Dr. Peter Kainz Einführung in die Nucleinsäure-Biochemie Teil 2. III.Einführung in die Polymerase Chain Reaction (PCR)

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Dr. Peter Kainz Einführung in die Nucleinsäure-Biochemie Teil 2. III.Einführung in die Polymerase Chain Reaction (PCR)"

Transkript

1 Dr. Peter Kainz Einführung in die Nucleinsäure-Biochemie Teil 2 III.Einführung in die Polymerase Chain Reaction (PCR)

2 DI Praktikumsergebnisse SS 2009 Restriktionsverdau MI V MI N

3 DI Praktikumsergebnisse SS 2009 RNA-Verdau MI V MI N

4 RT-PCR for testing the reaction components ( )

5 Roche

6 Reaktionsparameter einer Standard-PCR I. Reaktionskomponenten 1. Primer 2. dntp s 3. Puffer 4. Enzyme 5. Template 6. Ölüberschichtung II. Zyklusbedingungen

7 I. Reaktionskomponenten 1. Primer Einerseits läßt sich über die Primer am wenigsten sagen, weil sie speziell für die gewünschte Applikation maßgeschneidert werden, andererseits entscheiden sie am meisten über das Gelingen der Amplifikation! So unvorhersehbar ihr Verhalten ist, gibt es doch einige Regeln, welche die Wahrscheinlichkeit des Gelingens erhöhen: A. Länge: normalerweise Basen T m Wert: wichtig, Cyclusbedingungen müssen darauf abgestimmt werden multiplex PCR: Verwendung von mehreren Primerpaaren: T m s sind abzustimmen! Häufig Diskrepanz zwischen verschiedenen T m -Berechnungen und der Realität, d. i. Ermittlung des T m Werts eines best. DNA Fragments unter PCR-Bedingungen! ( Die anerkannteste Methode ist die nearest-neighbour Methode: basiert darauf, daß die Schmelztemperatur nicht nur von der Basenzusammensetzung, sondern auch von der Sequenz des Oligos abhängt, weil sich benachbarte Basen gegenseitig beeinflussen.) B. Sequenz: Längere C- oder G- Abschnitte vermeiden, bes. im 3 -Bereich! Komplementarität im 3 -Bereich vermeiden (Problem: Primer-Dimerisierung) Keine internen Sekundärstrukturen wie Haarnadeln (hair pins) für kritische Amplifikationen ev. HPLC-gereinigte Primer verwenden. Primer bei 4 C oder in kl. Aliquots bei 20 C lagern ( in Eppi s mit dichtem Deckel!) C. Konzentration: üblich µmol L -1.

8 T M -Wert Bestimmung eines Oligonucleotids "Hot 4" - Melting Curve 0,9 0,85 OD 260 nm 0,8 0,75 0,7 0, C

9 Sometimes nature doesn t care for our algorithms Sequence (5 to 3 ) T m (calc.) T m (measured) T m (Oligo, version 6 ) + Strand of ds DNA fragment: Tm = (G+C)% /L Tm as calculated using nearest neighbour thermodynamic values A AGCGGATAACAATATCA B TTAACCCTCACTAAAG C AGTCAGTAGTAACCAG D CACCACAAACAGAAAC E AGCGGATAACAATATCACA E-1 ACGGATAACAATATCACA E-2 CGGATAACAATATCACA F CACCACAAACAGAAACAGAAC G CGGGAATTCTGGCTCTGC therefore the proof of the pudding is in the eating!

10 C. Mülhardt, Molekularbiologie

11 Medprobe, Oligo6, primer analysis software

12 2. dntp s Die Qualität der Nucleotide kann ebenfalls einen bedeutenden Einfluß auf das Gelingen haben. Deshalb am besten in Ultrapure-Qualität kaufen Konzentration: In Standard- Protokollen ist eine Konz. von 200µmol L -1 üblich. Dies reicht für die Synthese von etwa 13µg DNA in einem 50µl Ansatz ( praktisch natürlich nie erreichbar!) Sinnvoller Konz. Bereich µM. (Fehlerhäufigkeit der Taq-Pol. fällt mit sinkender Konzentration!) als 10 oder 100mM Stammlösungen kaufen, in Aliquots einfrieren, -20 C, mind. 1Jahr haltbar.

13 3. Puffer Tris oder Tricine/Bicine: ph/ Τ bei Tris sehr hoch ( pk a von 0.021/ C ), Gefahr von Depurinierungen und dadurch Strangbrüche bei höherer Temperatur! Deshalb wird statt des ursprünglichen ph 8.3 bei RT ein Tris-Puffer von ph 9.0 verwendet. Salze: KCl (Standard: 50mM) und (NH 4 ) 2 SO 4 (20mM). NaCl hemmt die Amplifikation! Pufferzusätze: z.b.dmso, Formamid, Glycerol senken T m Werte ( ca.3 C für 10%Gl.), DMSO (maximal 10%) und Formamid (max. 5%) destabilisieren zwar einigermaßen das Enzym, deren Zusätze können aber die Spezifität und die Amplifikation von GC-reichen Sequenzen erleichtern. Glycerol dagegen macht die Polymerase hitzestabiler! Eine fixe Regel, was man wann am besten verwendet gibt es nicht, ausprobieren bleibt einem nicht erspart. Magnesium-Konzentration:optimieren! beeinflusst Primer annealing, Denaturierungsverhalten,Bildung von Primer-Dimer Artefakten, Enzymaktivität und die Genauigkeit! sinnvoll: Zur Sicherheit 0.1mm EDTA im Ansatz zum Binden von Schwermetallionen Plus one Addition ( A-Überhang am 3 -Ende, Terminale Transferase Aktivität )bei höherer Mg Konz. verstärkt. Diese ist übrigens auch abhängig von der Sequenz der letzten fünf Basen des 5 - Endes des Matrizenstranges.

14 4. Enzyme Enzymwahl: 1. Pol mit Proofreading A. (aus Archaebakterien) 2. Pol ohne Proofreading Aktivität ( aus thermophilen Eubakterien ) Archaebakterielle Pol s ( HiFi PCR ; oft verwendet wenn PCR -Produkte nachher in Expressionsvektoren kloniert werden sollen, wenn man sich lediglich für die Sequenz eines Targets interessiert,----cycle sequencing!!! Probleme mit Proofreading Polymerasen: (1)Sie bauen ssdna ab; Primer sind ssdna, d.h.als Nebenreaktion kann die Spezifität der Primer während der Reaktion verändert werden! (2) weiteres Problem: Pol kommt nach Extension ans Strangende, Enden atmen, Pol baut Nucs aus und füllt wieder auf ( dntp Verbrauch!!!) (3) Hauptproblem: Beim Denaturieren, Enden gehen auf, hyperthermophile Pol. beginnt an den Enden zu kauen ohne wieder aufzufüllen, verkürzt damit die Primeransatzstelle für das nächste Annealing! d.h. Ausbeute gering, Produkte früherer Zyklen können in späteren verschwinden! (4)weiteres Problem: Carryover-Kontamination, dutp-ung-system ist inkompatibel mit Archaebakt. Pol s! Die Verwendung archaebakt.-pol. ist vernünftig wenn man aus einem Plasmid ein kurzes Segment vermehrt bei möglichst niedriger Zyklenzahl! Sie sind aber nicht die Enzyme der Wahl, wenn mit hoher Effizienz längere Target-Sequenzen aus genomischer DNA amplifiziert werden sollen! für long range PCR : Gemisch aus 2 Polymerasen wird verwendet; (immer eine eubakterielle Pol. als Hauptanteil und etwa 1/50 bis 1/200 beträgt der Anteil an Pwo-, Pfu-oder Vent-Pol.) Extension-Temperatur nicht >68 C verwenden ( NICHT die üblichen 72 C!), zw. 65 und 68 ist die Enzym- Prozessivität am größten!

15 Enzymmenge: optimieren! frühere Angaben:2.5U/100µl, zu viel!! Richtwert: 0.5 1U/ 50µl für Taq-Pol.; für Archaebakt.Pol. deutlich mehr(~2.5u/50µl), wegen der wesentlich geringeren Prozessivität dieser Enzyme. Fehlerrate der Enzyme: liegt für Polymerasen mit Korrekturaktivität ( proofreading activity ) bei ungefähr 10-6 je eingebauter Base, für solche ohne diese Eigenschaft etwa um den Faktor 10 höher. Die Fehlerrate kann sich in Abhängigkeit von den verwendeten Bedingungen erhöhen! Temperaturabhängige Aktivität: am Bsp. Taq-Pol.: bei 70 C werden ~2800 Nucleotide/min eingebaut, bei 55 C noch 1400, bei 37 C 90 Nucleotide/min und bei 22 C immerhin noch etwa 15 Nucleotide /min. C. Mülhardt, Molekularbiologie

16 5. Template Je besser die Qualität der Template-DNA ist, desto günstiger. Das Faszinierende an der PCR ist jedoch, daß sie manchmal auch funktioniert, wenn man es ihr gar nicht zutraut ( und leider auch umgekehrt!) Templatemenge: Theoretisch reicht ein einziges Templatemolekül bereits aus, aber in der Praxis sind wenigstens 10 4 Moleküle erforderlich, um problemlos amplifizieren zu können. Zu große Mengen an Template provozieren Fehlannealing! 6. Ölüberschichtung Leichtes Mineralöl wird für klassische Geräteversionen ohne Heizdeckel verwendet, bei neuen Versionen dagegen ist der Verdunstungsschutz nicht mehr erforderlich ( 10% Volumensverringerung muß man aber in Kauf nehmen!)

17 II. Zyklusbedingungen Ein typisches PCR-Programm besteht aus Zyklen, die aus einem Denaturierungsschritt, einem Annealingschritt und einem Elongationsschritt. bestehen. Denaturiert wird bei C, dabei trennen sich die beiden Stränge der Template-DNA. Anschließend wird die Temperatur so weit gesenkt, daß es zur Hybridisierung der im massiven Überschuß vorhandenen Oligonucleotid-Primer an die einzelsträngige Target-DNA kommt (wenige Sekunden sind dafür ausreichend!) Danach wird die Temperatur auf 72 C erhöht, wobei der Primer verlängert wird, bis wieder eine doppelsträngige DNA vorliegt, die der ursprünglichen Target-DNA exakt gleicht ( Target DNA: der zu amplifizierende Teil der Template DNA). Weil die Komplementierung an beiden Strängen der Target-DNA abläuft, hat man in einem Zyklus die Zahl der Target-Moleküle verdoppelt. Wiederholt man den Zyklus, hat man schließlich die vierfache Menge usw. Eine hilfreiche Gleichung für stöchiometrische Berechnungen lautet : N = N o V n ; N o = Anfangszahl, N= Zahl nach n Zyklen, V= Vermehrungsfaktor, n= Zyklenzahl.

18 PCR Rechenbeispiele 1. 1 Unit Taq-Polymerase sind 50 fmol. Frage: Wieviele Moleküle sind 50 fmol? a. 1.5 x 10 9 b. 2 x c. 3 x Ein PCR Ansatz enthält beispielsweise als Template10 pg λ-dna: Frage: Wieviele Moleküle sind 10pg λ-dna (MW λ = 48.5 kb, MW 1bp ~ 660)? a. 1 x 10 5 b. 2 x 10 5 c. 5 x Ein PCR-Ansatz enthält u.a. 10 pg λ-dna, 1 U Taq- Polymerase, der Vermehrungsfaktor betrage 1.6. Frage: Nach welcher Zyklenanzahl entspricht die Zahl der Startstellen derjenigen der Polymerase-Moleküle im Reaktionsgemisch? X 0 = Anfangszahl X = Zahl am Ende der Reaktion (Gleichung: X = X 0 V n ) V = Vermehrungsfaktor ( theoretisch 2.0; praktisch meistens um 1.6 ) n = Zyklenzahl a. 24 b. 26 c. 28

19 PCR- Rechenbeispiele 4. Ein PCR-Ansatz enthält 10 pg λdna, 1 U Taq Polymerase, V=1.6, Ansatzvolumen =50µl; Primerkonzentration = 0.5µmol L -1 Frage: Wie hoch ist der molare Überschuß Primer zu Target-Molekülen zu Beginn der Reaktion? a. 5 x 10 6 b. 7.5 x 10 7 c. 1.2 x Ein PCR-Ansatz enthält 10 pg λ-dna, 1 U Polymerase, 0.5 µmol L -1 Primer, Reaktionsvolumen = 50µl.( Vermehrungsfaktor V sei 1.6) Frage: Nach wievielen Zyklen befinden sich gleich viele Primer-Ansatzstellen wie Primer in der Reaktion? a. nach 33 Zyklen b. nach 37 Zyklen c. nach 41 Zyklen 6. Die übliche Konzentration der dntp s in einem PCR-Ansatz (50µl) beträgt je 200µmol L -1. Frage: Wieviel DNA kann mit der vorhandenen dntp-menge theoretisch synthetisiert werden? a. ~10 µg b. ~13 µg c. ~17µg

20 Zyklenanzahl: Ab einer gewissen Produktmenge kommt es zum sog. Plateau-Effekt. Dieser ist in erster Linie auf die Adsorption der Polymerase- Moleküle an die Enden der synthetisierten Amplicons zurückzuführen ( = Endprodukt-Hemmung). Diese natürliche Bremse wird schon lange vor der Limitierung durch sinkende Primer-, dntp- bzw. gestiegene Amplicon-Konzentrationen und andere triviale Faktoren wirksam. Eine zu große Zyklenanzahl führt nie zu einer Reaktionsverbesserung! Denat.Temp. : Einerseits ist die Denaturierung ein sehr schneller Prozeß, der bereits bei Temperaturen ab 70 C beginnt. Andererseits leiden alle Komponenten unter der Hitze: die Polymerase wird denaturiert, die Nucleotide zerfallen und template-dna wie Primer werden depuriniert. Ausreichend Argumente, um die Denaturierungszeiten so kurz wie möglich zu halten. Tatsächlich reichen Zeiten von fünf Sekunden aus, um die DNA-Stränge voneinander zu trennen. Zur Orientierung: ein mit Öl überschichteter 50µl-Ansatz benötigt ca. 40 Sekunden, bis er die Temperatur des Heizblocks erreicht hat (Robocycler, Stratagene; dünnwandige Tubes). Annealing Temp.: Optimieren, nicht zu lange, wenige Sekunden genügen ( Verifizieren, daß Temp. in der Probe tatsächlich erreicht wird!) Extension-Temp.: zw. 65 C und 72 C :1-2kb/min

21 Methoden zur Vermeidung unspezifischer Amplifikationsprodukte 1. Nested PCR C. Mülhardt, Molekularbiologie

22 2. Hot Start PCR

23 3. PCR Carry-over Prevention Kit zur Vermeidung falsch positiver Amplifikationen Perkin Ellmer

24 Spontaneous deamination of cytosine Spontaneous deamination is the hydrolysis reaction of cytosine into uracil, releasing ammonia in the process. This can occur in vitro through the use of bisulfite, which converts cytosine, but not 5-methylcytosine. This property has allowed researchers to sequence methylated DNA to distinguish non-methylated cytosine (shown up as uracil) and methylated cytosine (unaltered). In DNA, this spontaneous deamination is corrected for by the removal of uracil (product of cytosine deamination and not part of DNA) by uracil glycosidase, generating an abasic (AP) site. The resulting abasic site is then recognised by enzymes, AP endonucleases) which cut the DNA and allow DNA to repair the lesion by replacement with another cytosine. Wikipedia

25 Aufgabenstellungen 1. Optimieren von Reaktionsparametern am Beispiel der Amplifikation eines 1 kb DNA Fragments aus dem Genom des Bakteriophagen λ Zusammensetzung eines Muster -PCR-Ansatzes: Wasser ad 50µl dntp-mix: je 200µmol L -1 forward-und reverse Primer 0.1 1µmol L -1 template DNA variabel Richtwerte: 10 5 Moleküle Template DNA entsprechen ca. 0.5 pg Plasmid DNA, 300 ng humaner, genomischer DNA oder der cdna von 1 µg Gesamt-RNA. 10 x Puffer 5µl Viele Puffer-Stammlösungen enthalten bereits 15 mm Mg 2+, sodass sich eine Einsatz-Konzentration von 1.5mM ergibt. Hinweis: 1.5mM Mg 2+ ist eine in vielen Fällen zu guten Resultaten führende Konzentration, vorausgesetzt die übrigen Reaktionsparameter passen dazu. Polymerase 1 Unit ( 50 fmol) Wird eine archaebakterielle Polymerase verwendet (proofreading activity!) so sollte wegen ihrer deutlich niedrigeren Prozessivität etwa 2.5U /50µl eingesetzt werden. Zu variierende Reaktionsparameter (Auswahl): a. Annealing-Temperatur, ev. Annealing-Dauer, Extension Temperatur, Polymerasekonzentration, Primerkonz., Mg-konz. b. Amplifikation eines Targets in Anwesenheit eines hohen Anteils an unspezifischer Template-DNA: Optimierung der Reaktion mittels verschiedener Hot Start Methoden)

26 2. Reverse Transcriptase-PCR (RT-PCR): Nachweis von β-2-mikroglobulinmrna in Gesamt-RNA aus Mäusemilz : Ausgehend von einem Aliquot der aus Mäusemilz isolierten Gesamt-RNA soll ß-2-Mikro-globulin-mRNA (ß-2-mGL) qualitativ und mittels kompetitiver RT-PCR auch quantitativ nachgewiesen werden: In einem ersten Schritt wird mittels eines genspezifischen Oligonucleotids in der Mixtur vorhandene ß-2-mGL-mRNA in cdna revers transcribiert. Nach der 30 min dauernden reversen Transcription erfolgt die Vermehrung dieser cdna mittels PCR. Im Praktikum wird ein sog. One Tube RT- PCR-Kit verwendet; dies bedeutet, dass sich sowohl Reverse Transcriptase als auch die für die nachfolgende PCR erforderlichen Reagentien gemeinsam im Ansatz befinden.

27 Abbas, Cellular & Molecular Immunology Funktion von β2-mikroglobulin

28 Grundprinzip der kompetitiven RT-PCR Man gibt dem Ansatz einen sog. Internen Standard zu, das ist eine definierte Menge einer Standard-Zielsequenz, die sich vom zu quantifizierenden Target nur geringfügig unterscheidet. Beide Sequenzen besitzen die gleichen Primeransatzstellen. So kann man davon ausgehen, dass die Amplifikationsbedingungen für beide Targets identisch sind. Man führt dann mehrere Amplifikationsreaktionen durch, bei denen jeweils gleiche vom zu quantifizierenden Target, aber unterschiedliche Mengen an Standard-Target eingesetzt werden. Die in höherer Konzentration vorliegende Sequenz wird entsprechend stärker vermehrt. Nur wenn beide Sequenzen, die exogene Standard- und die endogene Zielsequenz, in annähernd der gleichen Ausgangskonzentration vorliegen, liegen beide beim Wettstreit um die Primer gleich gut im Rennen ( Competition!) und werden deshalb gleich stark vermehrt. Dies bedeutet, dass sich in dem Ansatz, in dem beide Sequenzen gleich stark amplifiziert werden, auch die Ausgangskonzentrationen der beiden einander entsprochen haben. Da die jeweils zugegebene Standardmenge bekannt ist, kann damit auf die vorhandene Menge der endogenen Zielsequenz geschlossen werden.

29 Abb. Ergebnis einer kompetiven RT-PCR (aus einem Praktikumsprotokoll) Das Ergebnis lässt auf 10 6 endogene mrna- Moleküle im Ansatz schliessen (Beim Auftragen der Probe in der Bahn ohne Standard ging ein Großteil der Probe verloren, deshalb das geringe Fluoreszenzsignal der endogenen RNA-Bande).

30 Real Time PCR C. Mülhardt, Molekularbiologie

31 C. Mülhardt, Molekularbiologie

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

4 Die Polymerase-Kettenreaktion (PCR)

4 Die Polymerase-Kettenreaktion (PCR) 4 Die Polymerase-Kettenreaktion (PCR) Heil dem Wasser! Heil dem Feuer! Heil dem seltnen Abenteuer! Eigentlich gehört die Polymerase-Kettenreaktion (PCR) in das Kapitel Werkzeug, doch ist sie momentan sicherlich

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

SCRIPTUM HIGH PRECISE

SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

S-Dis Hotstart Polymerase

S-Dis Hotstart Polymerase Datenblatt Artikel-Nr. BS91.219.0200 Artikel-Nr. BS91.219.1000 200 Units 1000 Units (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen: Farbe: 1 Beschreibung Die

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR?

PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Inhalt Was ist? Eine Definition Optimierung Anwendungsgebiete - in der Gentechnologie - in der Diagnostik Zusammenfassung von Christian Jogler (Abteilung für Mol. & Med. Virologie) Was ist? Eine Definition

Mehr

Bioinformatik I: Grundlagen der Gentechnik

Bioinformatik I: Grundlagen der Gentechnik Bioinformatik I: Grundlagen der Gentechnik Dr. Maik Böhmer Institut für Biologie und Biotechnologie der Pflanzen Schlossplatz 7 Schwerpunkte: Vorlesung 1: Einführung & Enzyme der Gentechnik Vorlesung 2:

Mehr

Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP Informationsveranstaltung Heimtierfuttermittel PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln C. Haldemann, ALP Grundidee des Nachweises von GVOs mittels PCR Die Bestimmung genveränderter

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Pflanze direkt 2x PCR-Mastermix

Pflanze direkt 2x PCR-Mastermix Datenblatt Artikel-Nr. BS91.322.0250 Artikel-Nr. BS91.322.1250 250 Reaktionen in 20 μl 1250 Reaktionen in 20 μl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes

Mehr

peqgold M-MuLV H plus Reverse Transcriptase

peqgold M-MuLV H plus Reverse Transcriptase Arbeitsanleitung / Instruction Manual peqgold M-MuLV H plus Reverse Transcriptase v0314_d+e Creating the future together. Arbeitsanleitung peqgold M-MuLV H plus Reverse Transcriptase INHALT PRODUKTBESCHREIBUNG

Mehr

Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183

Mehr

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet

Mehr

Medizinische Fakultät Auswertestrategien von Microarrays Einführung

Medizinische Fakultät Auswertestrategien von Microarrays Einführung Medizinische Fakultät Auswertestrategien von Microarrays Einführung PD Dr. Knut Krohn IZKF Leipzig Dr. Markus Eszlinger Med. Klinik III Forschungslabor DNA RNA Hintergrund Charakteristisches Muster der

Mehr

Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und

Mehr

Reagenzien-Wegweiser für das LightCycler 480 System

Reagenzien-Wegweiser für das LightCycler 480 System Reagenzien-Wegweiser für das LightCycler 480 System qpcr Reagenzien in Premium Qualität für jede Applikation die optimale Lösung www.roche-applied-science.com Roche Applied Science Haben Sie schon Ihr

Mehr

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Definition: Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

Modifizierte Gene Editor Mutagenese

Modifizierte Gene Editor Mutagenese Modifizierte Gene Editor Mutagenese zur gleichzeitigen Einführung mehrerer Punktmutationen DNA Template Präparation: 2 µg Plasmid DNA (bei 6 kb, sonst entsprechend mehr oder weniger) + 2 µl 2M NaOH, 2

Mehr

Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1

Mehr

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert

Mehr

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA 3 Ergebnisse 3.1 Isolierung von leukozytärer Gesamt-RNA Um Ausgangsmaterial zur Isolierung von CD44-RNA zu erhalten, wurde aus einem Buffy coat (siehe Abschnitt Materialen und Methoden ) der Leukozytenanteil

Mehr

Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ

Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ 3> J ) Europäisches Patentamt European Patent Office Dffice europeen des brevets 2) Veröffentlichungsnummer: 0 409 078 AZ 3> EUROPAISCHE PATENTANMELDUNG Anmeldenummer: 90113328.0 ) Int. CIA C1 20. 1/68

Mehr

Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 -

Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 - Inhaltsverzeichnis 1 Theoretischer Hintergrund - 2-1.1 Die Komponenten der PCR - 2-1.2 Das Verfahren der PCR - 3-1.3 Die Gelelektrophorese - 5-2 Material und Methoden - 6-3 Ergebnisse - 7-3.1 Ergebnisse

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR

Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Nils Scharke, inano Abstract Die Verwendung neuartiger Seltenerd-Komplexe in Verbindung mit zeitaufgelöster Fluoreszenzmessung liefert

Mehr

Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an.

Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an. Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an. Kits für die Proteinanalyse und molekulare Diagnostik?

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet

Mehr

Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Gentechnik in Lebens- und Futtermitteln

Gentechnik in Lebens- und Futtermitteln BfR - Jubiläum FEDERAL INSTITUTE FOR RISK ASSESSMENT Gentechnik in Lebens- und Futtermitteln Dr. Jutta Zagon Produktidentität, Rückverfolgbarkeit und Neuartige Lebensmittel Thielallee 88-92, 14195 Berlin

Mehr

Product Catalogue 2011-2012. PCR Related

Product Catalogue 2011-2012. PCR Related Product Catalogue 2011-2012 PCR Related geneon.net A good decision... GeneON GmbH Hubertusstraße 20 D-67065 Ludwigshafen Phone: +49-621-5720 864 Fax: +49-621-5724 462 E-Mail: info@geneon.net Web: www.geneon.net

Mehr

peqgold M-MuLV H minus Reverse Transcriptase

peqgold M-MuLV H minus Reverse Transcriptase Arbeitsanleitung / Instruction Manual peqgold M-MuLV H minus Reverse Transcriptase v0314_d+e Creating the future together. Arbeitsanleitung peqgold M-MuLV H minus Reverse Transcriptase INHALT PRODUKTBESCHREIBUNG

Mehr

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen

Mehr

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich

Mehr

2. DNA-Fingerprinting

2. DNA-Fingerprinting Obwohl die Untersuchung von Mikrosatelliteninstabilität und LOH nicht Ziel der vorliegenden Arbeit war, kann es im Rahmen der Vaterschaftsbegutachtung dazu kommen, dass von einem verstorbenen Putativvater

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli

Mehr

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94.

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94. In diesem Skript wird der Versuch unternommen, der Prozess Pyrosequencing so zu erklären, dass Schüler die Chance haben Pyrosequencing zu verstehen. Es basiert auf einem Vortrag im Rahmen des Science Bridge

Mehr

Trouble-Shooting Sequenzierergebnisse

Trouble-Shooting Sequenzierergebnisse Trouble-Shooting Sequenzierergebnisse Mixed Base Definitionen Problem 1: Keine Reaktion, Keine Sequenzdaten Problem 2: Überlappende Signale Problem 3: Überlappende Signale beginnen in der Mitte der Sequenz

Mehr

Polymerase-Kettenreaktion

Polymerase-Kettenreaktion Polymerase-Kettenreaktion Universität für Bodenkultur Wien Interuniversitäres Department für Agrarbiotechnologie Tulln Ein Einblick über eine der wohl bekanntesten Analysemethoden der Neuzeit Martin Kellner

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Reagenzien Isolierung von Nukleinsäuren

Reagenzien Isolierung von Nukleinsäuren Aufbewahrung bei Raumtemperatur Anwendung Isolierung ultrareiner Plasmid-DNA aus Bakterienkulturen von 1 ml bis 800 ml. Die Plasmid-DNA eignet sich für Manuelle und automatisierte Sequenzierung mit Fluoreszenzfarbstoffen

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Kolonie-PCR Polymerase

Mehr

Applications Note 229 August 2010

Applications Note 229 August 2010 Applications Note 229 August 2010 Weiterverwendung von mehrfach in Eppendorf BioPhotometer plus TM und UVette gemessenen DNA- Proben für PCR- und real-time PCR Experimente Martin Armbrecht, Nils Gerke,

Mehr

1.Theoretischer Hintergrund

1.Theoretischer Hintergrund 1.Theoretischer Hintergrund Die Molekularbiologie oder Molekulargenetik befasst sich mit den zellulären Vorgängen bei der Vervielfältigung, Übertragung und Expression des genetischen Materials. Bei der

Mehr

Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95

Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95 Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95 Quantification strategies in real-time RT-PCR Pfaffl, M.W.: The real-time

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

Erster Baum genetisch sequenziert Genetische Veränderung geplant - Ökologen warnen vor Gentech- Pflanzen

Erster Baum genetisch sequenziert Genetische Veränderung geplant - Ökologen warnen vor Gentech- Pflanzen Erster Baum genetisch sequenziert Genetische Veränderung geplant - Ökologen warnen vor Gentech- Pflanzen Das erste Genom eines Baumes wurde nach Angaben des Wissenschaftsmagazins Science nun fertig entschlüsselt.

Mehr

Übersicht Sequenziermethoden

Übersicht Sequenziermethoden DNA-Sequenzierung Übersicht Sequenziermethoden Sanger-Sequenzierung Pyrosequencing (Roche/454) Illumina/Solexa Pacific Biosciences (PacBio) Sanger-Sequenzierung Didesoxymethode, Kettenabruch- Synthese

Mehr

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!

Mehr

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt USERGUIDE Seite 1 No. 201 Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt Temperierbereich: (RT 13 C) bis 99 C [MTPs: (RT 10 C) bis 70 C], Minimal

Mehr

Untersuchungen zur genetischen und serologischen Prävalenz. eines neuen humanen Polyomavirus

Untersuchungen zur genetischen und serologischen Prävalenz. eines neuen humanen Polyomavirus Untersuchungen zur genetischen und serologischen Prävalenz eines neuen humanen Polyomavirus Bachelorarbeit im Bachelor-Studiengang Biotechnologie der Beuth Hochschule für Technik Berlin - University of

Mehr

4. Wässrige Lösungen schwacher Säuren und Basen

4. Wässrige Lösungen schwacher Säuren und Basen 4. Wässrige Lösungen schwacher Säuren und Basen Ziel dieses Kapitels ist es, das Vorgehenskonzept zur Berechnung von ph-werten weiter zu entwickeln und ph-werte von wässrigen Lösungen einprotoniger, schwacher

Mehr

Identifizierung positiver Klone aus einer λ-phagenbibliothek

Identifizierung positiver Klone aus einer λ-phagenbibliothek Identifizierung positiver Klone aus einer λ-phagenbibliothek Betreuer: Elke Muth-Köhne und Nora Cavara Beginn des Versuchs: 9.00 Uhr im Praktikumssaal NBCF 04 Nord 1. Theoretischer Hintergrund 1.1 Screening

Mehr

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,

Mehr

3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems

Mehr

Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Lösungen zu den Übungsaufgaben zur Thematik Säure/Base (Zwei allgemeine Hinweise: aus Zeitgründen habe ich auf das Kursivsetzen bestimmter Zeichen

Lösungen zu den Übungsaufgaben zur Thematik Säure/Base (Zwei allgemeine Hinweise: aus Zeitgründen habe ich auf das Kursivsetzen bestimmter Zeichen Lösungen zu den Übungsaufgaben zur Thematik Säure/Base (Zwei allgemeine Hinweise: aus Zeitgründen habe ich auf das Kursivsetzen bestimmter Zeichen verzichtet; Reaktionsgleichungen sollten den üblichen

Mehr

Oligo Click S Reload ROTI kit für DNA labeling

Oligo Click S Reload ROTI kit für DNA labeling Gebrauchsanweisung Oligo Click S Reload ROTI kit für DNA labeling ROTI kit für DNA labeling Carl Roth GmbH + Co. KG Oligo Click S Reload ROTI kit für DNA labeling Für die Markierung von bis zu 10 nmol

Mehr

MutaREAL Cytomegalovirus real time PCR Kit

MutaREAL Cytomegalovirus real time PCR Kit MutaREAL Cytomegalovirus real time PCR Kit Screening Test für den Nachweis von humanen Cytomegaloviren (CMV) mittels real time PCR. KV2900324 KV2900396 Nur für Forschungszwecke Immundiagnostik AG, Stubenwald-Allee

Mehr

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Es sollten mithilfe des Yeast-Two-Hybrid-Systems Proteine identifiziert werden, die mit der zytoplasmatischen Domäne von CEACAM1-4L aus

Mehr

5x QPCR Mix (ROX) Datenblatt. Artikel-Nr. BS µl Artikel-Nr. BS µl. (Nur für Forschung und in vitro-anwendungen)

5x QPCR Mix (ROX) Datenblatt. Artikel-Nr. BS µl Artikel-Nr. BS µl. (Nur für Forschung und in vitro-anwendungen) Datenblatt Artikel-Nr. BS76.520.0200 200 µl Artikel-Nr. BS76.520.1000 1.000 µl Artikel-Nr. BS76.520.5000 5.000 µl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses

Mehr

www.gbo.com/bioscience Gewebekultur 1 Zell- und Microplatten 2 HTS- 3 Immunologie/ HLA 4 Mikrobiologie/ Bakteriologie Mehrzweckgefäße 5 Röhrchen/

www.gbo.com/bioscience Gewebekultur 1 Zell- und Microplatten 2 HTS- 3 Immunologie/ HLA 4 Mikrobiologie/ Bakteriologie Mehrzweckgefäße 5 Röhrchen/ 13 Reaktions/ 2 HTS 1 Zell und Reaktionsgefäße für die PCR 7 I 2 PCR Tubes 7 I 2 PCR 8er Streifen 7 I 3 PCR 7 I 4 Polypropylen 7 I 4 384 Well Polypropylen 7 I 4 PCR Kompatibilitätstabelle 7 I 6 ThermoQuick

Mehr

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Polymerase-Kettenreaktion (PCR) Die Polymerase-Kettenreaktion (englisch Polymerase Chain Reaction, PCR) ist eine

Mehr

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Versuchsleiter: Bernhard Eikmanns Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 11.11 15.11.2002 Protokoll testiert: WS02

Mehr

DNA-Sequenzierung. Martina Krause

DNA-Sequenzierung. Martina Krause DNA-Sequenzierung Martina Krause Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse

Mehr

3 Material und Methoden

3 Material und Methoden 22 Material und Methoden 3 Material und Methoden 3.1 Patienten und Patientenproben TEL-AML1-Spleißvarianten und MRD-Messungen wurden an RNA-Proben von Kindern, die an einer TEL-AML1 positiven B-Vorläuferzell

Mehr

Wasserchemie und Wasseranalytik SS 2015

Wasserchemie und Wasseranalytik SS 2015 Wasserchemie und Wasseranalytik SS 015 Übung zum Vorlesungsblock II Wasserchemie Dr.-Ing. Katrin Bauerfeld 5,5 6,5 7,5 8,5 9,5 10,5 11,5 1,5 13,5 Anteile [%] Übungsaufgaben zu Block II Wasserchemie 1.

Mehr

Nachweis von DNA im Wein

Nachweis von DNA im Wein Abschlussbericht über den Forschungsauftrag Nachweis von DNA im Wein Projektlaufzeit: 01.01.2001 bis 31.03.2003 Prof. Dr. Ralf Kaldenhoff Universität Würzburg Julius-von-Sachs-Institut für Biowissenschaften

Mehr

4.1.1. Nachweis von rcar1- und rcar2-mrna in verschiedenen Organen

4.1.1. Nachweis von rcar1- und rcar2-mrna in verschiedenen Organen 50 4. ERGENISSE 4.1. Evaluierung der kompetitiven RT-PCR 4.1.1. Nachweis von rcar1- und rcar2-mrna in verschiedenen Organen Der Nachweis der rcar1- und rcar2-mrna-expression erfolgte mittels RT-PCR. In

Mehr

DNA: Aufbau, Struktur und Replikation

DNA: Aufbau, Struktur und Replikation DNA: Aufbau, Struktur und Replikation Biochemie Die DNA als Träger der Erbinformation Im Genom sind sämtliche Informationen in Form von DNA gespeichert. Die Information des Genoms ist statisch, d. h. in

Mehr

Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise

Mehr

Milenia Hybridetect. Detection of DNA and Protein

Milenia Hybridetect. Detection of DNA and Protein Milenia Hybridetect Detection of DNA and Protein Firmenprofil und Produkte Milenia Biotec GmbH ist im Jahr 2000 gegründet worden. Die Firma entwickelt, produziert, vermarktet und verkauft diagnostische

Mehr

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion

Mehr

More space,more products

More space,more products E N Z Y M E S F O R M O L E C U L A R B I O L O G Y More space,more products Nun ist es vollbracht. GeneCraft firmiert unter einer neuen Adresse. Das großräumige Gebäude in Lüdinghausen eröffnet unzählige

Mehr

Charakterisierung von Transkripten mittels RT-PCR

Charakterisierung von Transkripten mittels RT-PCR Charakterisierung von Transkripten mittels RT-PCR Versuchsleiter: Ulrike Gerischer Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 18.11 22.11.2002 Protokoll testiert: WS02 Universität Ulm Inhaltsverzeichnis

Mehr

Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid

Mehr

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C F1-Praktikum Genetik Protokoll Versuch 2: Nachweis der Funktion von Promotor- und Enhancer-Sequenzen mittels Reportergen-Assay Gruppe 8, Manfred Depner & Susanne Duncker Einführung Um die Funktion von

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr