NATURA. Lösungen. Qualifikationsphase. bearbeitet von. Horst Bickel Anna Büntge Inka Montero Carsten Schmidt Petra Stock

Größe: px
Ab Seite anzeigen:

Download "NATURA. Lösungen. Qualifikationsphase. bearbeitet von. Horst Bickel Anna Büntge Inka Montero Carsten Schmidt Petra Stock"

Transkript

1 NATURA Qualifikationsphase bearbeitet von Horst Bickel Anna Büntge Inka Montero Carsten Schmidt Petra Stock Lösungen Ernst Klett Verlag Stuttgart Leipzig

2 Auflage Alle Drucke dieser Auflage sind unverändert und können im Unterricht nebeneinander verwendet werden Die letzte Zahl bezeichnet das Jahr des Druckes Das Werk und seine Teile sind urheberrechtlich geschützt Jede Nutzung in anderen als den gesetzlich zugelassenen Fällen bedarf der vorherigen schriftlichen Einwilligung des Verlages Hinweis 52 a UrhG: Weder das Werk noch seine Teile dürfen ohne eine solche Einwilligung eingescannt und in ein Netzwerk eingestellt werden Dies gilt auch für Intranets von Schulen und sonstigen Bildungseinrichtungen Fotomechanische oder andere Wiedergabeverfahren nur mit Genehmigung des Verlages Ernst Klett Verlag GmbH, Stuttgart 215 Alle Rechte vorbehalten wwwklettde Redaktion: Rolf Strecker Mediengestaltung: Ingrid Walter A

3 Methoden Modelle unterstützen die Forschung (Seite 15) A1 Erläutern Sie anhand Abb 6 den Vorgang der Modellierung am Beispiel der DNA-Strukturaufklärung Die Daten der DNA wurden ausgewertet und führten zu Modellvorstellungen An diesem Beispiel zeigt sich, dass auch Fehlinterpretationen zu Modellen führen die korrigiert und verändert werden (Pauling) oder sich bestätigen Diese führte zu neuen Untersuchungen (Rosalind Franklin), deren Daten zu veränderten Modellen führen Die Planung neuer Experimente und weiterer Ergebnisse müssen das Modell bestätigen A2 Beschreiben Sie den Kurvenverlauf in Abb 7 und erläutern Sie die einzelnen Abschnitte 1 bis 4 unter dem Aspekt der Populationsgröße von Räubern und Beute an einem Beispiel Bei diesen Modelldaten sind die Individuenzahlen gegen die Zeit aufgetragen Die Kurvenverläufe der Beute- und Räuberindividuen verändert sich zeitlich verzögert Der Anstieg der Beutetiere führt mit einer zeitlichen Verzögerung zu einem Anstieg der Räuber (Phase 1 und 2) Der Kurvenverlauf der Beutetiere sinkt mit zunehmender Räuberanzahl (Phase 3) In Phase 4 sinkt dann die Anzahl der Räuber ebenfalls Dieser idealisierte Kurvenverlauf kann durch Simulationen entstehen In natürlichen Systemen sind zusätzlich andere Faktoren vorhanden, welche die Kurvenverläufe zusätzlich beeinflussen, sodass die Sinuskurve in ihrem Verlauf beeinträchtigt wäre A3 Beschreiben Sie die Daten in Abb 8 und erläutern Sie, welche Bedeutung solche Modellrechnungen für das Verständnis der Evolution haben In Abb 8 sind Modelldaten zur Fitness unter verschiedenen Modellvorgaben dargestellt Die Verteilung und Veränderung von Allelen innerhalb von Populationen spielt eine entscheidende Rolle bei der Fitness im Evolutionsprozess Die Simulationen zeigen jedoch, dass im Idealfall die Fitness bei beiden Voraussetzungen immer erreicht wird Hier können Grundüberlegungen Mechanismen erklären Diese müssen jedoch in der Realität genauer angepasst werden, das Modell muss überprüft werden 3 Methoden

4 1 Genetik 1 1 Nucleinsäuren DNA ein geniales Speichermedium (Seite 21) A1 Die DNA im Vergleich mit modernen Speichermedien: Ein Nucleotid auf einem DNA-Strang hat einen Informationsgehalt von 2 bit (=,25 byte), da es 2 2 = 4 Zustände (A, T, G bzw C) annehmen kann Berechnen Sie den Informationsgehalt der DNA einer menschlichen Zelle Vergleichen Sie mit modernen Speichermedien (DVD oder USB-Stick) Berücksichtigen Sie auch den Platzbedarf Ein Basenpaar der DNA hat einen Informationsgehalt von 2 bit =,25 Byte Die menschliche DNA enthält rund 6 Milliarden Basenpaare Damit ergeben sich,25 x 6 x 1 9 Byte = 1,5 Gigabyte Auf eine DVD passt mit 4,7 Gigabyte mehr als die dreifache Datenmenge, allerdings bei enormem Platzbedarf Auch wenn z B Speichermedien immer kleiner bei größerem Speichervolumen werden, ist der Platzbedarf eines Zellkerns noch nicht erreicht DNA-Replikation (Seite 22) A1 Erläutern Sie den Vorteil der hohen Anzahl an AT-Basenpaaren im Bereich eines Origins Zwischen aufeinander folgenden AT-Basenpaaren sind die Stapelkräfte der DNA verringert Zudem besteht eine AT-Basenpaarung jeweils aus nur zwei Wasserstoffbrückenbindungen Aufgrund der geringeren Anzahl an Wasserstoffbrücken und schwächeren Basenstapelkräften kann der DNA-Doppelstrang von der Helicase hier leichter geöffnet werden PCR DNA-Replikation im Reagenzglas (Seite 23) A1 Vergleichen Sie die Polymerasekettenreaktion mit der DNA-Replikation in einer eukaryotischen Zelle Die Auftrennung der DNA-Stränge erfolgt bei der PCR durch Temperaturerhöhung Bei der DNA-Replikation werden hierzu Enzyme verwendet (Helicase) Bei der PCR werden sowohl der Leit- als auch der Folgestrang kontinuierlich synthetisiert Bei der DNA-Replikation wird nur der Leitstrang kontinuierlich synthetisiert Die Synthese des Folgestrangs erfolgt in Okazaki- Fragmenten, die am Ende der Replikation zusammengefügt werden müssen Genau wie bei der DNA-Replikation sind zum Start der Synthese Primer erforderlich Im Gegensatz zur DNA-Replikation handelt es sich jedoch bei der PCR um DNA-Primer und nicht um RNA-Primer Folglich müssen diese auch am Ende nicht wieder herausgeschnitten werden Startpunkt und Endpunkt der Replikation werden durch spezifische Sequenzen auf der DNA festgelegt Bei der PCR wird der Beginn durch die Primer festgelegt und das Ende durch die Temperaturerhöhung herbeigeführt Für beide Prozesse wird eine DNA-Polymerase verwendet, die nur in 3 5 -Richtung arbeiten kann Im Gegensatz zu den DNA-Polymerasen aus Eukaryoten ist die bei der PCR verwendete DNA-Polymerase hitzestabil Bei der DNA-Replikation steht am Ende eine Verdopplung des gesamten Genoms einer Zelle eines Organismus Das Endprodukt der PCR sind viele Kopien einer relativ kurzen spezifischen DNA-Sequenz RNA mehr als nur eine weitere Nucleinsäure (Seite 24) A1 Recherchieren Sie ein Beispiel eines Ribozyms und beschreiben Sie seine Funktion Eines der ersten Ribozyme, die entdeckt wurden, ist die RNase P eine Ribonuclease Sie ist an der Bildung von t-rna-molekülen durch die Spaltung größerer t-rna-vorstufen beteiligt A2 Vergleichen Sie Ribozyme und Enzyme in ihrem Aufbau und ihrer Funktion Ribozyme sind aus RNA-Nucleotiden aufgebaut Durch Wechselwirkungen zwischen den Nucleotiden (z B komplementäre Basenpaarung durch H-Brücken) können sie eine komplexe dreidimensionale Struktur bilden (Sekundär-/ Tertiärstruktur) Enzyme sind aus Aminosäuren aufgebaut Auch sie können durch Wechselwirkungen zwischen den Seitenketten der Aminosäuren eine komplexe dreidimensionale Struktur bilden (Sekundär-/ Tertiärstruktur) Ribozyme und Enzyme haben dieselbe Grundfunktion: Sie binden spezifisch Substrate, katalysieren eine spezifische Reaktion mit diesem Substrat und entlassen ein Produkt (verändertes Substrat) Sie gehen aus dieser Reaktion unverbraucht hervor und können sie oft wiederholen 4 Genetik

5 Material: Nucleinsäuren (Seite 25) A1 Erläutern Sie die Schwierigkeiten bei der Entwicklung antiviraler Medikamente ohne Nebenwirkungen Nehmen Sie Stellung zu der Aussage Viren sind perfekte Tramper Viren bestehen meist nur aus Nucleinsäure und Proteinhülle Sie nutzen den Zellstoffwechsel und die enzymatische Maschinerie des Wirts Medikamente, die ihre Vermehrung stoppen oder verhindern sollen, können nur schlecht in den Stoffwechsel oder die Replikation eingreifen, da sie auch unbefallene Zellen des Wirtes schädigen würden Viruserkrankungen lassen sich derzeit am besten durch Impfungen potentieller Wirte bekämpfen Möglich könnte auch ein Angriff auf die spezifischen RNA-Polymerasen sein Tramper reisen mit leichtem Gepäck und unter Ausnutzung fremder Ressourcen über große Entfernungen Die Aussage trifft zu, da Viren fast nur die Information ihrer Nucleinsäure mit sich tragen und sich über die Ressourcen ihrer Wirte effektiv vermehren können A2 Nennen Sie die drei möglichen Hypothesen von Hershey und Chase Erläutern Sie die Schritte des Experiments Ergänzen Sie begründet die Schlussfolgerung 1 Die Viren-Proteine sind entscheidend für die Vermehrung, enthalten also die nötigen Informationen 2 Die Viren-DNA ist entscheidend für die Vermehrung, enthält also die nötigen Informationen 3 Sowohl DNA als auch Proteine sind entscheidend für die Vermehrung Beide enthalten also die nötigen Informationen Zunächst züchteten sie Bakteriophagen, die entweder eine radioaktiv markierte Proteinhülle (durch den Einbau von radioaktiven Schwefelatomen) oder eine radioaktiv markierte DNA (durch den Einbau von radioaktiven Phosphoratomen) besaßen Diese ließen sie Bakterien befallen Durch Mixen und anschließendes Zentrifugieren gelang es ihnen, Proteine und DNA voneinander zu trennen, ohne dass dabei die Bakterien beschädigt wurden Bei den Phagen mit markierter DNA fand sich die Radioaktivität am Boden des Probenröhrchens, bei denen mit markierten Proteinen im Überstand Abschließend entnahmen sie Proben aus dem jeweiligen Bodensatz und beobachteten, ob die Phagen sich vermehren konnten Da sich die Phagen in beiden Ansätzen erfolgreich vermehren konnten, obwohl die Proteine im Überstand abgetrennt wurden, zeigt, dass allein die DNA für die Vermehrung nötig ist Hershey und Chase lieferten damit eine unabhängige Bestätigung der Ergebnisse 1944 von Avery, dass die DNA die genetische Information enthält 5 Genetik

6 1 2 Proteinbiosynthese Die Entwicklung des Genbegriffs (Seite 26) A1 Geben Sie an, welches Gen bei den in Abb 1 dargestellten Neurospora-Mutanten jeweils defekt ist und erläutern Sie die Entwicklung des Genbegriffs Bei jeder Mangelmutante von Neurospora ist das Gen für ein bestimmtes Enzym defekt Stellt man der Mutante aber im Nährmedium den Stoff zur Verfügung, hat ihr Stoffwechsel wieder alle benötigten Substanzen, vor allem das lebenswichtige Tryptophan zur Verfügung: Die Zellen wachsen und vermehren sich wieder Im ersten Fall kann Neurospora nur wachsen, wenn ihr direkt Tryptophan zur Verfügung gestellt wird Die Vorstufen dafür nützen nichts Es kann also hier der letzte Aufbauschritt zum Tryptophan nicht vollzogen werden, Das Enzym für die Katalyse der Reaktion von Indol zu Tryptophan ist aufgrund der Veränderung in seinem Gen defekt Im zweiten Fall funktioniert dieser Schritt Diese Mutante wächst auch, wenn Indol (oder direkt das daraus gebildete Tryptophan) zur Verfügung steht Indol selbst aber kann hier nicht synthetisiert werden, das Enzym für die Reaktion von Anthranilsäure zu Indol ist defekt Entsprechend kann man von den anderen beiden Mutanten sagen, dass die dritte keine Antranilsäure, die vierte keine Chorrisminsäure synthetisieren kann Die Entwicklung des Genbegriffs hängt mit dem Erkenntnisgewinn über Proteinfunktion und Genexpression zusammen Garrod stellte zunächst die Hypothese auf, dass ein Gen die genetische Information für den Bau eines Enzyms trägt Dies bestätigten Beadle und Tatum in ihrem Experiment über Mangelmutanten Mit der Kenntnis darüber, dass nicht jedes Polypeptid ein Enzym darstellt, entwickelte man die Ein-Gen-ein-Polypeptid-Hypothese Mit den Erkenntnissen über die Genexpression (z B alternatives Spleißen; r-rna, si-rna etc) entwickelte man den heutigen Genbegriff: Ein Gen ist ein DNA-Abschnitt, der für eine RNA codiert Material: Genwirkketten (Seite 27) A1 Erläutern Sie das in der Abbildung dargestellte Versuchsergebnis Alle 6 Bakterienstämme wachsen auf dem Vollmedium und auf dem Minimalmedium, dem Arginin zugesetzt wurde Auf dem Minimalmedium mit Ornithinzusatz wachsen 2 Stämme und auf dem mit Citrullin 4 Bakterienstämme Das Versuchsergebnis lässt darauf schließen, dass Arginin von allen Bakterien benötigt wird Zwei Stämme wachsen weder auf Ornithin noch auf Arginin Für diese Stämme ist Arginin ein lebenswichtiger Zusatz, da sie diesen Stoff nicht selbst herstellen können Die beiden Stämme, die auf Ornithin wachsen, wachsen ebenfalls auf Citrullin, was darauf hinweist, dass sie Enzyme zur Weiterverarbeitung beider Stoffe besitzen 2 Stämme wachsen nur auf Citrullin, nicht aber auf Ornithin Ihnen fehlen die Enzyme zur Verarbeitung dieses Stoffes So lässt sich schließen, dass Ornithin und Citrullin Zwischenprodukte auf dem Syntheseweg des Arginin sind A2 Erklären Sie den Begriff Mangelmutante Unter Mangelmutanten versteht man Bakterien, die die Fähigkeit verloren haben, bestimmte biochemische Synthesen durchzuführen Dadurch können sie nur auf Nährmedien wachsen, denen die Stoffe zugesetzt wurden, die sie nicht mehr selbst herstellen können A3 Nennen Sie Möglichkeiten, im Labor Mangelmutanten eines Bakteriums zu erkennen Mangelmutanten lassen sich dadurch erkennen, dass sie auf Minimalnährmedien nicht wachsen können Durch Zugabe verschiedener Substanzen lässt sich erkennen, welcher Stoff von der Mangelmutante nicht mehr selbst hergestellt werden kann Gibt man Zwischenprodukte des Syntheseweges hinzu, kann man genau erkennen, welches Enzym auf dem Stoffwechselweg des Bakteriums durch die Mutation einen Defekt aufweist A4 Stellen Sie den Syntheseweg der Aminosäure Arginin in Form einer Genwirkkette dar Vorstufe Ornithin Citrullin Arginin Enzym 1 Enzym 2 Enzym 3 Gen 1 Gen 2 Gen 3 A5 Ordnen Sie die beschriebenen Krankheitsbilder Mutationen der Gene der Enzyme A, B, C bzw D zu Begründen Sie Mutation am Gen für Enzym A: Phenylketonurie; Anreicherung von Phenylalanin, Entstehung von Phenylketon, da kein Abbau zu Tyrosin möglich; Mutation am Gen für Enzym B: Albinismus; keine Bildung von Melanin möglich; Mutation am Gen für Enzym C: Alkaptonurie; Anreicherung von Homogentinsinsäure und Oxidation zum Alkapton, da kein Abbau zu CO 2 und H 2 O möglich; Mutation am Gen für Enzym D: Kretinismus; keine Bildung von Thyroxin möglich 6 Genetik

7 A6 Bei den oben beschriebenen Stoffwechselerkrankungen handelt es sich um genetisch bedingte Krankheiten, die durch eine rezessive Anlage verursacht werden Die Erkrankung tritt nur auf, wenn beide homologen Chromosomen den Defekt aufweisen Geben Sie dafür eine Erklärung Liegt eine rezessive Erkrankung vor, tragen beide homologen Chromosomen den Defekt, d h der Organismus kann das Enzym nicht mehr herstellen In diesem Fall tritt die Erkrankung auf Beim heterozygoten Genotyp kann das Enzym immer noch hergestellt werden A7 Neugeborene werden heute routinemäßig auf PKU untersucht Beschreiben Sie eine mögliche Therapie im Falle eines positiven Tests Bei positivem Ergebnis wird eine phenylalaninarme und thyrosinreiche Diät verabreicht, das Gehirn entwickelt sich dann normal A8 PKU-Kranke fallen häufig durch eine besonders helle Haut, helle Haarfarbe und helle Augen auf Begründen Sie diese Symptome anhand des Phenylalaninstoffwechsels PKU-Kranken fehlt das Enzym zur Synthese von Thyrosin aus Phenylalanin Dadurch entsteht bei PKU-Kranken ein Mangel an Thyrosin und allen daraus gebildeten Stoffen Zu ihnen gehört auch der Farbstoff Melanin, der für die Färbung der Haut, der Haare und der Iris des Auges verantwortlich ist Transkription der erste Schritt der Proteinbiosynthese (Seite 29) A1 Geben Sie die m-rna-sequenz an, in die der folgende DNA-Abschnitt transkribiert wird 3 TTGAGGCTAGATACCGAACCTTCT 5 Die m-rna lautet: 5 AACUCCGAUCUAUGGCUUGGAAGA 3 A2 Stellen Sie tabellarisch DNA-Replikation und Transkription gegenüber, indem Sie die biologische Bedeutung, den Zeitpunkt im Zellzyklus, die zugehörigen Vorlagen, die beteiligten Enzyme sowie die verwendeten Nucleotide auflisten biologische Bedeutung der DNA-Replikation: Kopieren von DNA vor der Zellteilung biologische Bedeutung der Transkription: Transport der genetischen Information vom Zellkern zu den Ribosomen Zeitpunkt im Zellzyklus bei der DNA-Replikation: vor der Zellteilung (Synthese-Phase) Zeitpunkt im Zellzyklus bei der Transkription: G 1 -Phase (Wachstumsphase) und G -Phase (Dauerphase) zugehörige Vorlagen bei der DNA-Replikation: beide DNA-Einzelstränge zugehörige Vorlagen bei der Transkription: codogener DNA-Strang verwendete Nucleotide bei der DNA-Replikation: A-, T-, C-, G-Nucleotide verwendete Nucleotide bei der Transkription: A-, U-, C-, G-Nucleotide Material: Die Erforschung der RNA (Seite 31) A1 Beschreiben Sie kurz das Experiment in Abb 1 und erläutern Sie die Bedeutung der kurzfristigen Gabe von radioaktiv markiertem Uracil Eukaryotischen Zellen wurde für einen kurzen Zeitraum radioaktiv markiertes Uracil angeboten (Tracerexperiment) Anschließend wurde untersucht, wo die Markierungen in der Zelle zu finden waren Die Bedeutung der kurzfristigen Gabe von markiertem Uracil liegt darin, dass eine Veränderung innerhalb der Zelle gemessen werden kann, ansonsten käme es zu einer Anhäufung, wodurch die räumliche Veränderung nicht mehr nachvollziehbar wäre A2 Erklären Sie anhand der in Abb 1 dargestellten Versuchsergebnisse die unterschiedliche Verteilung des Tracers in der Zelle und übertragen Sie diese Aussagen auf das Schema in Abb 3 Uracil ist ein Baustein der nur in der RNA vorkommt Hierdurch konnte man nachweisen, dass zuerst im Zellkern (Nucleus) viel Uracil zu finden ist, danach im Cytoplasma Dies bedeutet, dass RNA im Nucleus gebildet wird und anschließend ins Cytoplasma gelangt Das wäre ein Hinweis, dass die RNA die Informationen aus dem Nucleus ins Cytoplasma transportiert A3 Erläutern Sie mithilfe dieser Aussagen und der Informationen zur Entdeckungsgeschichte der RNA, welche Fragestellungen mit diesen Experimenten beantwortet werden konnten Die Vermutung, dass die Ribosomen immer spezifische Aufbauten der Proteine vorbestimmt haben, konnte widerlegt werden, da die Zusammensetzung der RNA ständig wechselte und relativ schnell Informationen aus dem Nucleus ins Cytoplasma gelangten Daher musste eine zusätzliche RNA vorhanden sein, welche die Verbindung zwischen DNA und Ribosomen darstellte Diese wurde messenger-rna genannt 7 Genetik

8 A4 Beschreiben Sie die Versuchsergebnisse in Abb 2 In Abb 2 sind die verschiedenen RNAs und deren Verteilung nach der Zentrifugation dargestellt Es wird sowohl die Gesamtmenge der RNA angegeben als auch die radioaktiv markierte Menge Man findet größere Mengen an Polysomen und einzelnen Ribosomen sowie t-rna Freie m-rna findet man nicht in großen Mengen Bei der Markierung liegt der Schwerpunkt bei den Polysomen und Ribosomen und der m-rna, nicht bei der t-rna A5 Erklären Sie die Messergebnisse in Verbindung mit der Versuchsdurchführung Aus diesem Messergebnis wird deutlich, dass die Information kurzfristig über die m-rna umgesetzt wird, da diese kurzfristig für die Steuerung der Proteinbiosynthese neu aufgebaut wird Die m-rna tritt mit den Ribosomen in Verbindung Durch das Pulsexperiment konnte der kurzfristige Vorgang deutlich werden, besonders von der freien zu gebundenen m-rna A6 Erläutern Sie anhand des Textes zur Entdeckungsgeschichte der m-rna, welcher Zusammenhang mit den Versuchen geklärt werden konnte Es wurde die Vermittlung der Information von der DNA zum Ort der Proteinbiosynthese, den Ribosomen, hierdurch erklärbar A7 Beschreiben Sie die Experimente mit Acetabulariazellen in Abb 6 Nehmen Sie hierzu auch die Informationen aus dem Text zur Hilfe In Abb 6 sind die Auftrennungsergebnisse von Proteinen verschiedener Acetabularia-Arten mithilfe der Gelelektrophorese dargestellt Es zeigen sich zwischen A mediterranea und A crenulata deutliche Unterschiede Nach dem Tausch der Rhizoide mit dem jeweiligen Nucleus zeigten sich die dementsprechenden Bandenmuster des dazugehörenden Nucleus A8 Erläutern Sie, welche Bedeutung diese Ergebnisse für die Hypothese zu den morphogenetischen Substanzen und der m-rna haben Da die Proteine dem jeweiligen Kern zugeordnet werden konnten, jedoch kurzfristig noch die alte Hutform gebildet wurde, mussten neben den Proteinen noch andere Substanzen vorhanden sein, die morphogenetischen Substanzen Es waren also nicht nur der Nucleus und die neuen Proteine entscheidend, sondern noch Substanzen des alten Nucleus Da die m-rna jedoch auch nicht bei den Proteinen nachzuweisen ist, könnte sie diese Funktion beinhalten Der genetische Code (Seite 32) A1 Übersetzen Sie die folgende m-rna in eine Aminosäuresequenz 5 UUAGAUGAGCGACGAACCCCUAAAAUUUACCUAGUAGUAGCCAU 3 Met-Ser-Asp-Glu-Pro-Leu-Lys-Phe-Thr-Stopp-Stopp-Stopp A2 Übertragen Sie diesen Abschnitt eines codogenen DNA-Strangs in die entsprechende Aminosäuresequenz 3 CTGGCTACTGACCCGCTTCTTCTATC 5 Die m-rna lautet: 5 GACCGAUGACUGGGCGAAGAAGAUAG3 Die Aminosäuresequenz lautet: Met-Thr-Gly-Arg-Arg-Arg-Stopp A3 Lassen Sie den ersten Buchstaben im Beispielsatz VORDERRNAISTDIEDNA weg und behalten den Triplettcode bei, wird der Sinn des Satzes entstellt Lassen Sie in der DNA-Sequenz aus Aufgabe 2 ebenfalls die erste Base weg Beschreiben Sie die Konsequenzen Die m-rna lautet: 5 ACCGAUGACUGGGCGAAGAAGAUAG3 Durch die Verschiebung des Leserasters entfällt das Start-Codon AUG, es gibt kein Genprodukt 8 Genetik

9 Material: Die Entdeckung des genetischen Codes (Seite 33) A1 Skizzieren Sie den Versuchsaufbau von Nirenberg und Lederer, mit dem der genetische Code entschlüsselt wurde s Skizze radioaktiv markiertes Phenylalanin unmarkierte Aminosäuren (alle außer Phenylalanin) t-rna- Moleküle m-rna-tripletts der Sequenz UUU Ribosomen Nur die mit Phenylalanin beladene t-rna bindet an die m-rna und das Ribosom Filtrieren Ribosomen und die gebundene Phenylalanin-t-RNA bleiben auf dem Filter zurück Die übrigen t-rnas gelangen ins Filtrat Untersuchen auf Radioaktivität Ist der Filter radioaktiv, codiert das Triplett UCU für Phenylalanin A2 Aus den Versuchsergebnissen lässt sich den Tripletts UUU und UCU eine Bedeutung zuordnen Nennen Sie diese UUU codiert für die Aminosäure Phenylalanin (Phe), UCU für die Aminosäure Serin (Ser) A3 Vor den Triplettbindungstests wurden alle m-rna-moleküle der Herkunftszellen entfernt Begründen Sie dieses Vorgehen Die radioaktiv markierten Aminosäuren wären ansonsten bei der Translation der m-rna-moleküle der Herkunftszelle in die Proteine eingebaut worden, die Radioaktivität hätte sich auf dem Filter wiedergefunden, die Bedeutung der m-rna-moleküle bekannter Sequenz hätte sich nicht aufklären lassen A4 Durch die Verwendung von Poly-U-, Poly-A-, Poly-C- und Poly-G-m-RNA-Sequenzen konnte weiteren Tripletts eine Bedeutung zugeordnet werden Nennen Sie die entsprechenden Tripletts und ihre Bedeutung Jede der vier eingesetzten m-rnas wird in Proteine aus immer gleichen Aminosäuren übersetzt Die vier auftretenden Tripletts codieren die folgenden Aminosäuren: UUU = Phenylalanin; AAA = Lysin; CCC = Prolin; GGG = Glycin A5 Verwendet man RNA, in der zwei Nucleotide abwechselnd vorkommen, erhält man Peptide, in denen sich zwei Aminosäuren abwechseln Erklären Sie dies Kann man durch diese Versuche die Bedeutung weiterer Tripletts eindeutig klären? Wechseln sich in einer m-rna zwei Nucleotide regelmäßig ab, ergeben sich je nach Translationsstart zwei verschiedene, sich abwechselnde Tripletts Bei Poly-AC sind folgende Triplettmuster möglich: ACA-CAC-ACA-CAC- oder CAC-ACA-CAC-ACA- Da sich mit Poly-AC ein Peptid ergibt, in dem sich Threonin und Histidin abwechseln, kann man folgern, dass eines der beiden Tripletts ACA oder CAC die Aminosäure Histidin codiert, das andere Threonin Eindeutig klären lässt sich die Bedeutung der Tripletts nicht A6 Verwendet man andere, regelmäßige Polynucleotide aus längeren Untereinheiten, erhält man im Gemisch verschiedene Peptide (s unten) Erläutern Sie, weshalb verschiedene Peptide gebildet werden Ordnen Sie weiteren Tripletts eine Bedeutung zu Je nach Start ergeben sich bei Poly-AAC drei verschiedene Triplettmuster: AAC-AAC-AAC-AAC-, ACA-ACA-ACA-ACA- oder CAA-CAA-CAA-CAA- Zunächst lässt sich nicht eindeutig folgern, welches der drei Tripletts AAC, ACA und CAA die Aminosäuren Asparagin, Threonin bzw Glutamin codiert Aus den Angaben zu Aufgabe 5 ist aber bekannt, dass das Triplett ACA die Aminosäuren Histidin oder Threonin codiert Da hier nur Threonin auftritt, muss ACA für Threonin stehen Daraus ergibt sich, dass CAC der Aminosäure Histidin entspricht (s Aufgabe 5) Welches der beiden Tripletts AAC und CAA die Aminosäuren Asparagin bzw Glutamin codiert, bleibt zunächst unklar Mit Poly-ACC ergeben sich die drei Triplettmuster: ACC-ACC-ACC-ACC-, CCA- CCA-CCA-CCA- oder CAC-CAC-CAC-CAC- Da CAC der Aminosäure Histidin entspricht, müssen die Tripletts ACC und CCA jeweils für eine der beiden Aminosäuren Threonin oder Prolin stehen 9 Genetik

10 A7 Es wurden ebenfalls Experimente mit vier regelmäßig wechselnden Nucleotiden durchgeführt (s unten) Analysieren Sie das Versuchsergebnis Mit Poly-ACCC ergeben sich folgende vier Triplettmuster: ACC-CAC-CCA-CCC-ACC-, CCC-ACC-CAC-CCA-CCC-, CCA-CCC-ACC-CAC-CCA- oder CAC-CCA-CCC-ACC-CAC- Die vier möglichen Tripletts treten stets in derselben Reihenfolge auf Daher wird ein Peptid gebildet, in dem sich eine Sequenz aus vier Aminosäuren wiederholt Da bekannt ist, dass das Triplett CCC für Prolin und das Triplett CAC für Histidin steht, müssen die Tripletts ACC und CCA jeweils eine der beiden Aminosäuren Threonin oder Prolin codieren Das Triplett CCA liegt zwischen den Tripletts CAC und CCC Zwischen Histidin und Prolin liegt im Peptid die Aminosäure Prolin Also steht das Triplett CCA ebenfalls für Prolin und ACC folglich für Threonin Translation ein Protein entsteht (Seite 36) A1 Das Codon AUG hat zwei verschiedene Bedeutungen, je nachdem ob es sich am Anfang einer m-rna befindet oder nicht Begründen Sie Als Startcodon markiert AUG auf einer m-rna den Beginn der Translation, fungiert also als Satzzeichen Methionin ist demgemäß die erste Aminosäure eines Proteins, die aber meist bei der Reifung von Proteinen wieder abgespalten wird Innerhalb eines Proteins codiert das Codon AUG lediglich für die Aminosäure Methionin A2 Ein Ausschnitt eines Peptids lautet: Ser Val Lys Met Ala Geben Sie eine mögliche Sequenz der m-rna und der codogenen DNA an Eine mögliche Lösung wäre: m-rna: 5 UCU GUG AAA AUG GCU 3 codogene DNA: 3 AGA CAC TTT TAC CGA 5 Vergleich der Proteinbiosynthese bei Pro- und Eukaryoten (Seite 39) A1 Erläutern Sie, weshalb die Proteinsynthese bei Eukaryoten mehr Zeit erfordert Bei eukaryotischen Zellen erfolgt die Transkription im Zellkern, die Translation im Zellplasma Der Ort der Transkription ist also, anders als bei den Prokaryoten, durch die Kernmembran vom Ort der Translation getrennt Die Translation kann demnach bei Eukaryoten erst beginnen, wenn die Transkription mit dem Spleißen beendet und die fertige m-rna durch die Kernporen in das Cytoplasma gelangt ist Modellvorstellungen zur Genregulation bei Prokaryoten (Seite 4) A1 Vergleichen Sie Substrat-Induktion und Endprodukt-Repression Bei gleichem Grundaufbau (Repressor, Effektor, Operon aus Promotor, Operator und Strukturgenen) zeigen Substrat-Induktion und Endprodukt-Repression genau gegenteilige Zustände: Während bei der Substrat-Induktion das Regulatorgen für einen aktiven Repressor codiert, der durch Bindung des Effektors inaktiviert wird, codiert bei der Endprodukt-Repression das Regulatorgen für einen inaktiven Repressor, der durch Bindung des Effektors erst aktiv wird Beide Male verhindert ein aktiver Repressor die Transkription der Strukturgene, ein inaktiver gibt sie frei Bei der Substrat-Induktion entstehen abbauende Enzyme, während bei der Endprodukt- Repression aufbauende Enzyme gebildet werden A2 Erläutern Sie die Aussage: Ein Effektor kann als Induktor oder als Co-Repressor wirken Je nachdem, ob der Effektor den Repressor inaktiviert oder aktiviert, sorgt er als Induktor für den Substratabbau (Substrat-Induktion) oder als Co-Repressor für den Baustopp des Endprodukts (Endprodukt-Repression) Material: Genregulation bei Prokaryoten (Seite 41) A1 Beschreiben Sie die Grafik Zugabe der radioaktiven Aminosäuren erfolgt zeitlich vor der Zugabe des Substrats Kurze Zeit nach der Zugabe des Substrats sind die ersten Moleküle radioaktiv markierter ß-Galactosidase festzustellen Ihre relative Menge nimmt dann linear zu A2 Mit dem gezeigten Ergebnis konnte die Hypothese widerlegt werden Erläutern Sie diese Schlussfolgerung Radioaktive ß-Galactosidase kann nur entstehen, indem neue Proteine mit den radioaktiven Bausteinen (AS) gebildet werden Der Zeitpunkt des Nachweises zeigt, dass der Proteinbau erst nach der Substratzugabe erfolgt 1 Genetik

11 A3 Zeichnen Sie das zu erwartende Ergebnis, wenn die Hypothese richtig gewesen wäre Wenn sich die Substrate mit bereits vorhandenen Vorläufer-Proteinen verbinden, um aktive Enzyme zu erhalten, findet kein Neubau der Proteine statt Es wäre keine radioaktive ß-Galactosidase nachweisbar A4 Erläutern Sie die zeitliche Verzögerung zwischen der Substratzugabe und dem ersten Auftreten radioaktiver b-galactosidase Nach der Substratzugabe wird etwas Zeit für die Vorgänge der Transkription und Translation benötigt, bevor die ersten fertigen Proteine nachweisbar sind A5 Beschreiben Sie die vier Zustände des lac-operons (Abb 2) und geben Sie für jeden Zustand an, ob Lactose und/oder Glucose vorhanden sind 1: Operon aus; kein Repressor gebunden; kein CAP-c-AMP-Komlex gebunden; Lactose und Glucose sind vorhanden 2: Operon aus; Repressor ist gebunden; kein CAP-c-AMP-Komlex gebunden; keine Lactose aber Glucose vorhanden 3: Operon aus; Repressor ist gebunden; CAP-c-AMP-Komlex ist gebunden weder Lactose noch Glucose vorhanden 4: Operon an (Transkription erfolgt); kein Repressor gebunden; CAP-c-AMP-Komlex ist gebunden; RNA-Polymerase ist gebunden und transkribiert die lac-gene Lactose ist vorhanden, Glucose nicht A6 Nehmen Sie begründet Stellung zu folgender Aussage: Die Konzentrationsbestimmungen von Lactose, Glucose, Glucose-Abbauprodukten, c-amp und CAP lieferten den Forschern wichtige Informationen bei der Entschlüsselung der doppelten Kontrolle des lac-operons Ich halte diese Aussage für richtig, da die Forscher durch die Konzentrationsmessungen sehen konnten, dass nicht alle Konzentrationen hoch sein mussten, sondern eine Kombination unterschiedlicher Konzentrationen nötig waren, damit die Transkription erfolgt A7 Erstellen Sie Hypothesen, auf welchem Weg Medikamente in die doppelte Kontrolle des lac- Operons eingreifen können Medikamente können an vielen verschiedenen Stellen eingreifen Sie können die Menge des Repressors oder des Aktivators verändern, ihre Bindungseigenschaften ändern sowie die Bindungsstellen besetzen Modellvorstellungen zur Genregulation bei Eukaryoten (Seite 43) A1 Fassen Sie die Möglichkeiten der Genregulation bei Eukaryoten auf den verschiedenen Ebenen (Transkriptionsebene, RNA-Prozessierungsebene, Translationsebene, Proteinaktivitätsebene) in Form einer Tabelle zusammen siehe Tabelle Regulations ebene Transkriptionsebene RNA-Prozessierungsebene Translationsebene Proteinaktivitätsebene Mechanismus Proteine (Transkriptionsfaktoren) binden an regulatorische DNA- Sequenzen und aktivieren oder hemmen die Transkription alternatives Spleißen der m-rna Abbau der m-rna durch spezielle Enzyme Aktivierung bzw Inaktivierung von Proteinen; Abbau von Proteinen Epigenetik Gene und Umwelt (Seite 45) A1 Beschreiben Sie die unterschiedlichen epigenetischen Modifikationen am Beispiel der Agouti-Maus Das Beispiel der Agouti-Maus zeigt, wie der Aktivitätszustand eines Gens durch Umwelteinflüsse (Ernährung) beeinflusst werden kann Beim inaktiven Agouti-Gen liegt durch Methylierung der DNA das Chromatin so stark komprimiert vor, dass die RNA-Polymerase blockiert wird und die Transkription unterbleibt Auch die freien Enden der Histone können methyliert werden und so weitere Proteine aktivieren, die dann das Anheften der Polymerase und anderer Transkriptionsfaktoren blockieren (Silencing) Um das Agouti-Gen zu aktivieren, muss die Methylierung rückgängig gemacht werden Eine geringere Packungsdichte des Chromatins und eine damit einhergehende Erhöhung der Transkriptionsrate wird dann zusätzlich durch die Acetylierung der Histone erreicht 11 Genetik

12 A2 Entwickeln Sie eine Hypothese hinsichtlich der Wirkung epigenetischer Medikamente zur Krebstherapie Die Medikamente müssten die epigenetischen Modifikationen beeinflussen können Damit könnten z B Tumorsuppressorgene aktiviert werden Dies betrifft laut Abb 4 insbesondere die Demethylierung und Acetylierung der DNA, wodurch die Wechselwirkung der Histone mit der DNA verändert wird Die lockerere Wicklung sorgt dann für eine höhere Transkritionsrate bei den Tumorsuppressorgenen Entsprechend könnten auch Gene, die durch epigenetische Veränderungen die Kontrolle über das Zellwachstum verloren haben, durch Einsatz von Methyltransferasen, gezielt stillgelegt werden Material: Epigenetik (Seite 46) A1 Vergleichen Sie die Veränderungen durch epigenetische Abweichung in Abb 1 und ordnen Sie die Methylierungsmuster begründet dreijährigen bzw fünfzigjährigen eineiigen Zwillingen zu Im Vergleich der Methylierungsmuster der eineiigen Zwillinge zeigen sich auffällige Unterschiede Bei dem Chromosomenpaar mit der starken Gelbfärbung sind die Methylierungsmuster recht ähnlich Das Maß an Hypo- bzw Hypermethylierung ist annähernd identisch, d h dass eine Expression gleicher Gene erfolgt Dieses Muster kann man also dem dreijährigen Zwillingspaar zuordnen In dem anderen Chromosomenpaar überwiegen in jeweils anderen Bereichen der Chromosomen die roten und grünen Signale Hier liegen demzufolge mehr oder weniger ausgeprägte Methylierungen vor und so ergeben sich jeweils andere Muster Da die Methylierung die Transkription der Gene steuert und so deren Genexpression verändert, belegen verschiedenfarbige Bereiche der angefärbten Chromosomen eine unterschiedliche Genexpression Dieses Chromosomenpaar lässt sich deshalb den fünfzigjährigen eineiigen Zwillingen zuordnen, bei denen sich aufgrund des Alters über einen langen Zeitraum verschiedene Methylierungsmuster entwickeln A2 Formulieren Sie eine Hypothese über die Ursachen der epigenetischen Abweichungen bei eineiigen Zwillingen Obwohl sie identische Gene besitzen, unterscheiden sich ältere eineiige Zwillinge manchmal recht stark voneinander Es ist zu vermuten, dass einige Abschnitte der Erbsubstanz bei einem Zwilling aktiv und beim anderen inaktiv sind bzw bestimmte Gene an- oder abgschaltet sind Die Ursache dafür sind epigenetische Veränderungen am Erbgut, die im Laufe des Lebens entstehen und sich ausprägen So können psychische und physische Krankheiten, Ernährungsgewohnheiten, das Maß an körperlicher Aktivität, Stress und Rauchen zu unterschiedlichen epigenetischen Mustern und damit zu unterschiedlichen phänotypischen Merkmalen führen A3 Beschreiben Sie den Einfluss des Gelée Royal auf die Entwicklung in einem Bienenstaat Das fett- und eiweißreiche Gelée Royal hat einen direkten Einfluss auf die Entwicklung der Bienen und die Arbeitsteilung in einem Staat Arbeiterbienen und die eierlegende Königin haben zwar denselben Genotyp, die phänotypische Ausprägung ist jedoch unterschiedlich Werden Larven mit Gelée Royal gefüttert, so wachsen sie zu Königinnen heran, während die mit Pollen und Honig gefütterten Bienenlarven zu Arbeiterinnen werden A4 Erläutern Sie anhand der Abb 5 die Wirkung von Methyltransferase-Hemmer auf die Larven Methyltransferase-Hemmer blockieren gezielt die Enzyme (Methyltransferasen), die für Methylierungen der DNA verantwortlich sind Abb 5 zeigt, dass bei der Kontrolle der prozentuale Anteil der Methylierung in der DNA der Bienenlarven hoch ist (8 %) Diese Larven entwickeln sich dann zu Arbeiterinnen, während es deutlich weniger Bienen gibt, deren DNA einen geringeren Grad an Methylierung aufweist und die damit bezogen auf diesen Parameter königinnenähnlich sind Unter dem Einfluss eines Methyltransferase-Hemmers sind die Verhältnisse anders Das Enzym verhindert eine Übertragung von Methylgruppen, sodass nur etwa 25 % der Larven zu Arbeiterinnen werden Dagegen steigt der Anteil an Königinnen stark an Die Methyltransferasen sorgen demnach für ein gänzlich anderes Methylierungsmuster bei den Larven und steuern damit die Entwicklung von Königinnen A5 Stellen Sie eine begründete Hypothese auf über die Zusammensetzung des Gelée Royal hinsichtlich seiner epigenetischen Wirkung Die Ernährung von Bienenlarven mit Gelée Royal ist für die Entwicklung der Bienenkönigin ausschlaggebend und man kann diese Entwicklung auch durch den Einsatz von Methyltransferase- Hemmern auslösen So liegt die Vermutung nahe, dass sich im Gelée Royal auch Methyltransferase-Hemmer befinden, deren Aktivität ein zur DNA der Arbeiterinnen unterschiedliches Methylierungsmuster der Königinnen-DNA bewirkt 12 Genetik

13 A6 Ermitteln Sie, welche Folgen eine hohe Pheromonkonzentration für das Sammelverhalten der Bienen hat Pheromone, die von den älteren Sammelbienen abgegeben werden, signalisieren den Arbeiterbienen, dass genügend Sammelbienen im Stock vorhanden sind und keine jüngeren Bienen zu Sammlerinnen rekrutiert werden müssen Material: Genomische Prägung (Seite 47) A1 Beschreiben Sie die genauen Vorgänge bei der Inaktivierung des X-Chromosoms und stellen Sie die Kondensation des X-Chromosoms grafisch dar Die starke Kondensierung des X-Chromosoms geht von einem bestimmten DNA-Bereich nahe des Centromers aus, der sogenannten XIC-Region Die dort lokalisierten Gene tragen die genetische Information für die XIST-RNA Diese RNA-Moleküle binden flächendeckend am gesamten Chromosom und legen dieses still Außerdem bewirkt die XIST-RNA eine Methylierung der DNA sowie eine Abspaltung der Acetylgruppen von den Histonen XIST-RNA zunehmende Kondensation des Chromatids aktives X-Chromosom inaktives X-Chromosom A2 Erläutern Sie die Weitergabe von Methylierungsmustern an Tochterzellen und erörtern Sie den Begriff Zellgedächtnis am Beispiel der Schildpattkatze Während dem Wachstum und der Entwicklung von Organismen finden besonders viele Zellteilungen statt Die damit zusammenhängenden Replikationen der DNA erfordern eine Dekondensation des X-Chromosoms der Schildpatt-Katze Allerdings bleibt die Information darüber, welches X-Chromosom nach der Replikation wieder inaktiviert werden soll, über alle nachfolgenden Generationen erhalten Dies bezeichnet man als Zellgedächtnis Die Methylierungsmuster der DNA gehen also während der Replikation nicht verloren Nach dem Grundsatz der semikonservativen Replikation besteht die DNA der Tochterzellen aus einem methylierten Einzelstrang und einem Strang, der an den entsprechenden Stellen (vorwiegend an der Base Cytosin) keine Methylgruppen trägt Bestimmte Enzyme, die sogenannten Erhaltungsmethylasen, erkennen das Muster und ergänzen an den jeweiligen Stellen die Methylgruppe Da die Gene für die Fellfarbe bei Schildpatt-Katzen auf dem X-Chromosom lokalisiert sind und in den Zellen jeweils nur ein X-Chromosom (aber nicht stets dasselbe) aktiv ist, kommt es zu einer zufälligen Expression der Gene für die Fellfarbe je nach dem, von welchem Elternteil das jeweils aktive X-Chromosom stammt A3 Begründen Sie, inwiefern die Inaktivierung eines X-Chromosoms bei Säugetieren ein extremes Beispiel für epigenetische Vererbung darstellt Epigenetische Veränderungen durch Methylierung oder Acetylierung betreffen in der Regel bestimmte DNA-Abschnitte und beeinflussen damit die Expression einzelner dort lokalisierter Gene Bei der Inaktivierung eines X-Chromosoms ist jedoch ein ganzes Chromosom betroffen, da durch Methylierung und Histondeacetylierung alle Gene eines Chromosoms ausgeschaltet werden RNA-Interferenz und Gen-Silencing (Seite 49) A1 Vergleichen Sie mi-rna mit si-rna Beide sind doppelsträngige RNA-Moleküle mit einer Länge von ca 2 bis 25 Nucleotiden und beide erhalten ihre Länge durch Schneiden mit Dicer mi-rna wird als prä-mi-rna durch Transkription zelleigener DNA gebildet, paart sich komplementär, wird geschnitten und richtet sich gegen zelleigene Gene si-rna entsteht durch Schneiden langer, doppelsträngiger RNA, die zellfremd ist (z B viral) Richtet sich gegen zellfremde Gene 13 Genetik

14 A2 Erläutern Sie die Unterschiede zwischen der Regulation durch RISC und der durch Transkriptionsfaktoren Regulation durch RISC = posttraskriptional, d h Transkription ist gelaufen, m-rna vorhanden; wird gesucht und zerstört (nur Hemmung möglich) Regulation durch Transkriptionsfaktoren = transkriptional, d h Regulation erfolgt früher bereits auf der Ebene der Transkription; Enhancer beschleunigen die Transkription, Silencer hemmen sie (beides möglich) Mutationen (Seite 51) A1 Begründen Sie, warum nicht alle Mutationen zum Nachteil des Trägers sein müssen Zum einen führen nicht alle Mutationen zu einer Veränderung in der Struktur der Proteine, da z B eine Basensubstitution aufgrund der Redundanz des genetischen Codes keine Auswirkungen auf die Aminosäuresequenz haben muss (stumme Mutation) Zum anderen sind Mutationen notwendig, um ein gewisses Maß an Variation der Erbsubstanz zu ermöglichen, denn Variationen der Gene können einer Spezies Überlebensvorteile verschaffen A2 Beschreiben Sie die Ursachen und Folgen der Sichelzellanämie Bei der Sichelzellanämie liegt aufgrund einer Missense-Mutation (Substitution einer Base) und demzufolge dem Austausch einer Aminosäure in der Peptidkette des ß-Globins ein verändertes Hämoglobin vor (HbS) Das Sichelzell-Hämoglobin bildet unter Sauerstoffmangel und nach Sauerstoffabgabe sogenannte Aggregate Die Erythrocyten nehmen dann eine sichelartige Form an, verklumpen in den Blutgefäßen und können so zu Verschlüssen/ Infarkten führen A3 Eine DNA-Sequenz im codogenen Strang sei gegeben: CGAAATAAGCTGTTC Fügen Sie willkürlich jeweils zwei verschiedene Punktmutationen sowie eine Insertion und eine Deletion ein und erläutern Sie die Auswirkungen auf die Aminosäuresequenz Nehmen Sie dabei die Codesonne zu Hilfe z B: codogener Strang ohne Mutation CGAAATAAGCTGTCC m-rna GCUUUAUUCGACAGG AS-Sequenz Ala Leu Phe Asp Arg Basenaustausch CGATATAAGCTGTCC m-rna GCUAUAUUCGACAGG AS-Sequenz Ala Ile Phe Asp Arg weitere individuelle Lösungen A4 Erläutern Sie die Ursachen für die veränderte Aminosäuresequenz bei der b-globin-kette (Abb 4) Nach dem 7 Basentriplett in der abgebildeten Basensequenz kommt es zu einer zweifachen Deletion es fehlen im 8 Triplett zwei Thyminbasen Es kommt zu einer Verschiebung des Leserasters ab der Frameshift-Mutation und somit zur Veränderung der Aminosäuresequenz Material: Mondscheinkinder und schädliche UV-Strahlung (Seite 52/53) A1 Erläutern Sie, welche Maßnahmen zum Lichtschutz bei einem XP-Patienten noch sinnvoll sein könnten Tragen von langer Kleidung, die die sonnenexponierten Hautregionen komplett abdeckt und Tragen einer Sonnenbrille getönte Fensterscheiben oder UV-abweisende Schutzfolie an Fenstern von Haus und Auto Sonnencremes mit sehr hohem Lichtschutzfaktor (LSF 6) A2 Vergleichen Sie die Wahrscheinlichkeit, an Hautkrebs zu erkranken, bei XP-Patienten und Menschen ohne dieses Krankheitsbild (Abb 2) Die Untersuchungsergebnisse zeigen eine signifikante (fast exponentielle) Zunahme der Hautkrebswahrscheinlichkeit erst ab einem Alter von etwa 4 bis 5 Jahren bei Menschen ohne XP Die Ursache für Hautkrebs sind Mutationen, die vom Reparatursystem nicht behoben werden Im Allgemeinen ist mehr als eine Mutation nötig, um alle Veränderungen herbeizuführen, die eine Krebszelle charakterisieren Je älter man wird, desto mehr Mutationen häufen sich an und desto höher wird die Wahrscheinlichkeit für Hautkrebs Bei XP-Patienten ist dieses Risiko bereits von Geburt an sehr hoch, da UV-Licht-induzierte DNA- Schäden nicht repariert werden können Ab einem Alter von 2 Jahren bleibt das Risiko nahezu gleich bei 1 %, da die irreversiblen Schäden in den Hautzellen sich kontinuierlich anhäufen 14 Genetik

15 A3 Formulieren Sie eine Hypothese über die Auswirkungen der Dimerbildung auf die DNA-Replikation Thymin-Dimere führen zu einer Verformung der DNA, sodass die DNA-Polymerase die DNA an dieser Stelle nicht mehr passieren kann Die Replikation der DNA setzt daher aus und der gebildete Tochterstrang enthält entsprechend weniger Basen als der Mutterstrang A4 Nennen Sie das dem Reparatursystem der DNA zugrunde liegende Prinzip Spezielle Enzyme erkennen Schäden in der DNA und können die schadhaften Stellen herausschneiden Die Lücken werden nach dem Prinzip der komplementären Basenpaarung dann mit den entsprechenden Basen wieder aufgefüllt Eine andere Möglichkeit ist die Spaltung der Thymin-Dimere in Einzelbausteine, die wieder zur komplementären Basenpaarung fähig sind A5 Erläutern Sie die Bedeutung von Reparaturmechanismen für den Organismus im Allgemeinen und die Excisionsreparatur im Besonderen DNA-Reparaturmechanismen sind enzymatisch gesteuerte Prozesse, die Schäden der DNA beseitigen und dadurch den reibungslosen Ablauf der Replikation und Transkription gewährleis ten Sie sind dafür verantwortlich, dass sich Mutationen im Erbgut nicht anhäufen können Die Exzisionsreparatur erfolgt in Fällen, in denen falsche Basen eingebaut werden Die modifizierten Basen müssen entfernt und anschließend ersetzt werden Diese Stellen werden von speziellen Endonucleasen erkannt und zusammen mit benachbarten Nucleotiden herausgeschnitten, sodass eine ca 1 Basen lange Lücke entsteht, die durch die DNA-Polymerase I aufgefüllt und von der DNA-Ligase wieder geschlossen wird Der nicht betroffene Strang dient dabei als Matrize A6 Beschreiben und erklären Sie die in Abb 7 dargestellten Versuchsergebnisse Die Versuche zeigen die Überlebensfähigkeit von E coli-zellen (Anteil lebender Zellen nach UV-Bestrahlung) in Abhängigkeit von der Strahlendosis Dabei erwies sich, dass der Wildtyp Bestrahlungen überlebt und der Anteil an lebenden Zellen erst ab einer vergleichsweise hohen Dosis sinkt Die UV-sensiblen Mutanten (uvr- und RecA-Mutante) dagegen reagieren äußerst empfindlich; der Anteil an lebenden Zellen geht bereits bei niedrigen Strahlendosen stark zurück, wobei die Entwicklung bei der RecA-Mutante noch deutlicher ist Uvr und RecA sind Reparatursysteme, die UV-induzierte Fehler in der Basensequenz der DNA erkennen und reparieren Bei den UV-sensiblen uvr-mutanten kam es vermutlich zu einer Mutation in den uvr- Genen kommen, die für verschiedene Untereinheiten einer Endonuclease codieren Diese kann daraufhin ihre Funktion, die DNA auf Fehler und Schäden zu kontrollieren, nicht mehr ausüben Die sich dadurch anhäufenden Schäden führen zu einem Absterben der Zellen Beim Wildtyp dagegen greifen die Reparatursysteme und so können die Zellen eine relativ hohe Strahlendosis tolerieren A7 Erläutern Sie die Aussage: Die Haut vergisst nichts Die Haut vergisst nichts, schon gar nicht einen Sonnenbrand Oberflächlich betrachtet sieht es zwar aus, als hätte sich die Haut nach einem ausgeheilten Sonnenbrand erholt Aber tief im Innern der Zellen der Ober- und Lederhaut zeigt sich, dass der Schaden, den die UV-Strahlung in der DNA angerichtet hat, unwiderruflich ist Wiederholen sich die Sonnenbrände und die Wirkung lang anhaltender und intensiver Sonnenstrahlung häufiger, kumulieren und festigen sich die Schäden in den Hautzellen, da das zelleigene Reparatursystem nicht alle Schäden beheben kann Die Folge ist im besten Fall vorzeitige Hautalterung im schlimmsten Fall jedoch Hautkrebs A8 Beschreiben Sie die Entwicklung der Krebsneuerkrankungen (Abb 9) und stellen Sie Hypothesen über mögliche Ursachen auf Die Zahl der Neuerkrankungen beim Schwarzen Hautkrebs ist in Deutschland im dem angegebenen Zeitraum von 23 bis 21 signifikant gestiegen (bei Frauen um ca 2, bei Männern in etwa um 3 Fälle) Bis 27 gab es bei Frauen deutlich mehr neue Fälle von Hautkrebs, seit 28 überwiegt jedoch deren Anteil bei den Männern Die Zunahme an Neuerkrankungen ist dabei unabhängig vom Geschlecht seit 27 besonders gravierend Als mögliche Ursachen für den starken Anstieg sind folgendes Aspekte denkbar: starke und häufige Sonnenbrände in der Kindheit und Jugend mangelnde Sorgfalt beim Sonnenschutz häufiger und regelmäßiger Besuch von Sonnenbänken und Solarien, vor allem wenn die zulässigen Grenzwerte für die UV-Strahlung überschritten werden Alterung der Gesellschaft (viele Fälle von Schwarzem Hautkrebs treten erst im Alter auf) kontinuierliche Belastung durch UV-Strahlung in Berufsgruppen mit nahezu ausschließlicher Außentätigkeit (zb Landwirtschaft, Seefahrt, Fischerei, Straßenbau) verändertes Freizeitverhalten/ größere Mobilität: Urlaube werden ganzjährig in sonnenintensiven Regionen verbracht 15 Genetik

16 A9 Begründen Sie, warum das Maligne Melanom häufig tödlich verläuft Ein Malignes Melanom der Haut, auch Schwarzer Hautkrebs genannt, ist ein bösartiger (maligner) Tumor, der aus Pigmentzellen der Haut entsteht Diese Zellen entarten und wuchern unkontrolliert Das Maligne Melanom ist eine der gefährlichsten Krebsarten überhaupt, da es trotz einer relativ geringen Größe bereits frühzeitig Tochtergeschwülste (Metastasen) in Lymphknoten sowie anderen Organen bilden kann Proteom und Proteomforschung (Seite 54/55) A1 Beschreiben Sie die verschiedenen Möglichkeiten der Veränderung des Proteoms im Laufe der Entwicklung eines Organismus Neben unterschiedlichen Aktivitätsmustern von Genen durch Aktivierung oder Stilllegung in Form von Methylierungen oder Acetylierungen (oder Demethylierungen bzw Deacetylierungen), kommt es zu Veränderungen der m-rna durch alternatives Spleißen und zu Veränderungen der Polypeptide nach der Translation Dabei können sich bestimmte Modifikationen in der Tertiärstruktur und komplexe chemische Bearbeitungen vollziehen, z B Bildung von Glykoproteinen (Ausbildung von Signalstrukturen) oder Phosphorylierungen bzw die Bindung an größere Moleküle A2 Beschreiben Sie die genauen Arbeitsabläufe bei der Proteomanalyse Zunächst werden aus Patientenproben, wie Gewebe oder Blut, Proteine extrahiert und das Proteingemisch mit einer 2D-Gelelektrophorese aufgetrennt In einem speziellen Kunststoffgel erfolgt die Auftrennung nach Lage und Größe (in zwei Richtungen) Es entsteht eine Proteomkarte, ein Muster von Flecken, das sowohl Art als auch Menge der vorhandenen Proteine wiedergibt Ein Fleck wird dann aus dem Gel herausgeschnitten und durch Proteasen zerschnitten, sodass unterschiedliche große Proteinbruchstücke entstehen, die für das jeweilige Protein spezifisch sind Mithilfe der Massenspektrometrie lässt sich das Gewicht der einzelnen im Gemisch der Probe enthaltenen Proteine feststellen und jedes Protein eindeutig identifizieren A3 Auch schon seit langem bekannte genetische Erkrankungen, wie z B das Down-Syndrom, sind Gegenstand der Proteomforschung Stellen Sie eine begründete Hypothese darüber auf, wie sich die Trisomie 21 auf das Proteom der Betroffenen auswirken könnte Da bei der Trisomie 21 das Chromosom 21 dreimal vorhanden ist, sollten auch die Proteine, die durch die Gene auf diesem Chromosom codiert werden, vermehrt auftreten Welche Proteine das sind und in welchen Zellen sie exprimiert werden, könnte Rückschlüsse auf das konkrete Krankheitsbild und den Grad der Down-Syndrom-Erkrankung geben 16 Genetik

17 1 3 Humangenetik Befruchtung und Meiose (Seite 57) A1 Nennen Sie Gemeinsamkeiten und Unterschiede bei der Bildung weiblicher und männlicher Keimzellen männlich: Durch die Meiose entstehen vier gleich große, aber genetisch neu kombinierte Spermazellen Sie differenzieren sich zu Spermien (Spermienkopf mit Akrosom, Mittelstück, Schwanzfaden) weiblich: Durch die Meiose entsteht eine Eizelle, kleine Polkörperchen werden jeweils nach der Meiose I und II abgeschnürt Die Eizelle bildet mit verschiedenen Hilfszellen und Hüllen das Ei Die Meiose II wird erst nach dem Eindringen des Spermiums abgeschlossen A2 Stellen Sie die Vorgänge bei Mitose und Meiose in Form einer Tabelle einander gegenüber Mitose: in teilungsfähigen Körperzellen (2n, 4C) dauert höchstens einige Stunden gegliedert in Prophase Metaphase Anaphase Telophase Anaphase: Trennung der Chromatiden am Centromer Anzahl der Chromosomensätze bleibt gleich, DNA-Menge wird halbiert Tochterzellen sind genetisch gleich (2n, 2C) und ähnlich groß Meiose: in den Urkeimzellen der männlichen und weiblichen Keimdrüsen (2n, 4C) dauert einige Tage, Wochen oder Jahre, besteht aus zwei Teilungsschritten (Meiose I und Meiose II) Prophase I (sehr lang) Metaphase I Anaphase I Telophase I und Interkinese Prophase II Metaphase II Anaphase II Telophase II Prophase I: Paarung der homologen Chromosomen und Stückaustausch (Rekombination) Anaphase I: Trennung der homologen Chromosomen (1n, 2C) und anschließend zufallsgemäße Verteilung auf die Pole (Rekombination) Anaphase II: Trennung der Chromatiden am Centromer (1n, 1C) Es entstehen genetisch neu kombinierte Tochterzellen Chromosomenmutationen (Seite 59) A1 Beschreiben Sie die Ursachen von Monosomien und Trisomien Monosomie und Trisomie sind die Folge einer Nondisjunction bei einem diploiden Organismus während der ersten oder zweiten Teilung der Meiose, d h einer Nicht-Trennung eines homologen Chromosomenpaares mit der Folge, dass beide zu demselben Spindelpol wandern Durch diesen Verteilungsfehler entstehen Gameten mit einem überzähligen und einem fehlenden Chromosom (Genommutation) Nondisjunction in der 1 meiotischen Teilung Nondisjunction in der 2 meiotischen Teilung erste meiotische Teilung Spermium zweite meiotische Teilung Gameten Befruchtung Zygote Trisomie Monosomie Trisomie 17 Genetik

18 A2 Eine Trisomie kann auf eine Nondisjunction in der Meiose I zurückgehen Entwerfen Sie analog zur Randspaltenabbildung (s Seite 58) ein Schema siehe Abbildung Mukoviszidose eine erblich bedingte Krankheit (Seite 6) A1 Ermitteln Sie anhand von Abb 1 die Art des genetischen Defekts Bei dem vorliegenden genetischen Defekts (hier der sogenannte delta F58) handelt es sich um eine Mutation Es fehlen drei Basen, was zum Fehlen der Aminosäure Phenylalanin führt (Deletion) Anders als bei Deletionen, bei denen nur eine Base fehlt, wird das nachfolgende Leseraster jedoch nicht verändert, da eine komplette Aminosäure ausfällt A2 Ermitteln Sie anhand von Abb 2, wie die in Abb 1 dargestellte Mutation des CFTR-Gens das Membrankanalprotein verändert und welche physiologischen Ursachen der Entstehung des zähen Schleims zugrunde liegen Durch das Fehlen der Aminosäure Phenylalanin ist zu vermuten, dass sich die Struktur des Proteins stark ändern wird Die Tertiärstruktur wird sich insoweit ändern, dass es zu anderen Wechselwirkungen zwischen den Aminosäuren kommt Damit wird das Membrankanalprotein in seiner Funktion stark beeinträchtigt oder verliert seine Funktion, das Chlorid aus dem Zellinneren herauszupumpen Dieser Transportmechanismus sorgt im Normalfall für eine erhöhte Chloridkonzentration an der Oberfläche der Schleimhäute Wasser kann durch Diffusion die Zellmembran passieren Da die Chloridkonzentration an der Oberfläche dann größer ist als im Zellinneren, wird mehr Wasser aus der Zelle austreten als in die Zelle eindringen So wird der zähflüssige Schleim verdünnt Ist das CFTR-Kanalprotein bedingt durch die beschriebene Mutation in seiner Funktion beeinträchtigt, laufen die osmotischen Prozesse nicht mehr ab Der Schleim bleibt zäh Stammbaumanalyse (Seite 61) A1 Erklären Sie den Begriff Hemizygotie an einem Beispiel Bei Hemizygotie ist bei einem diploiden Individuum das Allel für die Blutgerinnungsstörung (Hämophilie ) nur einmal vorhanden, da dieses Allel auf dem X-Chromosom liegt und auf dem Y-Chromosom fehlt Daher prägt sich ein Allel, das geschlechtsgebunden über das X-Chromosom vererbt wird, bei männlichen Individuen phänotypisch aus 18 Genetik

19 Material: Stammbaumanalyse (Seite 62) A1 Leiten Sei ab, was man unter polygenetisch vererbten Merkmalen versteht und recherchieren Sie Beispiele Bei der polygenen Vererbung wirken mehrere verschiedene Gene zur Ausbildung eines Merkmals zusammen Beispiele dafür sind: Körpergröße, Gewicht, Pigmentierung (Haarfarbe, Hautfarbe, Fellfarbe bei Tieren) und mehrere Krankheiten (Asthma, Bluthochdruck) A2 Erklären Sie, warum ein Elternpaar, das Merkmalsträger ist, ein Kind mit anderem Phänotyp bekommen kann Jedes Elternteil besitzt zwei Allele, die für die Ausbildung des Merkmals verantwortlich sind Wenn das Allel für ein bestimmtes Merkmal dominant ist, können die Elternteile bei gleichem Phänotyp jeweils ein rezessives Allel besitzen Die Eltern wären dann heterozygot Erbt das Kind von jedem Elternteil jeweils das rezessive Allel, bildet sich ein anderes Merkmal aus A3 Analysieren Sie mithilfe der Kriterien aus Abb 1 den Stammbaum für erbliche Kurzfingrigkeit und Rot-Grün-Sehschwäche Erbliche Kurzfingrigkeit: Es handelt sich um einen autosomal-dominanten Erbgang Kranke Eltern haben gesunde Kinder, Auftreten des Merkmals in jeder Generation, mindestens ein Elternteil ist Merkmalsträger Ein X-chromosomal-dominanter Erbgang ist auszuschließen, da in diesem Stammbaum kranke Väter auch kranke Söhne haben (Väter geben jedoch das unbetroffene Y-Chromosom an ihre Söhne weiter) Rot-Grün-Sehschwäche: Es handelt sich um einen X-chromosomal-rezessiven Erbgang Das Merkmal tritt nicht in jeder Generation auf, merkmalsfreie Eltern haben phänotypisch betroffene Kinder Alle Merkmalsträger sind männlich, aufgrund der Hemizygotie prägt sich ein mutiertes Gen auf einem X-Chromosom phänotypisch aus Material: Angewandte Stammbaumanalyse (Seite 63) A1 Analysieren Sie den Stammbaum in Abb 1 hinsichtlich des vorliegenden Vererbungsmodus und bestimmen Sie die Genotypen der einzelnen Personen Der Stammbaum in Abb 1 zeigt den Erbgang zweier Merkmale (Rot-Grün-Blindheit und Hämophilie), die über mehrere Generationen bei den dargestellten Personen in unterschiedlicher Weise auftreten Beide Merkmale werden gemeinsam X-chromosomal-rezessiv vererbt: Ein dominanter Erbgang lässt sich an Elternpaar 6 und 7 ausschließen: Um ein krankes Kind zu bekommen, müssten beide Elternteile heterozygot oder ein Elternteil homozygot für die betreffenden Merkmale sein Dies ist nicht der Fall Phänotypisch gesunde Eltern haben einen erkrankten Sohn (Pers 4/5 mit Söhnen 5 und 7) Da die Mutter Konduktorin ist und sie für beide Merkmale rezessiv ist, gibt sie das betroffene X-Chromosom an ihre Söhne weiter Diese prägen die Merkmale aufgrund der Hemizygotie phänotypisch aus An Rot-Grün-Blindheit und Hämophilie leidende Töchter tauchen in diesem Stammbaum nicht auf; lediglich Konduktorinnen, die in Bezug auf die Merkmale heterozygot, aber phänotypisch gesund sind Legende für Genotypen: X = Allel für Farbensehen / Blutgerinnung, X rh = Allel für Rot-Grün-Blindheit/ Hämophilie Personen und ihre Genotypen Generation I 1: X rh Y 2: XX Generation II 1: X rh X 2: X rh Y 3: XY 4: XY 5: X rh X 6: XY 7: X rh X 8:X Y 9: X rh X Generation III 1: X rh Y 2:XY 3: X rh Y 4: X rh Y 5: X rh Y 6: XY 7: X rh Y 8: XX 9: X rh Y 1: XY 11: XX 12: XX A2 Ordnen Sie dem vorliegenden Erbgang dem entsprechenden Chromosom in Abb 2 zu und begründen Sie Ihre Entscheidung Die beiden Merkmale (Rot-Grün-Blindheit und Hämophilie) werden in dem vorliegenden Stammbaum gemeinsam (gekoppelt) vererbt, da beide Gene an unterschiedlichen Orten auf dem X-Chromosom liegen Dies entspricht dem einfachen Chromosom in Abb 2 Alle phänotypisch kranken Söhne von Konduktorinnen, die das betreffende X-Chromosom an ihre Söhne weitergeben, erhalten jeweils beide Gene 19 Genetik

20 A3 Untersuchen Sie den Stammbaum in Abb 3 Stellen Sie eine Vermutung an, welcher Vererbungsmodus des Nagel-Patella-Syndroms vorliegt und begründen Sie Ihre Entscheidung hinreichend Das Nagel-Patella-Syndrom folgt einem autosomal-dominanten Erbgang Das Merkmal tritt in jeder Generation und bei Frauen und Männern gleichermaßen auf Mindestens ein Elternteil ist krank (hetero- oder homozygot für das Merkmal) Aus einer Verbindung mit einem phänotypisch kranken Partner gehen auch gesunde Kinder hervor Dass kranke Väter (Pers 5 und 8 ) gesunde Töchter (19 und 21) haben, schließt einen X-chromosomalen Erbgang aus, da die Mütter jeweils homozygot gesund sind und die Väter in jedem Fall das X-Chromosom mit dem mutierten Gen an ihre Töchter weitergeben A4 Erklären Sie mithilfe der Abb 3 das gleichzeitige Auftreten des Nagel-Patella-Syndroms mit bestimmten Blutgruppenmerkmalen und stellen Sie eine begründete Hypothese über die Fälle auf, bei denen es zu Abweichungen kommt (Personen 7, 1 und 16) Bis auf die Abweichung bei den Personen 7, 1 und 16 tritt das Gen für das Nagel-Patella- Syndrom bei allen Erkrankten immer in Verbindung mit der Blutgruppe B auf, die Gene für Blutgruppe B und das Syndrom sind gekoppelt Alle merkmalsfreien Söhne und Töchter des Paares 1 und 2 haben die Blutgruppe Bei den Personen 7, 1 und 16 treten abweichend davon andere Merkmalskombinationen auf Person 7 und 16 haben Blutgruppe B, sind jedoch nicht vom Nagel-Patella-Syndrom betroffen Person 1 ist in Bezug auf diese Krankheit Merkmalsträger, aber hat die Blutgruppe Das bedeutet, dass die Kopplung der Gene aufgehoben wurde und sich die Gene unabhängig voneinander vererbt haben A5 Erläutern Sie in Bezug auf Abb 2, inwiefern sich die Fälle der Personen 7, 1 und 16 mit den Vorgängen während der Meiose I erklären lassen können Person 1 mit Blutgruppe und dem Nagel-Patella-Syndrom lässt sich damit erklären, dass die zwei Gene durch Crossingover (Stückaustausch zwischen homologen Chromosomen, s Abb 2) auf zwei verschiedenen Chromosomen zu liegen kommen In der ersten Reifeteilung werden die beiden betreffenden Chromosomen voneinander getrennt und so die Blutgruppe B nicht an Person 1 (mit Blutgruppe und Syndrom) vererbt Ähnliche Prozesse der interchromosomalen Rekombination liegen auch bei den Personen 7 und 16 vor Es kommt also zu einem Kopplungsbruch und einer Neukombination der Gene Molekulargenetische Verfahren Elektrophorese und Sequenzierung (Seite 65) A1 Geben Sie die entstehenden DNA-Fragmente im zweiten Ansatz von Abb 4 an Möglich sind die folgenden Fragmente: GATG, GATGTAATCG oder GATGTAATCGA (falls kein ddgtp eingebaut wurde) Hochdurchsatzsequenzierung (Seite 67) A1 Erklären Sie, weshalb bei der Sequenzierung mit der Fluoreszenzmarkierung in Abb 1 der Detektor nicht am Gel entlang geführt werden muss Die markierten Fragmente wandern durch das Gel und kommen nacheinander am Detektor vorbei A2 Fassen Sie die Veränderung der DNA-Analyse seit Sanger kurz zusammen und erläutern Sie die Bedeutung dieser technischen Entwicklung Die Entwicklung der DNA-Analyse geht bei den verschiedenen Generationen zu einer stärkeren Automatisierung, die durch die Fluoreszenzmarkierung und Detektoren ermöglicht wird Die Aufarbeitung der DNA-Fragmente wurde standardisiert und dadurch schneller Die Nachweisverfahren kommen gleichzeitig mit geringen Basenzahlen aus, sodass die Vervielfältigung der DNA vor der Analyse entfällt Genomik die Analyse des Genoms (Seite 69) A1 Beschreiben und erklären Sie den Ablauf der Untersuchung zur Genexpression anhand von Abb 2 und anhand des Textes Die Untersuchung der Genexpression erfolgt über Microarrays Hier sind gezielt einsträngige DNA-Fragmente als Sonden aufgebracht, die gezielt DNA-Abschnitte (Genabschnitte) binden Mithilfe von Fluoreszenzmarkern werden gebundene Abschnitte sichtbar gemacht Gene werden mithilfe von m-rna (welche einem Genabschnitt entspricht) und dem Enzym Reverse Transkriptase in c-dna umgewandelt und danach untersucht 2 Genetik

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

Kapitel 8 Ò Chromosomen und Genregulation

Kapitel 8 Ò Chromosomen und Genregulation Kapitel 8 Ò Chromosomen und Genregulation 8.1 Struktur eukaryontischer Chromosomen Ein menschlicher Zellkern ist nur zehn Mikrometer gross und (10-9 ) hat zwei Meter DNA drin. Damit es da kein Durcheinander

Mehr

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht

Mehr

Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

1. Welche Auswirkungen auf die Expression des lac-operons haben die folgenden Mutationen:

1. Welche Auswirkungen auf die Expression des lac-operons haben die folgenden Mutationen: Übung 10 1. Welche Auswirkungen auf die Expression des lac-operons haben die folgenden Mutationen: a. Eine Mutation, die zur Expression eines Repressors führt, der nicht mehr an den Operator binden kann.

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.)

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.) Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen Die verschiedenen Ribosomen-Komplexe können im Elektronenmikroskop beobachtet werden Durch Röntgenkristallographie wurden

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

7. Regulation der Genexpression

7. Regulation der Genexpression 7. Regulation der Genexpression 7.1 Regulation der Enzymaktivität Stoffwechselreaktionen können durch Kontrolle der Aktivität der Enzyme, die diese Reaktionen katalysieren, reguliert werden Feedback-Hemmung

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4 S 4 M 2 Studien an eineiigen Zwillingen Was ist für die Unterschiede bei eineiigen Zwillingen verantwortlich? Aufgaben 1. Fassen Sie die Informationen des Textes zusammen. 2. Wie sind die im Text beschriebenen

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

Praktikum Biochemie B.Sc. Water Science WS Enzymregulation. Marinja Niggemann, Denise Schäfer

Praktikum Biochemie B.Sc. Water Science WS Enzymregulation. Marinja Niggemann, Denise Schäfer Praktikum Biochemie B.Sc. Water Science WS 2011 Enzymregulation Marinja Niggemann, Denise Schäfer Regulatorische Strategien 1. Allosterische Wechselwirkung 2. Proteolytische Aktivierung 3. Kovalente Modifikation

Mehr

Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio

Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio Ein Wissenschaftler erhält nach einer Sequenzierung folgenden Ausschnitt aus einer DNA-Sequenz: 5 ctaccatcaa tccggtaggt tttccggctg

Mehr

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist.

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist. Die Prüfungsarbeit besteht aus drei zu bearbeitenden Teilen Aufgabe I Aufgabe II A oder II B Aufgabe III A oder III B I Aufgabe I: Humangenetik / klassische Genetik / Molekulargenetik Mukoviszidose Mukoviszidose,

Mehr

6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/lsd1-weist-stammzellen-immausembryo-den-richtigen-weg/ Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Die

Mehr

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name Starzinski-Powitz, 6 Fragen, 53 Punkte Name Frage 1 8 Punkte Nennen Sie 2 Möglichkeiten, wie der Verlust von Heterozygotie bei Tumorsuppressorgenen (Z.B. dem Retinoblastomgen) zum klompletten Funktionsverlust

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende

Mehr

Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese

Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese Station 1 Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese 1 I. Vorinformationen An der GSI wurde eine weltweit neuartige Krebstherapie mit Ionenstrahlen entwickelt. Dazu werden in

Mehr

...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-...

...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-... 1. Im Enzym Xase, das aus einer Polypeptidkette aus 300 Aminosäuren besteht, findet sich in der Region der Aminosäuren 40-50 die folgende Aminosäurensequenz:...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-...

Mehr

Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung

Mehr

Inhaltsverzeichnis. 1. Lebensformen: Zellen mit und ohne Kern... 3. 2. DNA: Träger der genetischen Information... 9

Inhaltsverzeichnis. 1. Lebensformen: Zellen mit und ohne Kern... 3. 2. DNA: Träger der genetischen Information... 9 Vorwort IX Teil I Grundlagen 1. Lebensformen: Zellen mit und ohne Kern... 3 Eukaryoten... 4 Prokaryoten... 6 Literatur... 8 2. DNA: Träger der genetischen Information... 9 Bausteine: Nucleotide... 10 Doppelhelix...

Mehr

Posttranskriptionale RNA-Prozessierung

Posttranskriptionale RNA-Prozessierung Posttranskriptionale RNA-Prozessierung Spaltung + Modifikation G Q Spleissen + Editing U UUU Prozessierung einer prä-trna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

1. Definition und Mechanismen

1. Definition und Mechanismen Zusammenfassung 1. Definition und Mechanismen Epigenetik (von griechisch epi- über ) bezeichnet erbliche Veränderungen in der Genexpression, die nicht von Veränderungen in der DNA Sequenz (Mutationen)

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 2 (06.06. 10.06.) DNA-Schäden, Mutationen und Reparatur 1.

Mehr

Die molekulare BDV. Inhalt

Die molekulare BDV. Inhalt Die molekulare BDV Biochemie Inhalt BDV = Biologische Datenverabeitung Informationen in lebenden Systemen Die Entschlüsselung des genetischen Codes Der genetische Code ist degeneriert 1 Die Weitergabe

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli.

Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli. Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli. zirkuläres bakterielles Chromosom Replikation (Erstellung einer identischen Kopie des genetischen Materials) MPM 1 DNA-Polymerasen

Mehr

Aufgabe 2: (Aminosäuren)

Aufgabe 2: (Aminosäuren) Aufgabe 2: (Aminosäuren) Aufgabenstellung Die 20 Aminosäuren (voller Name, 1- und 3-Buchstaben-Code) sollen identifiziert und mit RasMol grafisch dargestellt werden. Dann sollen die AS sinnvoll nach ihren

Mehr

Einstieg: Fortpflanzung

Einstieg: Fortpflanzung Einstieg: Fortpflanzung Wozu ist Sex gut? - Nachkommen werden gezeugt --> Erhalt der Spezies. - Es entstehen Nachkommen mit Merkmalen (z.b. Aussehen), die denen von Vater und Mutter ähneln. Beide Eltern

Mehr

Zellzyklus, Replikation und Chromosomen

Zellzyklus, Replikation und Chromosomen Zellzyklus, Replikation und Chromosomen Wiederholung: Größenverhältnisse im DNA-Molekül 3 5 Das größte menschliche Chromosom enthält 247 Millionen Basenpaare Moleküllänge: 8.4 cm Die Länge des gesamten

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1 Variabilität von Antikörpern 1 Rezeptoren bzw. Antikörper eines noch undifferenzierten B-Lymphocyten: a) Schreiben Sie die Anzahl der variablen Exons je Chromosom auf. b) Berechnen Sie die mögliche Anzahl

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

erläutern Eigenschaften des genetischen Codes und charakterisieren mit dessen Hilfe Experimentelle Entschlüsselung (SF)

erläutern Eigenschaften des genetischen Codes und charakterisieren mit dessen Hilfe Experimentelle Entschlüsselung (SF) Schulinterner Kernlehrplan Biologie Q1 : Genetik Inhaltsfelder Schwerpunkt Basiskonzept Konkretisierte Kompetenzen 1.1 Vom Gen zum Genprodukt Wiederholung - DNA und Replikation Aufgaben DNA und Replikation

Mehr

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden.

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden. 03 Arbeitsauftrag Arbeitsauftrag Ziel: Anhand des Foliensatzes soll die Bildung und der Aufbau des Proteinhormons Insulin erklärt werden. Danach soll kurz erklärt werden, wie man künstlich Insulin herstellt.

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen Chemie für Biologen Vorlesung im WS 004/05 V, Mi 0-, S04 T0 A0 Paul Rademacher Institut für rganische Chemie der Universität Duisburg-Essen (Teil 3: 9.0.005) MILESS: Chemie für Biologen 36 D-Aldosen C

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler

Mehr

Zusammenfassung Biologie Molekulargenetik

Zusammenfassung Biologie Molekulargenetik die Versuche von Griffith und Avery beschreiben und interpretieren können Gemeinsamkeit der Proteine und Nukleinsäuren: langkettige, unverzweigte Moleküle Bakterium: Streptococcus pneumoniae (S-Zellen

Mehr

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide O:/Wiley/Reihe_verdammt_klever/Fletcher/3d/c01.3d from 15.08.2013 17:16:38 1 Molekulargenetik 1 In diesem Kapitel geht es um diese Themen: DNA-Struktur Gene Der genetische Code Von der DNA zum Protein

Mehr

Inhalt Genexpression Microarrays E-Northern

Inhalt Genexpression Microarrays E-Northern Inhalt Genexpression Microarrays E-Northern Genexpression Übersicht Definition Proteinbiosynthese Ablauf Transkription Translation Transport Expressionskontrolle Genexpression: Definition Realisierung

Mehr

1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli:

1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli: 1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli: Übung 7 - DnaA bindet an 13 bp DNA Sequenz (DnaA Box, 5 Wiederholungen bei E. coli) im oric ori wird in AT reicher

Mehr

KV: Genexpression und Transkription Michael Altmann

KV: Genexpression und Transkription Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Genexpression und Transkription Michael Altmann Herbstsemester 2008/2009 Übersicht VL Genexpression / Transkription 1.) Was ist ein Gen? 2.) Welche Arten

Mehr

Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Genregulation bei Eukaryoten II

Genregulation bei Eukaryoten II Genregulation bei Eukaryoten II Aktivierung und Repression der Transkription erfolgen durch Protein-Protein-Wechselwirkungen Protein-Protein-Wechselwirkungen spielen bei der Genregulation der Eukaryoten

Mehr

Biochemie Vorlesung Die ersten 100 Seiten

Biochemie Vorlesung Die ersten 100 Seiten Biochemie Vorlesung 11-15 Die ersten 100 Seiten 1. Unterschiede der Zellen Eukaryoten- Prokaryoten Eukaryoten: - Keine Zellwand - Intrazelluläre Membransysteme - Kernhülle mit 2 Membranen und Kernporen

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Träger der Erbinformation sind die Nukleinsäuren. Es handelt sich hierbei um hochmolekulare lineare Kettenmoleküle, die aus durch

Träger der Erbinformation sind die Nukleinsäuren. Es handelt sich hierbei um hochmolekulare lineare Kettenmoleküle, die aus durch Achtung Die folgenden Texte sind als Stichworte für die Klausurvorbereitung zu sehen. Keinesfalls sind die Fragen in der Klausur auf den Inhalt dieser Folien beschränkt, sondern werden aus dem Stoff der

Mehr

Genetik für Ahnungslose

Genetik für Ahnungslose Genetik für Ahnungslose Eine Einstiegshilfe für Studierende von Michaela Aubele Mit 50 Abbildungen, 29 Tabellen S. Hirzel Verlag Stuttgart VII Inhalt Vorwort V 1 Die kleinste Einheit des Lebens - die Zelle

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz 1. Nennen Sie die verschiedenen RNA-Typen, die bei der Translation wichtig sind. Erklären Sie die Funktion der verschiedenen RNA-Typen. Skizzieren Sie die Struktur der verschiedenen RNA-Typen und bezeichnen

Mehr

Aminosäuren - Proteine

Aminosäuren - Proteine Aminosäuren - Proteine ÜBERBLICK D.Pflumm KSR / MSE Aminosäuren Überblick Allgemeine Formel für das Grundgerüst einer Aminosäure Carboxylgruppe: R-COOH O Aminogruppe: R-NH 2 einzelnes C-Atom (α-c-atom)

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

05_10_Genes_info.jpg

05_10_Genes_info.jpg Übertragung der Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2 Molecular Biology of the

Mehr

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt 1. Einleitung 2. RNA-Viren 3. DNA-Viren 1. Einleitung Im folgenden werden einige für die Genetik bedeutungsvolle Viren vorgestellt.

Mehr

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle RNAs Eine neue RNA-Welt 1. Uralte RNA-Welt Am Anfang der Entstehung des Lebens Bekannte RNA-Welt Protein-Synthese Neue RNA-Welt Regulatorische RNA-Moleküle 2. Eine neue RNA-Welt die Anzahl der nicht-kodierenden

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Übung 8. 1. Zellkommunikation. Vorlesung Bio-Engineering Sommersemester 2008. Kapitel 4. 4

Übung 8. 1. Zellkommunikation. Vorlesung Bio-Engineering Sommersemester 2008. Kapitel 4. 4 Bitte schreiben Sie Ihre Antworten direkt auf das Übungsblatt. Falls Sie mehr Platz brauchen verweisen Sie auf Zusatzblätter. Vergessen Sie Ihren Namen nicht! Abgabe der Übung bis spätestens 05. 05. 08

Mehr

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen 9.1 Welche Funktionen haben Sinneszellen und Sinnesorgan? Sinneszellen nehmen die Reize auf und wandeln die Information in elektrische Signale um. Die Sinnesorgane dienen unter anderem dazu. Beispiel Auge

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Seminar zur Grundvorlesung Genetik

Seminar zur Grundvorlesung Genetik Seminar zur Grundvorlesung Genetik Wann? Gruppe B5: Donnerstags, 11 15-12 00 Wo? Raum 133 Teilnahme obligatorisch, max. 1x abwesend Kontaktdaten Marcel Quint Leibniz-Institut für Pflanzenbiochemie - Nachwuchsgruppe

Mehr

Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin

Mehr

Photochemische Wasserdesinfektion und -reinigung. Ein Vortrag von Janina Mamok und Olga Olfert

Photochemische Wasserdesinfektion und -reinigung. Ein Vortrag von Janina Mamok und Olga Olfert Photochemische Wasserdesinfektion und -reinigung Ein Vortrag von Janina Mamok und Olga Olfert Geschichtliches Reinigung von Wasser Desinfektion von Wasser -DNS - Replikation von DNS - Verhinderung der

Mehr