Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen"

Transkript

1 Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses Praktikumsteils pro Gruppe einen Laptop. - Installieren Sie das Programm sequencher auf diesem Laptop. - Stellen Sie sicher, dass der Akku vollständig geladen ist (die Anzahl der Steckdosen im Seminarraum ist begrenzt). - Stellen Sie sicher, dass Sie über das Uni-Netzwerk Zugang zum Internet haben. Lesen Sie das gesamte Skript als Vorbereitung auf das Praktikum durch. Folgende Fragen sollen Ihnen helfen sich auf das Praktikum vorzubereiten. - Was sind MADS-Box-Gene? - Aus welchen Abschnitten besteht die mrna? - Was ist eine cdna und mit welchen Methoden können cdna-sequenzen vervollständigt werden? - Was ist eine RACE? - Wie funktioniert PCR und welche Faktoren beeinflussen das Ergebnis? - Was sind Plasmide? Welche Eigenschaften muss ein Plasmid haben, um als Klonierungsvektor benutzt werden zu können? - Auf welchem Prinzip beruht die Plasmidreinigung mittels der alkalischen Lyse? - Was ist sequence assembly? - Welche Programme gibt es für das sequence assembly? - Wie funktioniert die Sanger-Sequenzier-Methode mit Fluoreszenzmarkierung? - Wie beeinflussen die Parameter minimum match percentage und minimum overlap das sequence assembly? - Was ist eine BLAST-Suche und wie funktioniert diese? - Welche Informationen können Sie aus der BLAST-Suche über das von Ihnen sequenzierte Gen gewinnen? Literatur: Der Experimentator: Molekularbiologie/Genomics, C. Mühlhardt, Spektrum-Verlag Molekulare Genetik, R. Knippers, Thieme-Verlag Allgemeine und Molekulare Botanik, E. Weiler & L. Nover, Thieme-Verlag Seite 1 von 13

2 Abb. 1: Übersicht über den Ablauf des Praktikumsteil 3 - RACE-PCR und Klonierung von MADS-Box-Genen aus Tulpen. Im Praktikum wird Ihnen sowohl das Template für die nested-pcr (3 RACE-PCR-Produkt) als auch das cdna-template für die 3 RACE zur Verfügung gestellt. Umgekehrt als in diesem flow-chart, wird aus Zeitgründen das erste Experiment die nested-pcr sein. Seite 2 von 13

3 Einleitung RACE (rapid amplification of cdna ends) Die mrna eines Gens besteht aus einer Protein codierenden Region (coding DNA sequence = cds), die in ein Protein translatiert wird, den sich im 5 - und 3 -Bereich anschließenden nicht-translatierten Regionen (UTR = untranslated region, Siehe Abb.2), sowie dem 5 -Cap und dem poly-a-schwanz am 3 -Ende. In den UTRs können sich regulatorische Sequenzelemente befinden, aber oft ist von einer mrna nur die kodierende Sequenz bekannt. Mit der RACE-PCR kann die vollständige Sequenz der mrna ermittelt werden. RACE (rapid amplification of cdna ends) bedeutet schnelle Amplifikation von cdna-enden. Ausgehend von einer bekannten Sequenz im Transkript wird die Sequenz des 5 -Endes (5 -RACE-PCR) bzw. des 3 -Endes (3 - RACE-PCR) ermittelt. Abb.2: Schematische Darstellung der Genstruktur und der Struktur der transkribierten mrna (Q: Die mrna wird aufgrund ihrer Struktur in einer herkömmlichen Polymerase-Kettenreaktion nicht vervielfältigt (=amplifiziert) und muss demzufolge erst in einer Reaktion in eine DNA-Sequenz umgesetzt werden (cdna-synthese, Siehe Abb. 3). Während der cdna-synthese wird eine zur mrna reverskomplementäre DNA-Sequenz (complementary DNA = cdna) mit dem Enzym Reverse Transkriptase synthetisiert. Die Reverse Transkriptase ist eine RNA-abhängige DNA-Polymerase und benötigt für die DNA- Synthese einen Primer als Startpunkt. Meist wird ein Oligo-dT-Primer (15-25 Desoxythymidine) verwendet, der komplementär zum Poly-A-Schwanz des 3 -Endes der mrna ist und dort bindet. Am Ende der Reaktion liegt ein RNA-DNA-Hybrid vor, aus dem die RNA dann durch die zusätzliche RNase H-Aktivität der Reversen Transkriptase abgebaut wird. Am 5 -Ende des Oligo-dT-Primers schließt sich eine Ankersequenz an, die in der anschließenden PCR1 (hier 3 RACE-PCR) als Bindestelle für einen Primer genutzt wird. Der zweite Primer bindet genspezifisch im codierenden Bereich der mrna-sequenz (Abb.3). Oft erhält man nach der ersten Amplifizierungsrunde (3 RACE-PCR) von cdna noch viele unspezifische PCR- Produkte. Der Anteil spezifischer PCR-Produkte kann durch eine nested-pcr (verschachtelte PCR) erhöht werden. Für eine nested-pcr wird eine geringe Menge des PCR-Produkts aus der ersten Amplifikationsrunde Seite 3 von 13

4 (3 RACE-PCR) als Template verwendet. Im Gegensatz zu den Primern der 3 -RACE-PCR binden die Primer der nested-pcr leicht in 5 -Richtung versetzt auf dem zu amplifizierenden DNA-Fragment, sodass sie sich in ihrer Sequenz von den Primern der ersten PCR unterscheiden und dadurch die Spezifität der PCR erhöhen. (3 RACE-PCR) (nested PCR) Abb. 3: Ablauf von cdna-synthese, 3 RACE-PCR und nested-pcr (Q: Protocols & Applicatios Guide, rev. 3/11). Tag 1 Bitte berücksichtigen Sie, dass aus Zeitgründen erst die nested-pcr und dann die 3 RACE-PCR angesetzt wird, im normalen Ablauf würde man es umgekehrt machen. 1. Durchführung nested-pcr (= Experiment 1) 1.1. Pipettieren Sie folgende Komponenten in der angegebenen Reihenfolge in ein 0,2 µl PCR-tube auf Eis: (als Template erhalten Sie vom Betreuer schon vorbereitetes PCR-Produkt) Komponente Endkonzentration bzw. Menge in Eingesetzte Menge einem Reaktionsansatz ddh2o 10x Reaktionspuffer 1x dntp Mix (je 10 mm) je 200 µm T127-Ankerprimer (50 µm) 1 µm T175-Primer (50 µm) 1 µm Template: 1. PCR-Produkt 1:50 variabel 2 µl verdünnt Taq (5 U/µl) 2 U Endvolumen: 50 µl Endvolumen: 50 µl Seite 4 von 13

5 1.2. Mischen Sie den Reaktionsansatz und zentrifugieren Sie diesen kurz ab Stellen Sie ihre PCR-Reaktion so lange auf Eis bis das PCR-Programm gestartet wird PCR-Programm: Bezeichnung Temperatur [ C] Zeit Initiale Denaturierung 95 2 min Denaturierung sec Primer-Annealing sec 35 x Elongation 72 1 min Abschließende Elongation 72 5 min 15 hold 1.5. Geben sie zu der PCR-Reaktion 0,2x Volumen DNA-Ladepuffer. Weiter mit Gelelektrophorese im Punkt Durchführung 3 RACE-PCR (Rapid Amplification of 3 -cdna Ends) (= Experiment 2) 2.1. Pipettieren Sie folgende Komponenten in der angegebenen Reihenfolge in ein 0,2 µl PCR-tube auf Eis: Komponente Endkonzentration bzw. Menge Eingesetzte Menge in einem Reaktionsansatz ddh2o 10x Reaktionspuffer 1x dntp Mix (je 10 mm) je 200 µm T126-Ankerprimer (50 µm) 1 µm T176-Primer (50 µm) 1 µm cdna Template variabel 1 µl Taq (5 U/µl) 2 U Endvolumen: 50 µl Endvolumen: 50 µl 2.2. Mischen Sie den Reaktionsansatz und zentrifugieren Sie diesen kurz ab Stellen Sie ihre PCR-Reaktion so lange auf Eis bis das PCR-Programm gestartet wird PCR-Programm: Bezeichnung Temperatur [ C] Zeit Initiale Denaturierung 95 2 min Denaturierung sek Primer-Annealing min 25 x Elongation 72 1 min Abschließende Elongation 72 5 min 15 hold 2.5. Nach der PCR pipettieren Sie 10 µl der PCR in ein neues und gut beschriftetes 1,5 ml Tube für eine spätere nested-pcr (wird im nächsten Block verwendet) Geben sie zu den restlichen 40 µl der PCR-Reaktion 0,2x Volumen DNA-Ladepuffer Gelelektrophorese: Laden Sie die PCR-Produkte auf ein 1%iges Agarose-Gel mit großen Taschen (schon vorbereitet) und legen Sie für ca. 45 min eine Spannung von 120 V an das Gel. (nicht vergessen: zusammen mit der nested-pcr auftragen) Seite 5 von 13

6 2.8. Ausschneiden der DNA-Fragmente aus dem Agarose-Gel (vom Betreuer). DNA im Agarose-Gel kann auf Eis oder für eine längere Lagerung bei -20 C aufbewahrt werden. Hinweise zur Auswertung der Gelelektrophorese beider PCR-Produkte (Exp. 1&2): Wie viele Banden erscheinen auf dem Agarose-Gel für die verschiedenen PCR-Reaktionen? Auf welcher Höhe liegen die Banden und welche Intensität haben sie? Gibt es Banden mit denen Sie direkt ohne nested-pcr weiterarbeiten würden? 3. Aufreinigung (Elution) von DNA-Fragmenten aus dem Agarosegel (mit dem High Pure PCR Product Purification Kit von Roche Applied Science) Auflösen des Agarosegel-Stückes: 3.1. Geben Sie zu dem Agarosegel-Stück (ca. 150 mg) 450 µl Binde-Puffer (Tube mit Nr.1) Inkubieren Sie das Gel-Stück solange bei 56 C bis es komplett gelöst ist (max. 10 min.). Vortexen Sie kurz ca. alle 2 3 min während der Inkubationszeit, um den Lösungsvorgang zu beschleunigen Geben Sie 225 µl Isopropanol (Nr.2) zu der Lösung und vortexen nochmals gründlich. Vor dem Weiterarbeiten die Lösung kurz abzentrifugieren, damit keine Tropfen mehr am Deckel hängen. Bindung der DNA an die Säulen: 3.4. Stecken Sie eine Säule in ein Sammel-Tube Geben sie das gelöste Agarosegel aus Schritt 3.3. auf die Säule Inkubieren Sie 1 min bei Raumtemperatur Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluss in den Flüssigabfall. Waschen 3.9. Geben Sie 500 µl Wasch-Puffer (Nr.3, mit EtOH) auf die Säule Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluss in den Flüssigabfall Geben Sie 200 µl Wasch Puffer (Nr.3, mit EtOH) auf die Säule. Durch den zweiten Waschschritt soll die Reinheit des eluierten Produktes erhöht werden Geben Sie den Durchfluss in den Flüssigabfall. Elution der DNA von der Säule Stecken Sie die Säule in ein neues, gut beschriftetes 1,5 ml-tube. (Beschriftung: Gruppennummer, Datum, evtl. an der Seite cdna-name notieren) Geben Sie 50 µl Elutionspuffer (Nr.4) in die Mitte der Säule, berühren Sie aber nicht die Membran mit der Pipettenspitze! Inkubieren Sie 1 min bei Raumtemperatur Zentrifugieren Sie 1 min bei x g Lagerung der PCR-Fragmente bei -20 C bzw. 4 C möglich. Seite 6 von 13

7 4. pjet-klonierung (mit dem CloneJet PCR Cloning Kit von Thermo Scientific) Die eluierten PCR-Produkte werden in einer Ligations-Reaktion in den Klonierungsvektor pjet1.2/blunt (Abb.4 Vektorkarte) kloniert und der Vektor anschließend in chemokompetente Escherichia coli (E. coli) DH5α-Zellen transformiert. Der pjet1.2/blunt Vektor liegt in dem verwendeten Kit schon linearisiert vor, sodass DNA-Fragmente direkt in den Vektor ligiert werden können. Im Vektor ist das Gen bla(ap R ) enthalten das eine Ampicillin-Resistenz vermittelt, damit nur die Zellen auf einem Ampicillin-selektiven Medium überleben, die den Vektor aufgenommen haben. Des Weiteren trägt der Vektor in der Multiplen Cloning Site (MCS) das Gen eco47ir, dessen Genprodukt letal für die Bakterienzelle ist. Durch die Ligation eines DNA Fragmentes in die MCS wird die Sequenz des Gens eco47ir unterbrochen und demzufolge in den Zellen kein letales Genprodukt mehr hergestellt. Darum wachsen nach der Transformation auf Ampicillin-selektivem Medium nur noch die E. coli Zellen, welche das rekombinante Plasmid aufgenommen haben. Zellen, die den rezirkularisierten Vektor (Vektor ohne DNA-Fragment) aufgenommen haben, sterben aufgrund des letalen Genproduktes. Abb. 4: Vektorkarte und Sequenz der MCS des Vektors pjet1.2/blunt (Q: Blunting Reaction Der linearisierte Vektor pjet1.2 hat glatte Enden (sogenannte blunt ends). Da die Taq-Polymerase PCR- Produkte mit einem 3 -da Überhang produziert, müssen glatte Enden in einer sogenannten blunting Seite 7 von 13

8 reaction mittels dem DNA-Blunting-Enzym hergestellt werden. Das DNA-Blunting-Enzym entfernt 3 - Überhänge (Exonukleaseaktivität) und füllt 5 Enden auf Pipettieren Sie folgenden Ansatz auf Eis: 5 µl 2x Reaction Buffer 2,5 µl ddh2o 1 µl eluiertes PCR-Produkt 0,5 µl DNA Blunting Enzym Kurz vortexen und abzentrifugieren Inkubation: 70 C, 5 min Auf Eis abkühlen 4.2. Ligation Das blunt-end-pcr-produkt kann nun in den Vektor pjet1.2 (Siehe Vektorkarte in Abb.4) kloniert werden. Die enzymatische Verknüpfung der DNA-Enden wird als Ligation bezeichnet und durch das Enzym T4- DNA-Ligase realisiert. Der vom Enzym benötigte Kofaktor ATP ist im Puffer schon vorhanden Zum Reaktionsansatz aus Schritt pipettieren Sie folgende Reagenzien auf Eis: 0,5 µl pjet1.2 blunt Cloning Vector 0,5 µl T4 DNA Ligase Kurz vortexen und abzentrifugieren Inkubation: 22 C, 5 min Auf Eis abkühlen 5. Transformation von chemisch-kompetenten E. coli-zellen (Calciumchlorid-Methode) und Hitzeschock Manche Bakterienstämme produzieren von Natur aus verschiedenen Kompetenzproteine, die an der Aufnahme von Fremd-DNA beteiligt sind. Das in der Molekularbiologie häufig verwendete Bakterium E. coli besitzt nur einen Teil des Kompetenz-Operons und somit keine hohe Affinität Fremd-DNA aufzunehmen. Mit der Calciumchlorid-Methode werden E. coli-zellen chemisch kompetent gemacht. Bei der Transformation mit Hitzeschock bei 42 C wird kurzfristig die DNA-Membranfluidität erhöht und die Zellen nehmen vermehrt die DNA aus dem Ligationsansatz auf. Nach kurzem Abkühlen auf Eis werden die Zellen bei 37 C rekultiviert, bevor man sie auf selektiven LB-Agarplatten (enthalten Ampicillin) ausplattiert. Durchführung der Transformation: 5.1. Tauen Sie ein Aliquot (100 µl) chemisch kompetente E. coli- Zellen (Stamm DH5α) auf Eis auf Pipettieren Sie den gesamten Ligationsansatz aus Schritt 4.2 zu den chemokompetenten Zellen Inkubieren Sie den Transformationsansatz 30 min auf Eis. Seite 8 von 13

9 5.4. Führen Sie den Hitzeschock durch: Inkubation der Zellen für 2 min bei 42 C Stellen Sie die Zellen nach dem Hitzeschock unmittelbar auf Eis Geben Sie 1 ml LB-Medium zum Transformationsansatz Inkubieren Sie den Transformationsansatz mindestens 30 min bei 37 C Zentrifugieren Sie den Transformationsansatz 1 min bei 8000 x g Entfernen Sie den Überstand vorsichtig mit einer Pipette. Benutzen Sie für jeden Transformationsansatz eine neue Spitze. Sollten Sie ausversehen das Pellet mit pipettieren, wiederholen Sie den Schritt Resuspensieren Sie das Bakterienpellet in 100 µl LB-Medium Bitte unter der Clean Bench: Plattieren sie 30 µl des Transformationsansatzes auf einer LB-Platte mit Ampicillin. Der restliche Transformationsansatz wird bei 4 C aufbewahrt Inkubieren Sie die Transformationsplatte über Nacht bei 37 C. Hinweise zur Auswertung: Warum müssen Sie die transformierten Zellen auf LB-Platten mit Ampicillin ausplattieren? Wie wirkt Ampicillin und wie wird die Ampicillinresistenz vermittelt? Welche Kolonien werden nur auf der Platte wachsen und warum? Sind Satellitenkolonien gewachsen? Tag 2 6. Kolonie-PCR Mittels Kolonie-PCR kann man schnell nach einer Transformation E. coli-kolonien identifizieren, welche das gewünschte Plasmidkonstrukt (d.h. Vektor + DNA-Fragment) aufgenommen haben. Für die Kolonie-PCR wird keine DNA isoliert, sondern es werden ganze E. coli Zellen eingesetzt. Um die DNA aus den Bakterienzellen freizusetzen, werden die Zellen im vorliegenden Protokoll mittels initialer Denaturierung 7 min bei 94 C erhitzt. Damit im Anschluss an die PCR noch Klone der untersuchten Kolonie vorhanden sind, wird gleichzeitig eine Masterplatte angelegt, die zum Wachsen der Klone über Nacht bei 37 C inkubiert wird. verwendete Primer: pjet1.2 for: CGACTCACTATAGGGAGAGCGGC pjet1.2 rev: AAGAACATCGATTTTCCATGGCAG Es werden 4 Kolonien pro Transformation untersucht Pipettieren Sie folgenden Komponenten in der angegebenen Reihenfolge auf Eis: Komponente Endkonzentration bzw. Menge in Eingesetzte Menge einem Reaktionsansatz ddh2o 10x Reaktionspuffer 1x dntp Mix (je 10 mm) je 200 µm pjet 1.2 for (50 µm) 1 µm pjet1.2 rev (50 µm) 1 µm Homemade Taq (1 U/µl) 1 U Endvolumen: 25 µl Endvolumen: 25 µl Seite 9 von 13

10 6.2. Mischen Sie den Master-Mix, zentrifugieren Sie diesen kurz ab und aliquotieren Sie diesen zu je 25 µl in ein PCR-Tube auf Eis Diesen Schritt unter der Clean Bench durchführen: Picken Sie eine Einzelkolonie mit einer gelben Pipettenspitze und beimpfen Sie damit eine Masterplatte (LB mit Ampicillin). Anschließend stellen Sie die Pipettenspitze in ein PCR-Tube mit dem PCR-Mix. Die Masterplatte wird über Nacht bei 37 C inkubiert PCR-Programm: Bezeichnung Temperatur [ C] Zeit Initiale Denaturierung 94 7 min Denaturierung sek Primer-Annealing sek 28 x Elongation sek Abschließende Elongation 10 5 min 15 hold 6.5. Geben sie 0,2x Volumen DNA-Ladepuffer zur PCR Gelelektrophorese: Laden Sie die PCR-Produkte auf ein 1%iges Agarose-Gel mit kleinen Taschen (schon vorbereitet) und legen Sie für ca. 45 min eine Spannung von 120 V an das Gel. Hinweise zur Auswertung: Auf welcher Höhe erwarten Sie die DNA-Bande für Ihr PCR-Produkt? Achten Sie auf die Lage der Primer im Vektor. Finden Sie eine mögliche Erklärung für PCR-Produkte unerwarteter Größe. 7. Plasmid-Aufreinigung (mit dem GeneJET Plasmid Miniprep Kit von Thermo Scientific) Von der Transformation aus Schritt 5 wurden je 1-2 Kolonien in 2 ml flüssiges LB-Medium mit Ampicillin in einem Reagenzglas angeimpft und über Nacht bei 37 C und 200 rpm kultiviert. Aus dieser Bakterien- Kultur sollen Sie heute das Plasmid nach dem Prinzip der alkalischen Lyse isolieren. Alle benötigten Komponenten sind in dem oben erwähnten Kit enthalten. Die E. coli Kultur wird abzentrifugiert (pelletiert), der Überstand entfernt und das Pellet dann in EDTAhaltigem Puffer resuspendiert. EDTA destabilisiert die Zellwand durch Komplexierung von zweiwertigen Ionen wie Mg 2+, Ca 2+. Anschließend werden die Bakterien mit Hilfe von Natriumdodecylsulfat (SDS) lysiert und die DNA durch NaOH denaturiert. Im Vergleich zu chromosomaler DNA kann die niedermolekulare Plasmid-DNA nach der Denaturierung wieder renaturieren (allerdings nur, wenn die Denaturierung nicht zu lange erfolgt). Im anschließenden Neutralisierungsschritt wird das Lysat durch Zugabe von saurem Kaliumacetat-Puffer neutralisiert. Dabei präzipitieren die denaturierten Proteine und chromosomale DNA mit dem Kalium-Dodecylsulfat. Die niedermolekulare Plasmid-DNA bleibt in Lösung und kann renaturieren. Die unlöslichen Komponenten (denaturierte Proteine, hochmolekulare RNA, denaturierte Seite 10 von 13

11 chromosomale DNA, bakterieller Zelldebris) werden abzentrifugiert. Im klaren Überstand befindet sich die Plasmid-DNA. Der Überstand wird auf ein Säulchen gegeben. Die Plasmid-DNA bindet in Gegenwart von Salzen an das Säulchen-Material und wird mit Ethanol-haltigen Puffern gewaschen. Zum Schluss wird die Plasmid-DNA mit Wasser von der Säule eluiert, aufgefangen und die Konzentration bestimmt. Durchführung der Plasmid-Mini-Präparation: Pelletierung der Bakterienzellen: 7.1. Geben Sie je 1 ml der E. coli-kultur in ein frisches 1,5 ml Tube Zentrifugieren Sie für 1 min bei x g Pipettieren Sie den Überstand mit einer blauen Pipettenspitze vorsichtig ab und geben Sie den Überstand in den flüssigen S1-Abfall. Sollten Sie aus Versehen das Pellet mit pipettieren, pipettieren Sie die Lösung zurück in das Tube und wiederholen Schritt 7.2 Resuspension, Zelllyse und Neutralisiation 7.4. Resuspendieren Sie das Zellpellet in 250 µl Resuspension-Solution mit RNaseA (Nr.1) durch aufund abpipettieren. Achten Sie darauf, dass das Pellet komplett resuspendiert ist und keine weißen Zell-Klümpchen mehr vorhanden sind Alkalische Lyse: Geben Sie zu der Lösung mit den resuspendierten Zellen 250 µl Lysis Solution (Nr.2). Mischen Sie unmittelbar nach Zugabe der Lösung durch viermaliges Invertieren des Tubes. Invertieren ist das Hin- und Herschwenken des Tubes mit den Fingern - Nicht vortexen! es kann zum Scheren der chromosomalen DNA kommen. Nicht länger als 5 min inkubieren, um eine Denaturierung der Supercoiled Plasmid-DNA zu verhindern Inkubieren Sie 2 min bei Raumtemperatur Neutralisation: Geben Sie 350 µl Neutralisation-Solution (Nr.3) dazu. Mischen Sie unmittelbar nach Zugabe der Lösung durch vier- bis sechsmaliges Invertieren des Tubes. Es bildet sich ein weißes Präzipitat, das die chromosomale DNA und Proteine sowie weitere Zellbestandteile enthält Zentrifugieren Sie für 5 min bei x g. Reinigung: 7.9. Pipettieren Sie den klaren Überstand auf eine Säule des GeneJET -Kits. Vorsicht: nicht das weiße Präzipitat mitpipettieren! Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluss in den Flüssigabfall Geben Sie 500 µl Wash-Solution (Nr.4, mit EtOH) auf die Säule. Die Waschschritte dienen der Reinigung der Säule von anderen Zellbestandteilen Zentrifugieren Sie für 1 min bei x g. Seite 11 von 13

12 7.14. Geben Sie den Durchfluss in den Flüssigabfall Geben Sie erneut 500 µl Wash-Solution (Nr.4, mit EtOH) auf die Säule Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluss in den Flüssigabfall Zentrifugieren Sie erneut für 1 min bei x g um den restlichen EtOH zu entfernen. Wichtiger Schritt, denn falls zu viel Ethanol auf der Säule ist, sind die Ausbeuten an Plasmid-DNA gering und zudem verunreinigt. Elution: Stecken Sie die Säule in ein neues und gut beschriftetes 1,5 ml Tube Geben Sie 50 µl Elution-Buffer (Nr.5) in die Mitte der Membran der Säule (nicht mit der Pipettenspitze berühren!) Inkubieren Sie für 2 min bei Raumtemperatur Zentrifugieren Sie für 2 min bei x g Messen Sie die DNA-Konzentration (wird vom Praktikumsleiter durchgeführt) Gereinigte Plasmid-DNA kann bei -20 C gelagert werden. Die Plasmid-DNA wird in der Sequenzierreaktion zusammen mit dem Primer pjet1.2 for verwendet. Zusatz für schnelle Arbeitsbienen: 8. Restriktionsverdau des Plasmids und Auftragen auf ein Gel Um Herauszufinden, ob im Plasmid das Fragment der richtigen Größe enthalten ist, kann ein Testverdau mit Restriktionsenzymen durchgeführt werden. Dazu wird das Plasmid mit zwei Enzymen, dessen Erkennungssequenzen die MCS flankieren, verdaut. Als Kontrolle wird ein Plasmid ohne Insert ebenso verdaut Restriktionsansatz: Pipettieren Sie folgende Komponenten in ein neues 1,5 ml-tube: Komponente Endkonzentration bzw. Menge Eingesetzte Menge in einem Reaktionsansatz ddh2o 10x FastDigestReaktionspuffer 1x XbaI 1 µl XhoI 1 µl Plasmid-DNA 1 µg Endvolumen: 20 µl Endvolumen: 20 µl 8.2. Mischen und abzentrifugieren Sie den Reaktionsansatz Inkubation des Reaktionsansatzes bei 37 C im Heizblock (Eppendorf) für 5 min Stellen Sie den Reaktionsansatz auf Eis und geben Sie 0,2x Volumen DNA-Ladepuffer zur PCR. Seite 12 von 13

13 Als Kontrolle wird ebenso 1 µg unverdautes Plasmid aufgetragen Gelelektrophorese: Laden Sie den Verdau auf ein 1%iges Agarose-Gel mit kleinen Taschen und legen Sie für ca. 45 min eine Spannung von 120 V an das Gel. Anhang Abb. 5: GeneRuler DNA Ladder Mix (Thermo Scientific) Seite 13 von 13

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -

Mehr

Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten

Mehr

3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark

Mehr

Plasmid DNA purification

Plasmid DNA purification Plasmid DNA purification Excerpt from user manual - Deutsch - NucleoBond Xtra NucleoBond Xtra NucleoBond Xtra Plus NucleoBond Xtra Plus January 2013 / Rev. 11 Plasmid DNA Purification Deutsch Einleitung

Mehr

Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,

Mehr

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern.

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Plasmidisolierung Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Was können Sie lernen? Sie lernen eine ringförmige DNA, ein Plasmid, zu isolieren. Mit diesem

Mehr

Molekulargenetische Experimente IV: Plasmidpräparation

Molekulargenetische Experimente IV: Plasmidpräparation Molekulargenetische Experimente IV: Plasmidpräparation Plasmide sind kleine, ringförmige DNA-Moleküle in Bakterien, die in der Lage sind, sich selbst mit Hilfe von Enzymen zu replizieren. Gene, die auf

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Kolonie-PCR Polymerase

Mehr

DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2

Mehr

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Arbeitsblatt 1 Analyse von DNA 1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Bevor Sie anfangen: Alle Reagenzien müssen vor Gebrauch vollständig aufgetaut sein und durchmischt

Mehr

Reagenzien Isolierung von Nukleinsäuren

Reagenzien Isolierung von Nukleinsäuren Aufbewahrung bei Raumtemperatur Anwendung Isolierung ultrareiner Plasmid-DNA aus Bakterienkulturen von 1 ml bis 800 ml. Die Plasmid-DNA eignet sich für Manuelle und automatisierte Sequenzierung mit Fluoreszenzfarbstoffen

Mehr

Identifizierung positiver Klone aus einer λ-phagenbibliothek

Identifizierung positiver Klone aus einer λ-phagenbibliothek Identifizierung positiver Klone aus einer λ-phagenbibliothek Betreuer: Elke Muth-Köhne und Nora Cavara Beginn des Versuchs: 9.00 Uhr im Praktikumssaal NBCF 04 Nord 1. Theoretischer Hintergrund 1.1 Screening

Mehr

Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1

Mehr

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C F1-Praktikum Genetik Protokoll Versuch 2: Nachweis der Funktion von Promotor- und Enhancer-Sequenzen mittels Reportergen-Assay Gruppe 8, Manfred Depner & Susanne Duncker Einführung Um die Funktion von

Mehr

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei

Mehr

Laborkurs des Heidelberger Life-Science Lab und des igem-teams Heidelberg 2014 2. Woche/14. 16.07.2014

Laborkurs des Heidelberger Life-Science Lab und des igem-teams Heidelberg 2014 2. Woche/14. 16.07.2014 Laborkurs des Heidelberger Life-Science Lab und des igem-teams Heidelberg 2014 2. Woche/14. 16.07.2014 Tag 1 PCR Die Polymerase-Kettenreaktion (engl. polymerase chain reaction) ermöglicht die selektive

Mehr

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt USERGUIDE Seite 1 No. 201 Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt Temperierbereich: (RT 13 C) bis 99 C [MTPs: (RT 10 C) bis 70 C], Minimal

Mehr

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet

Mehr

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil 2 Inhaltsverzeichnis Sicherheitshinweise DNA-Analytik 1 Arbeitshinweise DNA-Analytik 2 Gießen von Agarosegelen 3 Isolierung genomischer DNA 4 Isolierung

Mehr

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Von: Andreas Tschammer, Fachhochschule Aalen-Hochschule f. Technik und Wirtschaft, Fachbereich Chemie, Schwerpunkt Molekulare Biotechnologie Material

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli

Mehr

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Im diesem Praktikumsteil sollen homöotische Mutanten von Arabidopsis untersucht werden. Abb 1, Aufbau einer Blüte einer

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

AdnaTest ColonCancerDetect

AdnaTest ColonCancerDetect AdnaTest ColonCancerDetect RT-PCR-Nachweis von Darmkrebs-assoziierter Genexpression in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-505 Inhaltsverzeichnis Bestellinformation...

Mehr

NUKLEINSÄUREN UND GENTECHNOLOGIE

NUKLEINSÄUREN UND GENTECHNOLOGIE NUKLEINSÄUREN UND GENTECHNOLOGIE Beispiele für Stoffinhalte aus der Chemie als Grundlage für das Verständnis dieses Teiles: nicht-kovalente chemische Bindungen, Koordinationsbindungen, funktionelle Gruppen

Mehr

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Bernhard Strigel Gymnasium Kollegstufe/ Jahrgang: 2007/ 2009 Memmingen Leistungskurs: Biologie Kollegiat: Stefanie Funk Facharbeit Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Abgegeben

Mehr

Molekularbiologie I. PCR Klonierung Transformation Southern Blot Hybridisierung BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN V 2.

Molekularbiologie I. PCR Klonierung Transformation Southern Blot Hybridisierung BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN V 2. V 2.6 Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN PCR Klonierung Transformation Southern Blot Hybridisierung Abteilung für Biochemie und Molekularbiologie, Fachbereich

Mehr

Molekularbiologische / gentechnische Methoden

Molekularbiologische / gentechnische Methoden Molekularbiologische / gentechnische Methoden MPM 1 Wie lässt sich ein spezifisches Gen/Genprodukt molekular analysieren? Fundamentales Problem: Komplexität biologischer Systeme MPM 2 Ein Ausschnitt aus

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN. PCR Klonierung Transformation Southern Blot Hybridisierung V 2.

Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN. PCR Klonierung Transformation Southern Blot Hybridisierung V 2. V 2.5 Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN PCR Klonierung Transformation Southern Blot Hybridisierung Abteilung für Biochemie und Molekularbiologie, Fachbereich

Mehr

Klonierung von GFP in E.coli

Klonierung von GFP in E.coli Bernhard-Strigel-Gymnasium Memmingen Kollegstufe Jahrgang:...2007/2009 Leistungskurs:...Biologie Kollegiatin:...Nicole Makowski Facharbeit Klonierung von GFP in E.coli Abgegeben am: 30.01.2009 Bewertung:

Mehr

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Versuchsleiter: Bernhard Eikmanns Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 11.11 15.11.2002 Protokoll testiert: WS02

Mehr

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

Charakterisierung von Transkripten mittels RT-PCR

Charakterisierung von Transkripten mittels RT-PCR Charakterisierung von Transkripten mittels RT-PCR Versuchsleiter: Ulrike Gerischer Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 18.11 22.11.2002 Protokoll testiert: WS02 Universität Ulm Inhaltsverzeichnis

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Fortbildung für Biologen an der Oranienschule

Fortbildung für Biologen an der Oranienschule Fortbildung für Biologen an der Oranienschule Am 28.01.08 fand die erste ganztägige schulinterne Lehrerfortbildung für Biologen an der Oranienschule unter der Leitung von Frau Dr. Wismar und Herrn Bender

Mehr

Nachweis von DNA im Wein

Nachweis von DNA im Wein Abschlussbericht über den Forschungsauftrag Nachweis von DNA im Wein Projektlaufzeit: 01.01.2001 bis 31.03.2003 Prof. Dr. Ralf Kaldenhoff Universität Würzburg Julius-von-Sachs-Institut für Biowissenschaften

Mehr

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila 01.-04.03.04 Joachim Marhold, Regine Garcia Boy, Natascha Kunert, Cora Mund, Frank Lyko Programm 01.03.04: Präparation genomischer

Mehr

MOLEKULARBIOLOGISCHE METHODEN

MOLEKULARBIOLOGISCHE METHODEN 45 MOLEKULARBIOLOGISCHE METHODEN Die Technik der DNA-Rekombination, auch als Gentechnik bezeichnet, erlaubt die Isolierung von DNA-Abschnitten (genomische oder cdna), deren Sequenzbestimmung, Modifikation

Mehr

2. MATERIAL UND METHODEN

2. MATERIAL UND METHODEN 2. MATERIAL UND METHODEN 2.1 Bakterienkulturen 2.1.1 Bakterienstämme Die bei den Arbeiten verwendeten Stämme sind sämtlich Derivate des 1922 in Stanford/ Kalifornien isolierten, anerkannten Sicherheitsstammes

Mehr

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR)

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) GVO-Screening Kit Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) I. Einführung Die Gentechnik stellt die Landwirtschaft vor neue Herausforderungen. Einerseits eröffnet

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

7 Prinzipien und Methoden der DNA-Klonierung

7 Prinzipien und Methoden der DNA-Klonierung 7 Prinzipien und Methoden der DNA-Klonierung Das Klonieren von DNA-Molekülen seien es DNA-Fragmente, komplette Gene oder sogar das ganze Genom eines Organismus stellt im Grunde genommen den Kern gentechnischer

Mehr

Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und

Mehr

Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen

Mehr

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli 1 Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli Organisatorisches: Termine: 24.10.2014; 7.11.2014, 14.11.2014 Beginn: 8.15 Uhr im Seminarraum 124, Philosophenweg 12 Am Beginn

Mehr

11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese

11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11.1 Einführung in die Problemstellung 11.1.1 Plasmid-DNA In der Gentechnik spielen Plasmide als Vektoren eine herausragende Rolle

Mehr

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet

Mehr

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint RFLP als Modell für einen DNA-Fingerprint Teil 1: Restriktionsverdau 1.1: Thermoblock / Wasserbad auf 37 C vorheizen 1.2: Puffer Y+/Tango auftauen und auf Eis stellen 1.3: 4 Proben, RSA I und H 2 O demin.

Mehr

GFP - Klonierung in E.coli

GFP - Klonierung in E.coli Bernhard-Strigel-Gymnasium Kollegstufe Jahrgang:...2008/2010 Memmingen Leistungskurs:...Biologie Kollegiatin:...Anja Rießenberger Facharbeit GFP - Klonierung in E.coli Abgegeben am Bewertung: Facharbeit:

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich

Mehr

2) Veröffentlichungsnummer: PATENTANMELDUNG

2) Veröffentlichungsnummer: PATENTANMELDUNG Europäisches Patentamt European Patent Office Dffice europeen des brevets 2) Veröffentlichungsnummer: 0 368 342 A2 EUROPAISCHE PATENTANMELDUNG 2) Anmeldenummer: 89120894.4 ) Anmeldetag: 10.11.89 it) Int.

Mehr

Isolierung von Plasmid-DNA aus einem Bakterienlysat mittels Ionenaustauschchromatographie an einer DEAE-Säule

Isolierung von Plasmid-DNA aus einem Bakterienlysat mittels Ionenaustauschchromatographie an einer DEAE-Säule Versuch 2 Isolierung von Plasmid-DNA aus einem Bakterienlysat mittels Ionenaustauschchromatographie an einer DEAE-Säule Versuchsbeschreibung Die Isolierung hochreiner Nucleinsäuren ist eine der grundlegenden

Mehr

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die Regulation der enterobakteriellen Kapselbiosynthese Inaugural-Dissertation zur Erlangung der Doktorwürde vorgelegt

Mehr

Vorlesung LV-Nr. 954.104. Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007

Vorlesung LV-Nr. 954.104. Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007 Vorlesung LV-Nr. 954.104 Molekularbiologie für Agrarwissenschaften J. Glößl, SS 2007 Thematik: Molekularbiologische Methoden Teil 1 Die ppt Folien wurden freundlicherweise von Prof. Florian Rüker aus der

Mehr

Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,

Mehr

DNA/RNA- Isolierung. DNA/RNA-Isolierung. PCR- Reagenzien. Geldokumentation. Labor- Plastik/ Geräte. Elektrophorese. Thermocycler. developing you.

DNA/RNA- Isolierung. DNA/RNA-Isolierung. PCR- Reagenzien. Geldokumentation. Labor- Plastik/ Geräte. Elektrophorese. Thermocycler. developing you. DNA/RNA-Isolierung DNA/RNA- Isolierung PCR- Reagenzien Elektrophorese Labor- Plastik/ Geräte Geldokumentation Thermocycler developing you. DNA/RNA-Isolierung DNA/RNA-Isolierung Inhalt Isolierung genomischer

Mehr

AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...

Mehr

Protokoll für MolekularBiologische Praktikum

Protokoll für MolekularBiologische Praktikum Protokoll für MolekularBiologische Praktikum Guan Zhang (Gruppe 6) 4. Mai 2006 Inhaltsverzeichnis 1 Einleitung 2 2 Gewinnung des GFP-codierenden Gens 3 2.1 06.März 2006............................ 3 2.1.1

Mehr

Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Plasmidpräparation

Mehr

AdnaTest EMT-2/StemCell Add-on ProstateDetect

AdnaTest EMT-2/StemCell Add-on ProstateDetect AdnaTest EMT-2/StemCell Add-on ProstateDetect RT-PCR-Nachweis von Prostatakrebs-assoziierter Genexpression in angereicherten Tumorzellen Nur für Forschungszwecke Gebrauchsanweisung T-1-537-PP Inhaltsverzeichnis

Mehr

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!!

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! aktualisiert, 08.03.2011, Wera Roth1 SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Anleitung für Minigele Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! Glasscheiben ordentlich

Mehr

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Inhaltsverzeichnis. 1 Einleitung... 1

Inhaltsverzeichnis. 1 Einleitung... 1 Inhaltsverzeichnis 1 Einleitung... 1 1.1 G-Protein-gekoppelte Rezeptoren... 3 1.1.1 Klassifizierung und Struktur von G-Protein-gekoppelten Rezeptoren... 6 1.1.2 Purinerge Rezeptoren... 12 1.1.3 Pharmazeutische

Mehr

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran

Mehr

Klonierung und Sequenzierung von DNA

Klonierung und Sequenzierung von DNA Klonierung und Sequenzierung von DNA Heike Mitternacht ( 10.08.2001 ) Inhalt Klonierung von DNA 1. Allgemeines 1.1. Klonierungsvektoren 1.1.1. Plasmidvektoren 1.1.2. Phagenvektoren 1.1.3. Cosmide, Phasmide

Mehr

Das grün fluoreszierende Protein (GFP)

Das grün fluoreszierende Protein (GFP) Datum Arbeitsplan 17.10.11 S1 Belehrung, kompetente E. coli Zellen herstellen, PCR GFP 24.10.11 Gelelektrophorese GFP, Vortrag, Gel-Aufreinigung, Konzentrationsbestimmung 31.10.11 Reformationstag 07.11.11

Mehr

Molekularbiologie II. Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung BIOCHEMISCHES ANFÄNGERPRAKTIKUM

Molekularbiologie II. Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung BIOCHEMISCHES ANFÄNGERPRAKTIKUM V 1.8 Molekularbiologie II BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung Abteilung für Biochemie und Molekularbiologie,

Mehr

3.5.3 Übertragung von DNA nach Amycolatopsis sp. HR167

3.5.3 Übertragung von DNA nach Amycolatopsis sp. HR167 152 3.5.3 Übertragung von DNA nach Die Zellwand der Grampositiven Bakterien stellt bei der DNAÜbertragung eine größere Barriere dar, so daß eine Übertragung von DNA nicht so einfach möglich ist. Für Grampositive

Mehr

Grundlagen der rekombinanten. DNA-Technologie

Grundlagen der rekombinanten. DNA-Technologie Grundpraktikum Grundlagen der rekombinanten DNA-Technologie Bitte für das Praktikum mitbringen: Laborkittel, Taschenrechner und Schutzbrille TU Darmstadt Biochemie AG Kolmar Grundpraktikum 2 Inhaltsverzeichnis

Mehr

Plasmide, Vektoren und Klonierung

Plasmide, Vektoren und Klonierung Biologische Übungen IV, Kurstage 3, 4 Restriktionskartierung eines Plasmids, 27./28.05.2004 Protokollant: Bernhard Schnepf Gruppe A1: Dachs Sven Schnepf Bernhard Thumann Rauno Plasmide, Vektoren und Klonierung

Mehr

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens 6 Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität

Mehr

1. Einleitung. 2. Projektinformationen

1. Einleitung. 2. Projektinformationen Praktikumsbericht zum Praktikum beim Max-Planck-Institut für Biochemie in der Abteilung Proteomics und Signaltransduktion in Martinsried vom 16.8. bis zum 9.9.2011 von Clara Bultmann 1 Inhalt: 1. Einleitung..

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT

aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1 aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1. Hinweise zu Membranen a. Nitrocellulose b. PVDF (alternativ) 2. Aufbau des Transfers a. Naßblot b. Semi-dry (alternativ) 3. Färben und Dokumentation

Mehr

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Identifizierung von Bakterien durch Sequenzierung der 16S-rDNA Amplifikate

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Identifizierung von Bakterien durch Sequenzierung der 16S-rDNA Amplifikate Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Identifizierung von Bakterien durch Sequenzierung der 16S-rDNA Amplifikate Erstellt vom Unterausschuss Methodenentwicklung der LAG,

Mehr

4. Methoden. 4.1 Molekularbiologische Methoden

4. Methoden. 4.1 Molekularbiologische Methoden 4. Methoden 4.1 Molekularbiologische Methoden Extraktion und Ethanolfällung von DNA oder RNA Die zu extrahierende DNA oder RNA wurde mit einem Volumen Phenol/Chloroform/Isoamylalkohol versetzt, stark gevortext

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Vorbereitung: Start des Serial Cloners ( unter Laufwerk K: im Ordner Win_SerialCloner2-5 Programm direkt im Ordner starten) K:\Win_SerialCloner2-5 (oder 2-6

Mehr

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans AVID X / 1998 Lawsonia intracellularis Seite -1- Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans 1. ALLGEMEINES

Mehr

Abbildungsverzeichnis

Abbildungsverzeichnis I INHALTSVERZEICHNIS Abkürzungen VI Abbildungsverzeichnis VIII I. Einleitung 1. Neurone und Axonwachstum 1 2. Oligodendrozyten und Myelin 3 3. Das Proteolipid Protein (PLP) 6 4. Mutationen im PLP-Gen und

Mehr

Methoden 17. 5% Triton X-100 50 mm EDTA 50 mm Tris-HCl ph 8,0

Methoden 17. 5% Triton X-100 50 mm EDTA 50 mm Tris-HCl ph 8,0 Methoden 17 3. Methoden 3.1 DNA-Präparationen 3.1.1 Isolierung von Plasmid-DNA nach der Rapid-Boiling-Methode (nach Evans and Wahl, 1987) Zur schnellen Isolation von Plasmid-DNA für Restriktions- und PCR-Analysen

Mehr

SingleQuant Assay Kit

SingleQuant Assay Kit GEBRAUCHSANLEITUNG SingleQuant Assay Kit Kit für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39226) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010

Mehr

PRAKTIKUM II: ENZYMREAKTIONEN UND STOFFWECHSEL

PRAKTIKUM II: ENZYMREAKTIONEN UND STOFFWECHSEL 91 PRAKTIKUM II: ENZYMREAKTIONEN UND TOFFWECHEL PLATZ 8: EIGENCHAFTEN VON DNA, DNA-REKOMBINATIONTECHNIK, POLYMERAE-KETTENREAKTION IN DER MEDIZINICHEN DIAGNOTIK In den folgenden Experimenten werden Eigenschaften

Mehr

B i o c h e m i s c h e s B l o c k p r a k t i k u m

B i o c h e m i s c h e s B l o c k p r a k t i k u m B i o c h e m i s c h e s B l o c k p r a k t i k u m N U K L E I N S Ä U R E N WiSe 2010/11 Vorlesung: Praktikumsbetreuer: Jens Peter Fürste Katja Behling, Frank Kuppler, Holger Sieg, Petra Römer ALLGEMEINE

Mehr

Trouble-Shooting Sequenzierergebnisse

Trouble-Shooting Sequenzierergebnisse Trouble-Shooting Sequenzierergebnisse Mixed Base Definitionen Problem 1: Keine Reaktion, Keine Sequenzdaten Problem 2: Überlappende Signale Problem 3: Überlappende Signale beginnen in der Mitte der Sequenz

Mehr

Forschungszentrum Karlsruhe

Forschungszentrum Karlsruhe Forschungszentrum Karlsruhe in der Helmholtz-Gemelnschaft Wissenschaftliche Berichte FZKA7106 Biochemische Charakterisierung der Isoprensynthase aus der Graupappel (Populus x canescens (Ait.) Sm.) und

Mehr