cook SD, Wolfe MW, Salkeld SL, Rueger DC: Effect of recombinant human osteogenic protein-1 on healing of segmental defects in non-human primates. J Bone Joint Surg Am 77 (1995) Dexheimer V, Mueller S, Braatz F, Richter W: Reduced reactivation from dormancy but maintained lineage choice of human mesenchymal stem cells with donor age. PLoS ONE 6 (2011) e doi: / journal.pone Dominici M, Le Blanc K, Mueller I, et al: Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8 (2006) doi: / Fritz J, Janssen P, Gaissmaier C, Schewe B, Weise K: Articular cartilage defects in the knee--basics, therapies and results. Injury 392 (Suppl 1) (2008) doi: /j.injury Garrison KR, Shemilt I, Donell S, et al: Bone morphogenetic protein (BMP) for fracture healing in adults. Cochrane Database Syst Rev (2010) CD Gerhart TN, Kirker-Head CA, Kriz MJ, et al: Healing segmental femoral defects in sheep using recombinant human bone morphogenetic protein. Clin Orthop Relat Res (1993) Gerstenfeld LC, Cullinane DM, Barnes GL, Graves DT, Einhorn TA: Fracture healing as a post-natal developmental process: molecular, spatial, and temporal aspects of its regulation. J Cell Biochem 88 (2003) doi: /jcb Goel A, Sangwan SS, Siwach RC, Ali AM: Percutaneous bone marrow grafting for the treatment of tibial non-union. Injury 36 (2005) doi: /j.injury Hernigou P, Mathieu G, Poignard A, Manicom O, Beaujean F, Rouard H: Percutaneous autologous bone-marrow grafting for nonunions. Surgical technique. J Bone Joint Surg Am 88 (Suppl 1 Pt 2) (2006) doi: /jbjs.f Hernigou P, Poignard A, Beaujean F, Rouard H: Percutaneous autologous bone-marrow grafting for nonunions. Influence of the number and concentration of progenitor cells. J Bone Joint Surg Am 87 (2005) doi: /jbjs.d Hoffmann A, Gross G: BMP signaling pathways in cartilage and bone formation. Crit Rev Eukaryot Gene Expr 11 (2001) Janicki P, Boeuf S, Steck E, Egermann M, Kasten P, Richter W: Prediction of in vivo bone forming potency of bone marrow-derived human mesenchymal stem cells. Eur Cell Mater 21 (2011) Joyce ME, Jingushi S, Bolander ME: Transforming growth factorbeta in the regulation of fracture repair. Orthop Clin North Am 21 (1990) Kalfas IH: Principles of bone healing. Neurosurg Focus 10 (2001) 1. doi: /foc Kasten P, Beyen I, Egermann M, et al: Instant stem cell therapy: characterization and concentration of human mesenchymal stem cells in vitro. Eur Cell Mater 16 (2008) Kawate K, Yajima H, Ohgushi H, et al: Tissue-engineered approach for the treatment of steroid-induced osteonecrosis of the femoral head: transplantation of autologous mesenchymal stem cells cultured with beta-tricalcium phosphate ceramics and free vascularized fibula. Artif Organs 30 (2006) doi: /j x. 24. Kempen DH, Lu L, Heijink A, et al: Effect of local sequential VEGF and BMP-2 delivery on ectopic and orthotopic bone regeneration. Biomaterials 30 (2009) doi: /j.biomaterials Krebsbach PH, Kuznetsov SA, Satomura K, Emmons RV, Rowe DW, Robey PG: Bone formation in vivo: comparison of osteogenesis by transplanted mouse and human marrow stromal fibroblasts. Transplantation 62 (1997) doi: / Kuznetsov SA, Krebsbach PH, Satomura K, et al: Single-colony derived strains of human marrow stromal fibroblasts form bone after transplantation in vivo. J Bone Miner Res 12 (1997) doi: /jbmr Laurencin C, Khan Y, El Amin SF: Bone graft substitutes. Expert Rev Med Devices 3 (2006) doi: / Li R, Stewart DJ, von Schroeder HP, Mackinnon ES, Schemitsch EH: Effect of cell-based VEGF gene therapy on healing of a segmental bone defect. J Orthop Res 27 (2009) doi: /jor Lieberman JR, Daluiski A, Einhorn TA: The role of growth factors in the repair of bone. Biology and clinical applications. J Bone Joint Surg Am 84-A (2002) Lind M, Schumacker B, Soballe K, Keller J, Melsen F, Bunger C: Transforming growth factor-beta enhances fracture healing in rabbit tibiae. Acta Orthop Scand 64 (1993) doi: / Marcacci M, Kon E, Moukhachev V, et al: Stem Cells Associated with Macroporous Bioceramics for Long Bone Repair: 6- to 7-Year Outcome of a Pilot Clinical Study. Tissue Eng 13 (2007) doi: / ten Mendes SC, Tibbe JM, Veenhof M, et al: Bone tissue-engineered implants using human bone marrow stromal cells: Effect of 34 deutsche Zeitschrift für Sportmedizin Jahrgang 63, Nr. 2 (2012)

6 Knochen In situ Regeneration und Tissue Engineering ÜBERSICHT culture conditions and donor age. Tissue Eng 8 (2002) doi: / Morishita T, Honoki K, Ohgushi H, Kotobuki N, Matsushima A, Takakura Y: Tissue engineering approach to the treatment of bone tumors: three cases of cultured bone grafts derived from patients' mesenchymal stem cells. Artif Organs 30 (2006) doi: /j x. 34. Neufeld DA und Mohammad K: Regeneration of Bone. Encyclopedia of Life Sciences (1 A.D.). 35. Oest ME, Dupont KM, Kong HJ, Mooney DJ, Guldberg RE: Quantitative assessment of scaffold and growth factor-mediated repair of critically sized bone defects. J Orthop Res 25 (2007) doi: / jor Praemer, A, Furner, S, Rice, D: Musculoskeletal Condition in the United States. (1992). 37. Prockop DJ, Azizi SA, Colter D, DiGirolamo C, Kopen G, Phinney DG: Potential use of stem cells from bone marrow to repair the extracellular matrix and the central nervous system. Biochem Soc Trans 28 (2000) doi: / : Quarto R, Mastrogiacomo M, Cancedda R, et al: Repair of large bone defects with the use of autologous bone marrow stromal cells. N Engl J Med 344 (2001) doi: /nejm Richter, W und Diederichs, S: [Regenerative medicine in orthopaedics : Cell therapy - tissue engineering - in situ regeneration.]. Orthopade (2009). 40. Runkel M, Rommens PM: [Pseudoarthrosis]. Unfallchirurg 103 (2000) doi: /s Ruter A, Mayr E: [Pseudarthrosis]. Chirurg 70 (1999) doi: /s Schmidt-Rohlfing B, Tzioupis C, Menzel CL, Pape HC: [Tissue engineering of bone tissue. Principles and clinical applications]. Unfallchirurg 112 (2009) doi: /s x. 43. Sciadini MF, Johnson KD: Evaluation of recombinant human bone morphogenetic protein-2 as a bone-graft substitute in a canine segmental defect model. J Orthop Res 18 (2000) doi: / jor Sensebé L, Bourin P, Tarte K: Good manufacturing practices production of mesenchymal stem/stromal cells. Hum Gene Ther 22 (2011) doi: /hum Shapiro, F: Bone development and its relation to fracture repair. The role of mesenchymal osteoblasts and surface osteoblasts. Eur Cell Mater 15 (2008) Shen X, Wan C, Ramaswamy G, et al: Prolyl hydroxylase inhibitors increase neoangiogenesis and callus formation following femur fracture in mice. J Orthop Res 27 (2009) doi: /jor Siddappa R, Licht R, van Blitterswijk C, de Boer J: Donor variation and loss of multipotency during in vitro expansion of human mesenchymal stem cells for bone tissue engineering. J Orthop Res 25 (2007) doi: /jor Siddappa R, Martens A, Doorn J, et al: camp/pka pathway activation in human mesenchymal stem cells in vitro results in robust bone formation in vivo. Proc Natl Acad Sci USA 105 (2008) doi: /pnas Simmons CA, Alsberg E, Hsiong S, Kim WJ, Mooney DJ: Dual growth factor delivery and controlled scaffold degradation enhance in vivo bone formation by transplanted bone marrow stromal cells. Bone 35 (2004) doi: /j.bone Siwach RC, Sangwan SS, Singh R, Goel A: Role of percutaneous bone marrow grafting in delayed unions, non-unions and poor regenerates. Indian J Med Sci 55 (2001) Street J, Bao M, deguzman L, et al: Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover. Proc Natl Acad Sci USA 99 (2002) doi: / pnas Tomford WW: Transmission of disease through transplantation of musculoskeletal allografts. J Bone Joint Surg Am 77 (1995) Walter C, Rohde B, Wicke DC, Pohler C, Luhrmann A. von der, LH: [Regulatory framework of innovative therapies : From bench to bedside]. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz 54 (2011) doi: /s z. 54. Wan C, Gilbert SR, Wang Y, et al: Activation of the hypoxia-inducible factor-1alpha pathway accelerates bone regeneration. Proc Natl Acad Sci USA 105 (2008) doi: /pnas Warnke PH, Springer IN, Wiltfang J, et al: Growth and transplantation of a custom vascularised bone graft in a man. Lancet 364 (2004) doi: /s (04) Wexler SA, Donaldson C, Denning-Kendall P, Rice C, Bradley B, Hows JM: Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol 121 (2003) doi: /j x. 57. Yamaguchi A: Regulation of differentiation pathway of skeletal mesenchymal cells in cell lines by transforming growth factor-beta superfamily. Semin Cell Biol 6 (1995) doi: /scel Yasko AW, Lane JM, Fellinger EJ, Rosen V, Wozney JM, Wang EA: The healing of segmental bone defects, induced by recombinant human bone morphogenetic protein (rhbmp-2). A radiographic, histological, and biomechanical study in rats. J Bone Joint Surg Am 74 (1992) Ziegele B, Dahl L, Muller AT: [The Innovation Office of the Paul- Ehrlich-Institut. Regulatory support during the scientific development of ATMP]. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz 54 (2011) doi: /s Korrespondenzadresse: Prof. Dr. Wiltrud Richter Forschungszentrum für Experimentelle Orthopädie Orthopädische Universitätsklinik Heidelberg Schlierbacher Landstraße 200a Heidelberg Jahrgang 63, Nr. 2 (2012) Deutsche Zeitschrift für Sportmedizin 35

putty Der synthetische, resorbierbare Spongiosaersatz mit Osteoinduktion

putty Der synthetische, resorbierbare Spongiosaersatz mit Osteoinduktion putty Der synthetische, resorbierbare Spongiosaersatz mit Osteoinduktion Quality made in Germany Der synthetische, resorbierbare Spongiosaersatz mit Osteoinduktion Informationen zum synthetischen Knochenaufbaumaterial


Regulatorischer Rahmen. Klassifizierung

Regulatorischer Rahmen. Klassifizierung Regulatorischer Rahmen Erkenntnisgewinn zu Regenerations- und Reparaturprozessen des menschlichen Körpers führen zu neuen Arten innovativer und komplexer Produkte. Unter Regenerativer Medizin (kurz: RegMed)


Tissue engineering. Auf dem Weg zum Ersatzteillager Mensch? Status und Perspektiven des. Tissue engineering. Dr. Cornelia Kasper

Tissue engineering. Auf dem Weg zum Ersatzteillager Mensch? Status und Perspektiven des. Tissue engineering. Dr. Cornelia Kasper Auf dem Weg zum Ersatzteillager Mensch? Status und Perspektiven des Tissue engineering Definition und Prinzip Status/Beispiele Entwicklungen am TCI Perspektiven Zukunftstechnologie Ersaztteilzüchtung Organe


Hohlräume der Natur füllen.

Hohlräume der Natur füllen. Hohlräume der Natur füllen. 1 Daten in Akten bei RTI Biologics, Inc. 2 Schoepf C. Allograft safety: the efficacy of the Tutoplast Process. Implants: International Magazine of Oral Implantology. 2006;1(7):


Knochenersatz- Systematik, Möglichkeiten und Grenzen ein Überblick. Steffen Zätzsch Geschäftsführer SpongioTech

Knochenersatz- Systematik, Möglichkeiten und Grenzen ein Überblick. Steffen Zätzsch Geschäftsführer SpongioTech Knochenersatz- Systematik, Möglichkeiten und Grenzen ein Überblick Steffen Zätzsch Geschäftsführer SpongioTech Notwendigkeiten für den Einsatz von Knochenersatzmaterial KEM - große spongiöse Knochendefekte


Medizinische Universität Graz. Adulte Stammzellen. Hoffnungsträger der modernen Medizin

Medizinische Universität Graz. Adulte Stammzellen. Hoffnungsträger der modernen Medizin Medizinische Universität Graz Adulte Stammzellen Hoffnungsträger der modernen Medizin Große Hoffnung durch neue Verfahren in der Stammzelltherapie Forschung im Dienst der Gesellschaft Mit dem gezielten

Mehr Stammzellen. Aus Nabel- Schnurblut Und anderen Quellen- Was ist heute schon reif für die Praxis? Stammzellen. Aus Nabel- Schnurblut Und anderen Quellen- Was ist heute schon reif für die Praxis? Stammzellen Aus Nabel- Schnurblut Und anderen Quellen- Dr.h.c.mult. Wolfgang Holzgreve, MBA Was ist heute schon reif für die Praxis? Wissenschaftskolleg zu Berlin/ Institute


Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden Stammzellenmanipulation Hämatopoietische Stammzellen können gebraucht werden um kranke Zellen mit gesunden zu ersetzen (siehe experiment bestrahlte Maus) Epidermale Stammzellpopulationen können in Kultur


Fettgeweberegeneration. für die Rekonstruktive und Plastische Chirurgie

Fettgeweberegeneration. für die Rekonstruktive und Plastische Chirurgie Fettgeweberegeneration für die Rekonstruktive und Plastische Chirurgie Prof. Dr. Torsten Blunk Klinik und Poliklinik für Unfall-, Hand-, Plastische und Wiederherstellungschirurgie Universitätsklinikum


Patienteninformation. Knochenaufbau bei: Implantation Zahnextraktion Wurzelspitzenresektion Parodontitisbehandlung Kieferzystenentfernung

Patienteninformation. Knochenaufbau bei: Implantation Zahnextraktion Wurzelspitzenresektion Parodontitisbehandlung Kieferzystenentfernung Knochenaufbau bei: Implantation Zahnextraktion Wurzelspitzenresektion Parodontitisbehandlung Kieferzystenentfernung curasan AG Lindigstraße 4 D-63801 Kleinostheim Telefon: (0 60 27) 46 86-0 Fax: (0 60


Knochenaufbau mit Biomaterialien

Knochenaufbau mit Biomaterialien Patienteninformation dental bone & tissue regeneration botiss biomaterials Knochenaufbau mit Biomaterialien bewährt sicher natürlich X100 Implantation Die Stabilität entscheidet Kierferkammatrophie Knochenabbau


Stammzellen besitzen 2 Hauptcharaktereigenschaften: Quellen von pluripotenten Stammzellen:

Stammzellen besitzen 2 Hauptcharaktereigenschaften: Quellen von pluripotenten Stammzellen: Stammzellen besitzen 2 Hauptcharaktereigenschaften: - langfristiger Selbstaufbau - produzieren viele verschiedene Arten von differenzierten Zellen Quellen von pluripotenten Stammzellen: -innere Zellmasse


Aufbau der Stammzellbank am Universitätsklinikum Erlangen

Aufbau der Stammzellbank am Universitätsklinikum Erlangen Aufbau der Stammzellbank am Universitätsklinikum Erlangen Prof. Dr. Volker Weisbach Transfusionsmedizinische und Hämostaseologische Abteilung, Universitätsklinikum Erlangen 06.02.2010 Plazentarestblutbank


Stammzellen. Therapie der Zukunft?

Stammzellen. Therapie der Zukunft? Stammzellen Therapie der Zukunft? Was sind Stammzellen? Embryo, aus embryonalen Stammzellen bestehend Stammzellen sind Ausgangszellen für die Bildung aller Gewebe und Organe, aus denen ein Lebewesen besteht


Hirntumore neue Therapien

Hirntumore neue Therapien Hirntumore neue Therapien Peter Vajkoczy CHARITÉ - Universitätsmedizin Berlin ( U N I V E R S I T Ä T S M E D I Z I N B E R L I N THERAPIE MALIGNER GLIOME Langzeitüberleben beim



Präzisions-Gentherapie Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Gentherapie trifft auf erfolgreiche Stammzelltherapie bei Lebererkrankung

Mehr Arthrose bei Hunden mit Stammzellen behandeln 6 Gründe, die bei Hunde-Arthrose für eine Stammzellen-Therapie sprechen. Tierarzt finden auf Hunde-Arthrose mit Stammzellentherapie erfolgreich behandeln:


Transgene Tiere: Genmodifikation in der Maus

Transgene Tiere: Genmodifikation in der Maus Transgene Tiere: Genmodifikation in der Maus Gentechnik und Genomics WiSe 2007/2008 Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Nobelpreis Physiologie und Medizin 2007


Optimierte Rekonstruktion des Röhrenknochens nach Trauma oder Infekt beim langstreckigen Defekt mit Spongiosaplastik

Optimierte Rekonstruktion des Röhrenknochens nach Trauma oder Infekt beim langstreckigen Defekt mit Spongiosaplastik Fallbericht Optimierte Rekonstruktion des Röhrenknochens nach Trauma oder Infekt beim langstreckigen Defekt mit Spongiosaplastik V. Heppert REPARIEREN UND REGENERIEREN Optimierte Rekonstruktion des Röhrenknochens


STAMMZELLEN. Therapie der Zukunft?

STAMMZELLEN. Therapie der Zukunft? STAMMZELLEN Therapie der Zukunft? WAS SIND STAMMZELLEN? Ausgangszellen für die Bildung aller Gewebe und Organe, aus denen ein Lebewesen besteht Charakteristische Merkmale (Unterscheidung von anderen Zellen)


Transplantation von Stammzellen und soliden Organen einige Gemeinsamkeiten, viele Unterschiede

Transplantation von Stammzellen und soliden Organen einige Gemeinsamkeiten, viele Unterschiede Transplantation von Stammzellen und soliden Organen einige Gemeinsamkeiten, viele Unterschiede Martin Stern Abteilung Hämatologie/Departement Biomedizin Universitätsspital Basel Nomenklatur I Stammzelle


Nicht-invasives Monitoring molekularer Therapien in der Onkologie: Bench-to-Bedside Etablierung von Biomarkern in der Therapieresponse (PM7)

Nicht-invasives Monitoring molekularer Therapien in der Onkologie: Bench-to-Bedside Etablierung von Biomarkern in der Therapieresponse (PM7) Nicht-invasives Monitoring molekularer Therapien in der Onkologie: Bench-to-Bedside Etablierung von Biomarkern in der Therapieresponse (PM7) Dr. biol. hum. Heidrun Hirner Institut für Klinische Radiologie


Projekt. Humane Thrombozytenextrakte als Serum-Ersatz in der Kultivierung von Stammzellen in In-vitro-Toxizitätstests

Projekt. Humane Thrombozytenextrakte als Serum-Ersatz in der Kultivierung von Stammzellen in In-vitro-Toxizitätstests [Text eingeben] Stiftung zur Förderung der Erforschung von Ersatz- und Ergänzungsmethoden zur Einschränkung von Tierversuchen Projekt Humane Thrombozytenextrakte als Serum-Ersatz in der Kultivierung von



POST MARKET CLINICAL FOLLOW UP POST MARKET CLINICAL FOLLOW UP (MEDDEV 2.12-2 May 2004) Dr. med. Christian Schübel 2007/47/EG Änderungen Klin. Bewertung Historie: CETF Report (2000) Qualität der klinischen Daten zu schlecht Zu wenige


Innovative Technologien für ein neues Medizin-Zeitalter

Innovative Technologien für ein neues Medizin-Zeitalter Innovative Technologien für ein neues Medizin-Zeitalter Gewinnung von körpereigenen Stammzellen direkt im OP Multipotente Stammzellen des Fettgewebes sind Alleskönner Die multipotenten Stammzellen des


Potenziale der Regenerativen Medizin bei sog. Verschleißkrankheiten

Potenziale der Regenerativen Medizin bei sog. Verschleißkrankheiten Alternsbezogene Gesundheitsressourcen und klinische Medizin Potenziale der Regenerativen Medizin bei sog. Verschleißkrankheiten FRAUNHOFER Innovationsforum 23. Oktober 2008 Dr. Gudrun Tiedemann Advanced


SCHÖNE ZÄHNE. Lebensqualität mit Zahnimplantaten 1

SCHÖNE ZÄHNE. Lebensqualität mit Zahnimplantaten 1 SCHÖNE ZÄHNE Lebensqualität mit Zahnimplantaten 1 1 Lebensqualität mit Zahnimplantaten bezieht sich auf eine höhere Lebensqualität mit einem Zahnimplantat im Vergleich zu keiner Behandlung. Awad M.A et


Kieferknochentransplantate. aus körpereigenen Knochenzellen. Informationen zur Behandlungsmethode. Praxis-/Klinikstempel

Kieferknochentransplantate. aus körpereigenen Knochenzellen. Informationen zur Behandlungsmethode. Praxis-/Klinikstempel Praxis-/Klinikstempel Kieferknochentransplantate aus körpereigenen Knochenzellen Haben Sie weitere Fragen zu autologen gezüchteten Kieferknochentransplantaten? Weitere Informationen zu der Behandlungsmethode


MEDIZINPRODUKTE. Chancen und Herausforderungen aus Sicht der Industrie

MEDIZINPRODUKTE. Chancen und Herausforderungen aus Sicht der Industrie MEDIZINPRODUKTE Chancen und Herausforderungen aus Sicht der Industrie Bonn, 16. September 2015, BfArM, Bundesinstitut für Arzneimittel und Medizinprodukte Joachim M. Schmitt Geschäftsführer/Vorstandsmitglied



Stammzelltransplantation Cornelie Haag Medizinische Klinik und Poliklinik 1 Universitätsklinikum Carl-Gustav-Carus Dresden 1 Klinische Einteilung - Begriffsbestimmung Autologe Quelle: Patient selbst KM oder peripheres Blut (Apherese)


EPICAL EPICAL. The Non-Coated Bioactive Calcium-Rich Surface* * Developed in cooperation with the Federal Institute for Material Research and Testing

EPICAL EPICAL. The Non-Coated Bioactive Calcium-Rich Surface* * Developed in cooperation with the Federal Institute for Material Research and Testing EPICAL The Non-Coated Bioactive Calcium-Rich Surface* An Awarded Procedure! EPICAL An Awarded Procedure! * Developed in cooperation with the Federal Institute for Material Research and Testing EPICAL -


Customer-specific software for autonomous driving and driver assistance (ADAS)

Customer-specific software for autonomous driving and driver assistance (ADAS) This press release is approved for publication. Press Release Chemnitz, February 6 th, 2014 Customer-specific software for autonomous driving and driver assistance (ADAS) With the new product line Baselabs


1. Einleitung. Knochenersatzmaterialien

1. Einleitung. Knochenersatzmaterialien 1. Einleitung Knochenersatzmaterialien Eine spontane Ausheilung eines umfangreichen Knochendefektes führt häufig zu einem funktionell ungünstigen bindegewebigen Ersatz, da das den Defekt umgebende Bindegewebe


Institut für Rekonstruktive Neurobiologie. Biomedizinische Anwendungen pluripotenter Stammzellen

Institut für Rekonstruktive Neurobiologie. Biomedizinische Anwendungen pluripotenter Stammzellen Institut für Rekonstruktive Neurobiologie Universität Bonn Biomedizinische Anwendungen pluripotenter Stammzellen Oliver Brüstle 10 Jahre Forschung mit humanen embryonalen Stammzellen Veranstaltung der


of chronic skin inflammation

of chronic skin inflammation DISS. ETH NO. 21996 Identification of new targets and treatment strategies for the therapy of chronic skin inflammation A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented


Stammzellenforschung Karina Köppl LK Biologie

Stammzellenforschung Karina Köppl LK Biologie Stammzellenforschung Karina Köppl LK Biologie 1.Was sind Stammzellen? Reparaturreserve des Körpers undifferenzierte Zellen von Menschen und Tieren Stammzellen sind in der Lage, sich zu teilen und neue


orthopaedics The Swiss spirit of innovation

orthopaedics The Swiss spirit of innovation orthopaedics The Swiss spirit of innovation Firma Produktbereiche Qualität Die Metoxit AG wurde 1978 gegründet und ist ein mittelständisches Schweizer Unternehmen, spezialisiert in der Herstellung


Zielgerichtete Therapie Ob Ihr wollt oder nicht

Zielgerichtete Therapie Ob Ihr wollt oder nicht Zielgerichtete Therapie Ob Ihr wollt oder nicht Ziad Atassi Universitätsfrauenklinik Ulm Direktor: Prof.Dr.R.Kreienberg inedome Ulm 08.07.2009 ADECATUMUMAB N = 22 NERATINIB N = 37 PERTUZUMAB N = 29 TRASTUZUMAB


Knochenaufbau mit Biomaterialien

Knochenaufbau mit Biomaterialien Patienteninformation dental bone & tissue regeneration botiss biomaterials Knochenaufbau mit Biomaterialien bewährt sicher natürlich X100 Implantation Die Stabilität entscheidet Kierferkammatrophie Knochenabbau


Gewebsersatz in der Implantologie: Knochenaugmentation des Sinusbodens mit autologen osteogenen Transplantaten

Gewebsersatz in der Implantologie: Knochenaugmentation des Sinusbodens mit autologen osteogenen Transplantaten Profesor Invitado Universidad Sevilla Dr. (H) Peter Borsay Gewebsersatz in der Implantologie: Knochenaugmentation des Sinusbodens mit autologen osteogenen Transplantaten Auf Grund des in den letzten Jahren


Analyse der Funktionen der A Disintegrin und Metalloprotease 10 (ADAM10) in Leber und Niere und der Regulation der Proteaseaktivität

Analyse der Funktionen der A Disintegrin und Metalloprotease 10 (ADAM10) in Leber und Niere und der Regulation der Proteaseaktivität Analyse der Funktionen der A Disintegrin und Metalloprotease 10 (ADAM10) in Leber und Niere und der Regulation der Proteaseaktivität Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen


3D-Printing in der computerassistierten Chirurgie

3D-Printing in der computerassistierten Chirurgie 3D-Printing in der computerassistierten Chirurgie Prof. Dr.-Ing. Stefan Weber ARTORG - Forschungszentrum ISTB - Institut für chirurgische Technologien und Biomechanic Universität Bern The ARTORG Center


Biopharm GmbH: Wachstumsfaktor der regenerativen Medizin

Biopharm GmbH: Wachstumsfaktor der regenerativen Medizin Powered by Seiten-Adresse: Biopharm GmbH: Wachstumsfaktor der regenerativen Medizin


Susanne Kühl Michael Kühl Stammzellbiologie

Susanne Kühl Michael Kühl Stammzellbiologie Susanne Kühl Michael Kühl Stammzellbiologie Ulmer 20 Grundlagen Apoptose: der programmierte Zelltod 1.4.4 Der Notch-Signalweg Von besonderer Bedeutung ist darüber hinaus der Notch/Delta-Signalweg (Abb.


Was ist unicca? Der Start programmiert das Ende. UnicCa ist eine neue Oberfläche für BTI- Implantate der Serie optima, mit Calcium-Ionen behandelt.

Was ist unicca? Der Start programmiert das Ende. UnicCa ist eine neue Oberfläche für BTI- Implantate der Serie optima, mit Calcium-Ionen behandelt. OBERFLÄCHE unicca unicca OBERFLÄCHE Der Start programmiert das Ende Was ist unicca? UnicCa ist eine neue Oberfläche für BTI- Implantate der Serie optima, mit Calcium-Ionen behandelt. Halsbereich Kehlen


Stammzelltransplantation: Nabelschnurblut, periphere Blutstammzellen, Knochenmark

Stammzelltransplantation: Nabelschnurblut, periphere Blutstammzellen, Knochenmark Stammzelltransplantation: Nabelschnurblut, periphere Blutstammzellen, Knochenmark Nina Worel Medizinische Universität Wien Stammzelltransplantation: Generelles Konzept Zytoreduktion Engraftment Leukämie



Indikationserweiterung der. KLINIK UND POLIKLINIK FÜR FRAUENHEILKUNDE UND GEBURTSHILFE Darius Dian Titanisiertes i i Netz, azelluläre lä Matrix Indikationserweiterung der Implantatchirurgie KLINIK UND POLIKLINIK FÜR FRAUENHEILKUNDE UND GEBURTSHILFE Titanisiertes Netz Azelluläre Matrix Titanisiertes


Brustrekonstruktion mit Eigenfett und Stammzellen als sichere Methode bewährt

Brustrekonstruktion mit Eigenfett und Stammzellen als sichere Methode bewährt Veröffentlichung: 10.05.2016 09:30 Brustrekonstruktion mit Eigenfett und Stammzellen als sichere Methode bewährt US-Studie belegt Sicherheit von Eigenfetttransfer zur Brustrekonstruktion nach Brustkrebs


Zahntransplantation. Indikation

Zahntransplantation. Indikation Zahntransplantation Die Kenntnis von Zahnersatz auf der Basis von Zahnimplantaten (künstlichen Zahnwurzeln) ist weit verbreitet. Weitgehend unbekannt ist hingegen die Möglichkeit der Verpflanzung von Zähnen


BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl

BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl BMP / TGF-ß Receptor Prof. Dr. Albert Duschl Biologische Regelsysteme Behalten Sie bitte im Gedächtnis, daß biologische Systeme immer wieder vor vergleichbaren Aufgaben stehen, bei denen es darum geht,


Wie soll individualisierte Medizin in evidenzbasierten Leitlinien umgesetzt werden? Eine Analyse von Leitlinienmanualen

Wie soll individualisierte Medizin in evidenzbasierten Leitlinien umgesetzt werden? Eine Analyse von Leitlinienmanualen IFOM INSTITUT FÜR FORSCHUNG IN DER OPERATIVEN MEDIZIN Wie soll individualisierte Medizin in evidenzbasierten Leitlinien umgesetzt werden? Eine Analyse von Leitlinienmanualen Michaela Eikermann, Tim Mathes,


Knochen versus Knochenersatz

Knochen versus Knochenersatz Knochen versus Knochenersatz Knöcherne Defekte im Bereich der Kiefer können mit unterschiedlichen Behandlungsmethoden rekonstruiert werden. Dabei werden in den meisten Fällen Substrate verwendet, die das


"Plastische Chirurgie - eine reine Erfahrungsdisziplin?"

Plastische Chirurgie - eine reine Erfahrungsdisziplin? "Plastische Chirurgie - eine reine Erfahrungsdisziplin?" RE Horch, MG Jeschke, J Kopp, AD Bach Abteilung für Plastische und Handchirurgie Leiter Prof. Dr. R.E. Horch Universitätsklinik Erlangen Einleitung


mi-rna, zirkulierende DNA

mi-rna, zirkulierende DNA Erbsubstanz: Grundlagen und Klinik mi-rna, zirkulierende DNA 26.11.2010 Ingolf Juhasz-Böss Homburg / Saar Klinische Erfahrungen zirkulierende mirna erstmals 2008 im Serum von B-Zell Lymphomen beschrieben


Focal Adhesion Protein Interaction and. Cytoskeletal Adaptation during Osteogenesis: Watching it happen

Focal Adhesion Protein Interaction and. Cytoskeletal Adaptation during Osteogenesis: Watching it happen Diss. N 19357 Focal Adhesion Protein Interaction and Cytoskeletal Adaptation during Osteogenesis: Watching it happen A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented


Kostenreduktion durch Prävention?

Kostenreduktion durch Prävention? Gesundheitsökonomische Aspekte der Prävention: Kostenreduktion durch Prävention? Nadja Chernyak, Andrea Icks Jahrestagung DGSMP September 2012 Agenda Spart Prävention Kosten? Ist Prävention ökonomisch


e n t a l

e n t a l e n t a l Firma Die Metoxit AG ist ein mittelständisches Schweizer Unternehmen, das zur AGZ-Holding gehört. Metoxit bietet eine breite Palette von Produkten aus Hochleistungskeramik (Oxidkeramik)


Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt


Vielfalt der Zellen - Integration ins hörgeschädigte Ohr

Vielfalt der Zellen - Integration ins hörgeschädigte Ohr Vielfalt der Zellen - Integration ins hörgeschädigte Ohr Dr. med. Pascal Senn Universitätsklinik für HNO, Kopf- und Halschirurgie Inselspital, 3010 Bern Inhalt Einführung Vielfalt der Zellen Definitionen


Michael Gelinsky 1/44

Michael Gelinsky 1/44 Michael Gelinsky Herstellung von patientenindividuellen Implantaten und Tissue Engineering- Konstrukten mit dem Verfahren des 3D-Plottens: Perspektiven und Limitationen Zentrum für Translationale Knochen-,


Regenerative Therapie > Heilen mit Stammzellen

Regenerative Therapie > Heilen mit Stammzellen Regenerative Therapie > Heilen mit Stammzellen Emmrich Miglied im Deutschen Ethikrat 11.Münchener Wissenschaftstage 23.10.2011


The Mrs.Sporty Story Founders and History

The Mrs.Sporty Story Founders and History Welcome to The Mrs.Sporty Story Founders and History 2003: vision of Mrs. Sporty is formulated 2004: pilot club opened in Berlin 2005: launch of Mrs.Sporty franchise concept with Stefanie Graf Stefanie


Introduction to the diploma and master seminar in FSS 2010. Prof. Dr. Armin Heinzl. Sven Scheibmayr

Introduction to the diploma and master seminar in FSS 2010. Prof. Dr. Armin Heinzl. Sven Scheibmayr Contemporary Aspects in Information Systems Introduction to the diploma and master seminar in FSS 2010 Chair of Business Administration and Information Systems Prof. Dr. Armin Heinzl Sven Scheibmayr Objective


Was gibt es Neues zur Stammzelltransplantation. E Holler Klinik f Innere Medizin III Klinikum der Universität Regensburg

Was gibt es Neues zur Stammzelltransplantation. E Holler Klinik f Innere Medizin III Klinikum der Universität Regensburg Was gibt es Neues zur Stammzelltransplantation E Holler Klinik f Innere Medizin III Klinikum der Universität Regensburg Themen Aktuelle Entwicklungen der Indikationen: Fortschritte generell? Neue allogene


Im Dienste der Gesundheit

Im Dienste der Gesundheit Im Dienste der Gesundheit Unternehmensvorstellung Neunkirchen, November 2013 IN COMPLIANCE WITH HEALTH 1 Unternehmen Stammsitz im fränkischen Neunkirchen am Brand 160 Mitarbeiter Versorger für regenerative


After sales product list After Sales Geräteliste

After sales product list After Sales Geräteliste GMC-I Service GmbH Thomas-Mann-Str. 20 90471 Nürnberg After sales product list After Sales Geräteliste Ladies and Gentlemen, (deutsche Übersetzung am Ende des Schreibens)


Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt. Rekombinante Wirkstoffe Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Empfohlene Literatur Rekombinante Wirkstoffe Der legale


DFG. Deutsche Forschungsgemeinschaft. Forschung mit humanen embryonalen Stammzellen. Research with Human Embryonic Stern Cells. Standpunkte/Positions

DFG. Deutsche Forschungsgemeinschaft. Forschung mit humanen embryonalen Stammzellen. Research with Human Embryonic Stern Cells. Standpunkte/Positions Deutsche Forschungsgemeinschaft Forschung mit humanen embryonalen Stammzellen Research with Human Embryonic Stern Cells Standpunkte/Positions WILEY- VCH WILEY-VCH GmbH & Co. KGaA DFG Vorwort IX Forschung


Eine wissenschaftliche Darstellung über den heutigen Kenntnisstand von Stammzelltherapien zur Behandlung von Diabetes mellitus senden wir Ihnen anbei.

Eine wissenschaftliche Darstellung über den heutigen Kenntnisstand von Stammzelltherapien zur Behandlung von Diabetes mellitus senden wir Ihnen anbei. Paul-Ehrlich-Institut Paul-Ehrlich-Str. 51-59 63225 Langen Sprecherin des Kompetenznetzes Diabetes mellitus: Prof. Dr. Anette-Gabriele Ziegler Forschergruppe Diabetes der Technische Universität München


Cerebrale Metastasierung warum?

Cerebrale Metastasierung warum? Molekulare Erklärungen für klinische Beobachtungen Cerebrale Metastasierung warum? Volkmar Müller Klinik für Gynäkologie, Brustzentrum am UKE Universitätsklinikum Hamburg-Eppendorf Cerebrale Metastasierung


Gentherapie. Grüne Gentechnologie

Gentherapie. Grüne Gentechnologie Gentherapie Grüne Gentechnologie Definition Mit Gentherapie bezeichnet man das Einfügen von Genen in Zellen eines Individuums zur Behandlung von Erbkrankheiten bzw. Gendefekten Durch die Einführung soll


Integration of a CO 2 separation process in a coal fired power plant

Integration of a CO 2 separation process in a coal fired power plant Integration of a CO 2 separation process in a coal fired power plant, Hans Fahlenkamp, Bernhard Epp Technische Universität Dortmund *AiF 15234 N: CO 2 Druckgaswäsche mit Membrankontaktoren Forschungsstellen:


Risk-Managements for Installation, Maintenance and Reprocessing of Medical Devices

Risk-Managements for Installation, Maintenance and Reprocessing of Medical Devices Risk-Managements for Installation, Maintenance and Reprocessing of Medical Devices Laws, Guidelines and Standards Medizinproduktegesetz (MPG) Medizinprodukte-Betreiberverordnung (MBetreibV) Sicherheitsplanverordnung


Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen

Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen Dr. rer. nat. Jasmin Wellbrock und Prof. Dr. Walter Fiedler Projektbericht an die Alfred & Angelika Gutermuth Stiftung Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen


Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie

Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Prof. Dr. Wolfgang Herr Innere Medizin III Hämatologie und intern. Onkologie Klinik und Poliklinik für Innere Medizin III


ARTCLINE GmbH BMBF-Innovationsforum Bioaktive Zellfilter. März 2011

ARTCLINE GmbH BMBF-Innovationsforum Bioaktive Zellfilter. März 2011 ARTCLINE GmbH BMBF-Innovationsforum Bioaktive Zellfilter März 2011 Aktueller Stand der Extrakorporalen Zelltherapie für Sepsis-Patienten SEPSIS 1,5 Mio. Tote in Industrieländern Definition: = Generalisierte


Die nächste Generation der Regeneration

Die nächste Generation der Regeneration DE Phasenreines Beta-Tricalciumphosphat Die nächste Generation der Regeneration Warum SynthoGraft? SynthoGraft s einmalige Struktur bietet erhöhte Stabilität und seine Mirco- und Nanoporosität sorgt für


Therapeutisches und reproduktives Klonen. TCI Institut für. Dr. Cornelia Kasper. Klonen.

Therapeutisches und reproduktives Klonen. TCI Institut für. Dr. Cornelia Kasper. Klonen. Therapeutisches und reproduktives Überblick Was ist? Verschiedene Ansätze Historischer Überblick und neueste Entwicklungen Gesetzliche Anforderungen Entwicklungen von Menschen


Indikationserweiterungen für JANUVIA (Sitagliptin, MSD) in der EU - Kombination mit Sulfonylharnstoff n

Indikationserweiterungen für JANUVIA (Sitagliptin, MSD) in der EU - Kombination mit Sulfonylharnstoff n Indikationserweiterungen für JANUVIA (Sitagliptin, MSD) in der EU Kombination mit Sulfonylharnstoff nun ebenfalls zugelassen Haar (März 2008) - Die europäische Arzneimittelbehörde EMEA hat JANUVIA für


Beurteilung der klinischen Heterogenität: eine empirische Untersuchung

Beurteilung der klinischen Heterogenität: eine empirische Untersuchung Beurteilung der klinischen Heterogenität: eine empirische Untersuchung Christian Lerch, Bernd Richter Cochrane Metabolic and Endocrine Disorders Group Abteilung für Allgemeinmedizin Universitätsklinikum


Wissenstest für junge Stammzell-Forscherinnen und -Forscher

Wissenstest für junge Stammzell-Forscherinnen und -Forscher Stammzellen und regenerative Medizin Nationales Forschungsprogramm NFP 63 Cellules souches et médecine régénérative Programme national de recherche PNR 63 Stem Cells and Regenerative Medicine National


Rheumatologie. Zeitschrift für. Elektronischer Sonderdruck für G. Schett

Rheumatologie. Zeitschrift für. Elektronischer Sonderdruck für G. Schett Zeitschrift für Rheumatologie Elektronischer Sonderdruck für G. Schett Ein Service von Springer Medizin Z Rheumatol 2012 71:138 141 DOI 10.1007/s00393-012-0954-3 zur nichtkommerziellen Nutzung auf der


Strukturelle Rahmenbedingungen der klinischen Forschung in Deutschland. Michael Hallek Universität zu Köln

Strukturelle Rahmenbedingungen der klinischen Forschung in Deutschland. Michael Hallek Universität zu Köln Strukturelle Rahmenbedingungen der klinischen Forschung in Deutschland Michael Hallek Universität zu Köln Klinische, Praxis-verändernde Forschung an Patienten Ein Beispiel Chronische lymphatische Leukämie


Efficient Monte Carlo Simulation of Tunnel Currents in MOS Structures

Efficient Monte Carlo Simulation of Tunnel Currents in MOS Structures Efficient Monte Carlo Simulation of Tunnel Currents in MOS Structures D. Grgec, M.I. Vexler, C. Jungemann, B. Meinerhagen Grg-P/02-1 Presentation Outline Introduction: quantum effects in MOS structures


"Stammzellen - Alleskönner zwischen Wissenschaft und Ethik"

Stammzellen - Alleskönner zwischen Wissenschaft und Ethik "Stammzellen - Alleskönner zwischen Wissenschaft und Ethik" Jörg Klug Justus-Liebig-Universität Gießen 2. Science Bridge Seminar 19. November 2010 Wo kommt der Name her? A. megalocephala C. elegans Edmund


Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin Die richtige Therapie für den richtigen Patienten Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin: Was ist denn das? Februar 2011 Personalisierte Medizin:


Publikationsliste: J. Falduti, F. Gudermann, J. Uhlenküken (2004) On-line IgG Quantification for Bioprocessing Genetic Engineering News 24 (19): 46 47

Publikationsliste: J. Falduti, F. Gudermann, J. Uhlenküken (2004) On-line IgG Quantification for Bioprocessing Genetic Engineering News 24 (19): 46 47 Publikationsliste: F. Gudermann (2006) Instrumentation and Concepts for Automated Cell Culture Analysis Vortrag zum Amgen BioProcessors Symposium on High Throughput Biopharmaceutical Development, Los Angeles,



DETECT III DETECT III DETECT III Eine prospektive, randomisierte, zweiarmige, multizentrische Phase III Studie zum Vergleich Standardtherapie versusstandardtherapie mit Lapatinib bei metastasierten Patientinnen mit initial


Keine CE-Kennzeichnung ohne klinische Bewertung

Keine CE-Kennzeichnung ohne klinische Bewertung Seite 1 von 5 Keine CE-Kennzeichnung ohne klinische Bewertung Medizinprodukte können in der Regel nicht ohne klinische Daten und deren Bewertung auf den Markt gelangen. Zudem besteht für Medizinprodukte


Dentale Implantate und Kieferaugmentationen

Dentale Implantate und Kieferaugmentationen 1 Dentale Implantate und Kieferaugmentationen N. Jakse a.o. Univ.-Prof. Dr. Dr. Norbert Jakse Department für Zahnärztliche Chriurgie und Röntgenologie Universitätsklinik für Zahn-, Mund- und Kieferheilkunde


Die Generierung axial vaskularisierten Knochengewebes im arteriovenösen Gefäßschleifenmodell des Schafes

Die Generierung axial vaskularisierten Knochengewebes im arteriovenösen Gefäßschleifenmodell des Schafes Aus der Chirurgischen Tierklinik der Veterinärmedizinischen Fakultät der Universität Leipzig und der Plastisch- und Handchirurgischen Klinik Universitätsklinikum Erlangen der Friedrich-Alexander-Universität


Insgesamt erfüllten 30 Studien die definierten Einschlusskriterien. Davon konnten 8 Studien in die Nutzenbewertung eingeschlossen werden.

Insgesamt erfüllten 30 Studien die definierten Einschlusskriterien. Davon konnten 8 Studien in die Nutzenbewertung eingeschlossen werden. Kurzfassung Das wurde vom Gemeinsamen Bundesausschuss (G-BA) beauftragt, eine Nutzenbewertung der allogenen Stammzelltransplantation mit nicht verwandtem Spender bei der Indikation Hodgkin- Lymphom (HL)


Symbio system requirements. Version 5.1

Symbio system requirements. Version 5.1 Symbio system requirements Version 5.1 From: January 2016 2016 Ploetz + Zeller GmbH Symbio system requirements 2 Content 1 Symbio Web... 3 1.1 Overview... 3 1.1.1 Single server installation... 3 1.1.2


von Samira Fargali aus Casablanca, Marokko

von Samira Fargali aus Casablanca, Marokko In vitro Etablierung eines Kaninchenmodells zur Herstellung von hochvitalen Knochenimplantaten auf Basis osteogener Zellen und bioresorbierbarer Trägergerüste Von der Fakultät für Lebenswissenschaften


PRODUCT CATALOG Osseous & Connective Tissue Tendinous & Cartilaginous Tissue

PRODUCT CATALOG Osseous & Connective Tissue Tendinous & Cartilaginous Tissue PRODUCT CATALOG Osseous & Connective Tissue Tendinous & Cartilaginous Tissue All deliveries are subject to the terms and conditions of Tutogen Medical GmbH, Status August 2007. These can be seen and printed


Auftaktveranstaltung zum Vorhaben DendroMax

Auftaktveranstaltung zum Vorhaben DendroMax Auftaktveranstaltung zum Vorhaben DendroMax Entwicklung der biotechnologischen Grundlagen und praxisnaher Anbauverfahren für die Steigerung der Dendromasseproduktion in Land- und Forstwirtschaft durch


Franke & Bornberg award AachenMünchener private annuity insurance schemes top grades

Franke & Bornberg award AachenMünchener private annuity insurance schemes top grades Franke & Bornberg award private annuity insurance schemes top grades Press Release, December 22, 2009 WUNSCHPOLICE STRATEGIE No. 1 gets best possible grade FFF ( Excellent ) WUNSCHPOLICE conventional annuity


Diss. ETH No IN LIVER HOMEOSTASIS AND REGENERATION. A dissertation submitted to the. for the degree of Doctor of Sciences.



TMF projects on IT infrastructure for clinical research

TMF projects on IT infrastructure for clinical research Welcome! TMF projects on IT infrastructure for clinical research R. Speer Telematikplattform für Medizinische Forschungsnetze (TMF) e.v. Berlin Telematikplattform für Medizinische Forschungsnetze (TMF)


Klonierung von Säugern durch Zellkerntransfer

Klonierung von Säugern durch Zellkerntransfer Klonierung von Säugern durch Zellkerntransfer Gentechnik und Genomics WiSe 2007/2008 Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Können differenzierte Zellen einen
