Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Größe: px
Ab Seite anzeigen:

Download "Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen"

Transkript

1 Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen

2 DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

3 Gen Chromosom Boten-RNA - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

4 Gene auf Strang und Gegenstrang Chromosom Boten-RNA - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA Boten-RNA

5 Gene auf Strang und Gegenstrang Chromosom Boten-RNA - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA Boten-RNA

6 Väterliche und mütterliche Genkopien väterliches Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA mütterliches Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

7 Imprinting von im Gehirn Chromosom 15 IC väterlich IC CH 3 mütterlich Genaktivität

8 Ursache von AS: Mutation Chromosom 15 IC väterlich IC CH 3 X mütterlich Genaktivität

9 Ursache von AS: Deletion Chromosom 15 IC väterlich IC CH 3 SNORDs mütterlich Genaktivität

10 Ursache von AS: Uniparentale Disomie Chromosom 15 IC väterlich IC väterlich Genaktivität

11 Ursache von AS: Imprintingfehler Chromosom 15 IC väterlich IC mütterlich Genaktivität

12 Funktion von

13 Eine zweite Mutation verhindert AS αcamkii, Calcium/calmodulin-abhämgige Kinase Typ 2 αcamkiit305v/t306a kann nicht phosphoryliert werden + Ube3A+/- αcamkii305/306+/- Wildtyp αcamkii mutant AS mutant Double mutant Gesund Gesund AS Gesund!

14 Therapie der RETT-Maus Mecp2 - Mecp2 - Rett Syndrom Mecp2 - Mecp2 Nach Geburt angeschaltet Mecp2 + Milder Verlauf

15 Therapeutische Strategien bei AS Ursächliche Therapie Aktivierung des väterlichen Gens Symptomatische Therapie

16 Therapeutische Strategien bei AS Ursächliche Therapie Aktivierung des väterlichen Gens - Vitamin B (Folsäure)

17 Therapeutische Strategien bei AS IC väterlich Genaktivität

18 Folsäure IC väterlich Erhöht Methyl-Gehalt der Zelle IC CH 3 väterlich Genaktivität

19 Folsäure

20 Therapeutische Strategien bei AS Ursächliche Therapie Aktivierung des väterlichen Gens - Vitamin B (Folsäure) - Methyliertes DNA-Fragment

21 Therapeutische Strategien bei AS IC väterlich Genaktivität

22 Methyliertes DNA-Fragment IC väterlich CH 3 ATTCGTTGGC Spezifische Methylierung des ICs IC CH 3 väterlich Genaktivität Steenpass & Horsthemke, Essen (noch keine Daten)

23 Therapeutische Strategien bei AS Ursächliche Therapie Aktivierung des väterlichen Gens - Vitamin B (Folsäure) - Methyliertes DNA-Fragment - Topoisomerase-Inhibitor (Topotecan)

24 Therapeutische Strategien bei AS IC väterlich Genaktivität

25 Topoisomerase-Inhibitor IC väterlich Reduziert -Genaktivität IC väterlich Genaktivität Huang et al., 2011

26 Topoisomerase-Inhibitor Huang et al. Chapel Hill, USA

27 Topoisomerase-Inhibitor Topotecan ist ein Chemotherapeutikum gegen Krebs Nebenwirkungen: Knochenmarkschädigung (Blutzellmangel) Leukämien Leberschädigung Nierenschädigung Allergische Reaktion Haarverlust

28 Inhibition der -Genaktivität IC PAT Folsäure Methyliertes DNA-Fragment Topotecan IC PAT Genaktivität PWS???

29 Therapeutische Strategien bei AS Ursächliche Therapie Aktivierung des väterlichen Gens Symptomatische Therapie

30 Minocyclin Verbessert Bewegungsstörungen und Langzeit-Potenzierung der synaptischen Übertragung bei der AS-Maus

31 Minocyclin Tetracyclin-ähnliches Antibiotikum passiert Blut/Hirn-Schranke Nervzellschützend/entzündungshemmend: - kein Effekt/destruktiv: Amyotrophe Lateralsklerose - positiver Effekt beschrieben (Einzelfälle, kleine Kohorten) Multiple Sklerose Fragiles X-Syndrom Huntington-Erkrankung Parkinson-Erkrankung Schlaganfall Nebenwirkungen: - Magen-Darm-Beschwerden - Allergische Reaktionen

32 Minocyclin FASTA (Foundation for Angelman Syndrome Therapeutics) Weeber et al. "Off-label use" Klinische Studie begonnen in Florida

33 Minocyclin-Studie Art der Studie: Intervention Design der Studie: Endpunkt (Wirksamkeit) Einarmig (alle Teilnehmer werden behandelt) Offen (Arzt und Eltern kennen Medikament) 24 Patienten nehmen 16 Wochen lang Minocyclin Einschlusskriterien: AS molekular nachgewiesen 4-12 Jahre Mädchen und Jungen Ausschlusskriterien: Medizinische Gründe (Unverträglichkeiten etc.) Untersuchungen: Beginn (Basislinie), 8 Wochen, 16 Wochen Primäres Messergebnis: Veränderungen gegenüber der Basislinie in den "Bayley Scales of Infant Development" Allgemeiner Entwicklungstest (kognitive und motorische Skala) Sekundäre Ergebnisse: EEG und drei Verhaltenstests (Adaptive Verhaltensweisen, Verhaltensprobleme, aktives und passives Sprachverständnis,

34 Minocyclin-Studie Schwaches Studiendesign: wenig Teilnehmer, offen (nicht doppelt blind) Trotzdem: Eine Studie besser als keine Studie Warnung vor individueller Heilbehandlung Mögliche Beeinträchtigung der Gesundheit Nebenwirkungen, eventuell symptomverschlechternd Einschätzung der Wirkung wird sehr subjektiv sein

35 Ende

1 von :09

1 von :09 1 von 5 09.06.2011 15:09 2 von 5 09.06.2011 15:09 Klinische Studien CAI Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS CAI n/a NCT00126321 Therapie von Patienten mit rezidivierter akuter myeloischer

Mehr

Demenz Strategien für eine gemeinsame Versorgung

Demenz Strategien für eine gemeinsame Versorgung Demenz Strategien für eine gemeinsame Versorgung Demenz in der ambulanten Versorgung Gereon Nelles, Köln Demenz 1.3 Mo. 60% Alzheimer Demenz 733 000 Demenzkranke erhalten Leistungen (408,000 ambulant,

Mehr

Arbeitsgruppe: Spastik. Fragestellung: Motorische Übungsbehandlung

Arbeitsgruppe: Spastik. Fragestellung: Motorische Übungsbehandlung Arbeitsgruppe: Spastik Fragestellung: Motorische Übungsbehandlung 1 Intervention: Physioterapie Ref.- Nr. Autor, Jahr 1 Sunderlan d et al 1992 Erhebung sbogen Originalarbeit Studie ntyp RCT während der

Mehr

Vorbeugung und Früherkennung von Gedächtnisstörungen

Vorbeugung und Früherkennung von Gedächtnisstörungen Institut für Studien zur Psychischen Gesundheit Mannheim Ludwigshafen, 17. September 2016 Prof. Dr. Georg Adler Begriffsklärung Demenz ein Syndrom ( Krankheitsbild ) Alzheimer-Krankheit, Durchblutungsstörungen

Mehr

Leitlinien für die molekulare und cytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom

Leitlinien für die molekulare und cytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom Leitlinien und Stellungnahmen medgen 2010 22:282 286 DOI 10.1007/s11825-010-0227-y Online publiziert: 10 Juni 2010 Springer-Verlag 2010 Deutsche Gesellschaft für Humangenetik e.v. (GfH) Berufsverband Deutscher

Mehr

Kein Hinweis für eine andere Ursache der Demenz

Kein Hinweis für eine andere Ursache der Demenz die später nach ihm benannte Krankheit. Inzwischen weiß man, dass die Alzheimer-Krankheit eine sogenannte primär-neurodegenerative Hirnerkrankung ist. Das bedeutet, dass die Erkrankung direkt im Gehirn

Mehr

Informations- und Wissensstand der Mütter von Kindern mit angeborenem Herzfehler

Informations- und Wissensstand der Mütter von Kindern mit angeborenem Herzfehler Informations- und Wissensstand der Mütter von Kindern mit angeborenem Herzfehler A Löbel 1, U Grosser 2, A Wessel 2, S Geyer 1 1 Medizinische Soziologie, Medizinische Hochschule Hannover 2 Pädiatrische

Mehr

Wie erblich sind Epilepsien?

Wie erblich sind Epilepsien? Wie erblich sind Epilepsien? Häufigkeit Epilepsie in Bevölkerung 5% erleiden ein Mal einen epileptischen Anfall 1% erkranken an Epilepsie Folie 2 Folie 3 3-5 % Epidemiologische Studie 1989 Rochester, Minnesota,

Mehr

Effekte eines Trainings mit Hilfe von Nintendo Wii Fit Plus bei Patienten mit Multipler Skleroseeine prospektive, kontrollierte, randomisierte Studie.

Effekte eines Trainings mit Hilfe von Nintendo Wii Fit Plus bei Patienten mit Multipler Skleroseeine prospektive, kontrollierte, randomisierte Studie. Effekte eines Trainings mit Hilfe von Nintendo Wii Fit Plus bei Patienten mit Multipler Skleroseeine prospektive, kontrollierte, randomisierte Studie. IQMG JAHRESTAGUNG 17.11.2016, Physiotherapeutin B.A.

Mehr

Immundefekte. Dr. med. Peter Igaz PhD DSc. Klinik II. der Inneren Medizin Medizinische Fakultät Semmelweis Universität

Immundefekte. Dr. med. Peter Igaz PhD DSc. Klinik II. der Inneren Medizin Medizinische Fakultät Semmelweis Universität Immundefekte Dr. med. Peter Igaz PhD DSc Klinik II. der Inneren Medizin Medizinische Fakultät Semmelweis Universität IMMUNDEFEKTE I. -B-Zellen Defekte Antikörpermangelsyndrome -T-Zellen Defekte Defekte

Mehr

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt Inhalt 15 Zwei Gesundheitskulturen Männer sind anders, Frauen auch 16 Der Begriff Gender Medicine 18 Biologische Gegebenheiten 19 Frauen leben länger 21 Warum Frauen länger leben 22 Gesund oder krank?

Mehr

Genetik und Entwicklung: Das Fragile-x-Syndrom. Urs Hunziker NGW, 9. Januar 2015

Genetik und Entwicklung: Das Fragile-x-Syndrom. Urs Hunziker NGW, 9. Januar 2015 Genetik und Entwicklung: Das Fragile-x-Syndrom Urs Hunziker NGW, 9. Januar 2015 Themen Genotyp: Wie wird das Fragile-X-Syndrom vererbt? - Phänotyp: Wie erkennt man Kinder mit Fragilem-X-Syndrom? Wie entwickeln

Mehr

Angelman-Syndrom. Ellen, Barbara u Anna

Angelman-Syndrom. Ellen, Barbara u Anna Angelman-Syndrom Ellen, Barbara u Anna Angelman-Syndrom = Folge einer seltenen neurologischen Genbesonderheit im Bereich des Chromosoms der Nummer 15 psychischen und motorischen Entwicklungsverzögerungen

Mehr

Neues und Altbewährtes in der Therapie der Glioblastome

Neues und Altbewährtes in der Therapie der Glioblastome Neues und Altbewährtes in der Therapie der Glioblastome Christina Hofmann Standardtherapie für Neuerkrankungen 1. Resektion/ Biopsie, post-operatives cmrt 2. Kombinierte Radiatio (54-60 Gy/ ED 1,8-2 Gy)

Mehr

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit?

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit? Funktionelle Dyspepsie: Bei Patienten mit positivem Helicobacter pylori Nachweis hilft eine Eradikation, wenn überhaupt nur wenigen Patienten (Resultate von 2 Studien) Frage: Führt die antibiotische Behandlung

Mehr

Komplementärmedizin nach Transplantation?

Komplementärmedizin nach Transplantation? Komplementärmedizin nach Transplantation? Dr.med. Martin Frei-Erb Facharzt FMH Allgemeine Innere Medizin Institut für Komplementärmedizin IKOM Universität Bern 22.3.2014, 10. Symposium für Transplantierte,

Mehr

Niedrigrisiko MDS Therapeutische Optionen Wolf-Karsten Hofmann

Niedrigrisiko MDS Therapeutische Optionen Wolf-Karsten Hofmann Niedrigrisiko MDS Therapeutische Optionen Wolf-Karsten Hofmann III. Medizinische Klinik, Universitätsmedizin Mannheim Therapie des Niedrigrisiko-MDS Heilung Nebenwirkungen Lebensqualität WHO Klassifikation

Mehr

experto Der Beraterverlag, ein Unternehmensbereich der VNR Verlag für die Deutsche Wirtschaft AG Theodor-Heuss Straße Bonn

experto Der Beraterverlag, ein Unternehmensbereich der VNR Verlag für die Deutsche Wirtschaft AG Theodor-Heuss Straße Bonn Impressum Besser mit Demenz umgehen experto Der Beraterverlag, ein Unternehmensbereich der VNR Verlag für die Deutsche Wirtschaft AG Theodor-Heuss Straße 2 4 53177 Bonn Telefon 0228 9550 100 Telefax 0228

Mehr

Universitätsklinikum Essen Institut für Humangenetik

Universitätsklinikum Essen Institut für Humangenetik Universitätsklinikum Essen Institut für Humangenetik Adresse 45122 Essen Deutschland Telefon +49 201 723-4560 Telefax +49 201 723-5900 E-Mail bernhard.horsthemke@uni-due.de Internet Zur Homepage Projekte

Mehr

genomischen Mutation in bis zu 25 Kilobasen kodierender Sequenz 11445

genomischen Mutation in bis zu 25 Kilobasen kodierender Sequenz 11445 05315 Zuschlag zu den Gebührenordnungspositionen 31840, 31841, 36840 und 36841 11501 Zuschlag zu den Gebührenordnungspositionen 11502 und 11503 für die Anwendung eines Kulturverfahrens zur Anzucht von

Mehr

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/992492254. digitalisiert durch

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/992492254. digitalisiert durch Inhaltsverzeichnis 1 Einleitung 1.1 Die transkranielle Magnetstimulation (TMS) - allgemeine Einführung 1.1.1 Die TMS - technisches Prinzip 17-18 1.1.2 Einsatz der TMS in der neuro-psychiatrischen Forschung

Mehr

Kognitive Defizite bei der bipolaren Störung

Kognitive Defizite bei der bipolaren Störung Kognitive Defizite bei der bipolaren Störung Einfluss von Schlaf und sub-syndromaler Depression DP Julia Volkert Klinik und Poliklinik für Psychiatrie, Psychosomatik und Psychotherapie Direktor: Prof.

Mehr

Was sind die Folgen von Resistenzen?

Was sind die Folgen von Resistenzen? Was sind die Folgen von Resistenzen? Infektionen werden schwieriger zu behandeln und können lebensbedrohlich verlaufen Die Heilung von Infektionen verzögert sich Für manche Infektionen stehen kaum noch

Mehr

Behandlung der Multiplen Sklerose durch Inhibition von Adhäsionsmolek. sionsmolekülen len. Dr. Martin Berghoff

Behandlung der Multiplen Sklerose durch Inhibition von Adhäsionsmolek. sionsmolekülen len. Dr. Martin Berghoff Behandlung der Multiplen Sklerose durch Inhibition von Adhäsionsmolek sionsmolekülen len Dr. Martin Berghoff Immunmodulierende Basistherapie (1) Interferon-β (IFN-β)1b (Betaferon) und 1a (Rebif / Avonex)

Mehr

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie 22. Onkologisches Symposium - 21.01.2017 Große Fortschritte in der Leukämietherapie Prof. Dr. Wolfgang Herr Klinik und Poliklinik für Innere Medizin III - Hämatologie und intern. Onkologie Leukämien (Patienten

Mehr

Behandlung der arteriellen Hypertonie - Wie lautet der Zielwert 2016?

Behandlung der arteriellen Hypertonie - Wie lautet der Zielwert 2016? Behandlung der arteriellen Hypertonie - Wie lautet der Zielwert 2016? Hannes Reuter Klinik III für Innere Medizin Herzzentrum der Universität zu Köln Patient 1 Risikofaktoren: Blutdruck 167/96 mmhg Typ

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Bericht über die beim Internationalen Angelman-Treffen in Paris 2014 vorgestellten Arbeiten

Bericht über die beim Internationalen Angelman-Treffen in Paris 2014 vorgestellten Arbeiten Bericht über die beim Internationalen Angelman-Treffen in Paris 2014 vorgestellten Arbeiten Die Monoamin-Transporter als Ziel für CaMK2alpha: Auswirkungen auf das Angelman- Syndrom Monoamine transporters

Mehr

Lang wirksame Beta-Mimetika Long Acting Beta Agonists (LABAs) erhöhtes Risiko einer Exazerbation der Asthmasymptome

Lang wirksame Beta-Mimetika Long Acting Beta Agonists (LABAs) erhöhtes Risiko einer Exazerbation der Asthmasymptome Lang wirksame Beta-Mimetika Long Acting Beta Agonists (LABAs) erhöhtes Risiko einer Exazerbation der Asthmasymptome Basisinformation FACHINFORMATION Lang wirksame Beta-Mimetika - Long Acting Beta Agonists

Mehr

Programm Demenz-Prävention

Programm Demenz-Prävention Programm Demenz-Prävention Mehr Lebensqualität durch individuelle Maßnahmen im Frühstadium der Erkrankung Ministère de la Santé Villa Louvigny/Allée Marconi L-2120 Luxembourg Tel. 00352/ 27861312 info@demence.lu/info@demenz.lu

Mehr

Effektgrößen. Evidenz-basierte Medizin und Biostatistik, Prof. Andrea Berghold

Effektgrößen. Evidenz-basierte Medizin und Biostatistik, Prof. Andrea Berghold Effektgrößen 2x2Tafel Therapie Medikament 1 Medikament 2 Summe Misserfolg 450 = a 300 = c 750 = (a+c) Endpunkt Erfolg 550 = b 700 = d 1250 = (b+d) Vergleich von 2 Therapien; Endpunkt binär Summe 1000 =

Mehr

EWOG-SAA 2010 Genetische und immunologische Charakterisierung der Schweren Aplastischen Anämie (SAA) bei Kindern und Jugendlichen

EWOG-SAA 2010 Genetische und immunologische Charakterisierung der Schweren Aplastischen Anämie (SAA) bei Kindern und Jugendlichen Studienbeschreibung Titel der Studie EWOG-SAA 2010 Genetische und immunologische Charakterisierung der Schweren Aplastischen Anämie (SAA) bei Kindern und Jugendlichen Studienakronym EWOG-SAA 2010 Internetseite

Mehr

Dr. Martin IMHOF Klinische Abteilung für Endokrinologie und Sterilitätsbehandlung Universitätsklinik für Frauenheilkunde Wien. Pilotstudie PROfertil

Dr. Martin IMHOF Klinische Abteilung für Endokrinologie und Sterilitätsbehandlung Universitätsklinik für Frauenheilkunde Wien. Pilotstudie PROfertil Dr. Martin IMHOF Klinische Abteilung für Endokrinologie und Sterilitätsbehandlung Universitätsklinik für Frauenheilkunde Wien Pilotstudie PROfertil Haben Mikronährstoffe einen Einfluss auf Spermiogrammparameter?

Mehr

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms?

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Brustkrebs aktuell - OSP am 21.10.2015 Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Prof. Dr. German Ott, Institut für Pathologie Robert-Bosch-Krankenhaus

Mehr

Neonataler Diabetes mellitus. Dr. med. Jürgen Grulich-Henn

Neonataler Diabetes mellitus. Dr. med. Jürgen Grulich-Henn Neonataler Diabetes mellitus Dr. med. Jürgen Grulich-Henn DDG-Kurs München 09.10.2012 Klassifikation des Diabetes mellitus I. Diabetes mellitus Typ 1 Primärer Insulinmangel a) autoimmun b) idiopathisch

Mehr

GI Oncology 2011 Session II Magen II

GI Oncology 2011 Session II Magen II GI Oncology 2011 Session II Magen II Prognose- und prädiktive Marker beim Magenkarzinom mehr als Her2? Matthias Ebert II. Medizinische Klinik Universitätsmedizin Mannheim Offenlegung potentieller Interessenkonflikte

Mehr

Das Lennox-Gastaut-Syndrom

Das Lennox-Gastaut-Syndrom Das Lennox-Gastaut-Syndrom Diagnose, Behandlung und Unterstützung im Alltag von Ulrich Stephani 1. Auflage Das Lennox-Gastaut-Syndrom Stephani schnell und portofrei erhältlich bei beck-shop.de DIE FACHBUCHHANDLUNG

Mehr

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen.

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Reduktion der Antibiotikaverordnungen bei akuten Atemwegserkrankungen 1. Basis für rationale Antibiotikaverordnungen: Leitlinien

Mehr

PATIENTENINFORMATION. Caregiver Burden bei betreuenden Angehörigen schwer betroffener Parkinsonpatienten

PATIENTENINFORMATION. Caregiver Burden bei betreuenden Angehörigen schwer betroffener Parkinsonpatienten Version 1.2 Neurologische Klinik mit Klinischer Neurophysiologie Kommissarischer Direktor: Prof. Dr. med. M. Stangel PD Dr. med. F. Wegner Telefon: (0511) 532-3110 Fax: (0511) 532-3115 Carl-Neuberg-Straße

Mehr

Verzögerte Sprachentwicklung sensibler Indikator für globale Entwicklungsdefizite?

Verzögerte Sprachentwicklung sensibler Indikator für globale Entwicklungsdefizite? Verzögerte Sprachentwicklung sensibler Indikator für globale Entwicklungsdefizite? Ergebnisse aus der Heidelberger Sprachentwicklungsstudie Anke Buschmann, Bettina Jooss & Joachim Pietz ISES 4, Klagenfurt

Mehr

NEUE BEHANDLUNGSMÖGLICHKEITEN MONOKLONALE ANTIKÖRPER

NEUE BEHANDLUNGSMÖGLICHKEITEN MONOKLONALE ANTIKÖRPER NEUE BEHANDLUNGSMÖGLICHKEITEN MONOKLONALE ANTIKÖRPER Was sind Antikörper? Antikörper patrouillieren wie Wächter im Blutkreislauf des Körpers und achten auf Krankheitserreger wie Bakterien, Viren und Parasiten

Mehr

Ergebnisse der Strahlentherapie bei Makuladegeneration

Ergebnisse der Strahlentherapie bei Makuladegeneration Ergebnisse der Strahlentherapie bei Makuladegeneration Frank Zimmermann Klinik für Strahlentherapie und Radioonkologie, Universitätsspital Basel radioonkologiebasel.ch Einteilung der Makuladegeneration

Mehr

Rückbildung von Aphasien und Wirkung von Sprachtherapie

Rückbildung von Aphasien und Wirkung von Sprachtherapie Rückbildung von Aphasien und Wirkung von Sprachtherapie Medizinische Fakultät Basel 2. Jahreskurs, Major Clinical Medicine Wahlmodul 3 Gehirn und Sprache Dezember 2008 Seraina Locher Medical eduction,

Mehr

Veränderung der Lebenswelt: Ursache für die Zunahme psychischer Störungen

Veränderung der Lebenswelt: Ursache für die Zunahme psychischer Störungen Veränderung der Lebenswelt: Ursache für die Zunahme psychischer Störungen Prof. Dr. Veit Rößner Dresden, 20. September 2012 Komplexität menschlichen Verhaltens unzählige Aspekte unzählige Veränderungen

Mehr

P1 Grundlagen der Pathologie. Inhalt. Gesundheit und Krankheit. Terminologie. Krankheitsursachen. Krankheitsverlauf. Ausgang und Folgen der Krankheit

P1 Grundlagen der Pathologie. Inhalt. Gesundheit und Krankheit. Terminologie. Krankheitsursachen. Krankheitsverlauf. Ausgang und Folgen der Krankheit Inhalt Gesundheit und Krankheit Terminologie Krankheitsursachen Krankheitsverlauf Ausgang und Folgen der Krankheit Krankheitsbehandlung Altern und Tod Klinische Untersuchung des Patienten Lernziele Die

Mehr

mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms

mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms Georg Jaeschke, F. Hoffmann La Roche Fragiles X Syndrom mglur Theorie Martin-Bell Syndrom Fmr1 Gen identifiziert mglu5 MPEP FMRP hemmt Translation

Mehr

Daten bestätigen Bedeutung einer frühen Behandlung von Patienten mit Multipler Sklerose (MS)

Daten bestätigen Bedeutung einer frühen Behandlung von Patienten mit Multipler Sklerose (MS) Europäischer Multiple-Sklerose-Kongress ECTRIMS: Daten bestätigen Bedeutung einer frühen Behandlung von Patienten mit Multipler Sklerose (MS) - Studienergebnisse belegen kognitive Funktionseinschränkungen

Mehr

Neues aus Diagnostik und Therapie beim Lungenkrebs. Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln

Neues aus Diagnostik und Therapie beim Lungenkrebs. Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln Neues aus Diagnostik und Therapie beim Lungenkrebs Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln Über was ich Ihnen heute berichten will: Lungenkrebs ist nicht gleich Lungenkrebs

Mehr

Die häufigsten Ursachen von Anfällen und Epilepsien

Die häufigsten Ursachen von Anfällen und Epilepsien epi-info Die häufigsten Ursachen von Anfällen und Epilepsien www.diakonie-kork.de 1 Die Ursachen von epileptischen Anfällen und Epilepsien hängen in erster Linie vom Lebensalter der Betroffenen sowie der

Mehr

Deutsche Multicenter-Studien erforschen die Wirksamkeit der Psychotherapie chronischer Depression und ihre neurobiologischen Wirkmechanismen

Deutsche Multicenter-Studien erforschen die Wirksamkeit der Psychotherapie chronischer Depression und ihre neurobiologischen Wirkmechanismen UniversitätsKlinikum Heidelberg Heidelberg, den 31. Juli 2012 PRESSEMITTEILUNG Deutsche Multicenter-Studien erforschen die Wirksamkeit der Psychotherapie chronischer Depression und ihre neurobiologischen

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

Leukämie (CML) Was ist Chronische Myeloische Leukämie? Download. Published on Novartis Austria (https://www.novartis.at)

Leukämie (CML) Was ist Chronische Myeloische Leukämie? Download. Published on Novartis Austria (https://www.novartis.at) Published on Novartis Austria (https://www.novartis.at) Home > Printer-friendly PDF > Leukämie (CML) Leukämie (CML) Was ist Chronische Myeloische Leukämie? Die chronische myeloische Leukämie (CML) ist

Mehr

TOPIC. Epigenetik. Prof. Dr. Max Mustermann Lehrstuhl/Institut

TOPIC. Epigenetik. Prof. Dr. Max Mustermann Lehrstuhl/Institut TOPIC Prof. Dr. Max Mustermann Lehrstuhl Dr. Max Mustermann für XYZ Referat Kommunikation & Marketing Verwaltung Epigenetik Prof. Dr. Max Mustermann Lehrstuhl/Institut Seminar: Gentechnik im Dialog Prof.

Mehr

Die Behandlung des Tourette-Syndroms mit Aripiprazol

Die Behandlung des Tourette-Syndroms mit Aripiprazol Vortragzusammenfassung Die Behandlung des Tourette-Syndroms mit Aripiprazol Professor Dr. med. Mathias Bartels Universitätsklinik für Psychiatrie und Psychotherapie Tübingen Das Tourette-Syndrom ist eine

Mehr

Grundlagen der evidenzbasierten neurologischen Rehabilitation

Grundlagen der evidenzbasierten neurologischen Rehabilitation Grundlagen der evidenzbasierten neurologischen Rehabilitation Prof. Dr. phil. Helmut Hildebrandt Klinikum Bremen-Ost, Neurologie Universität Oldenburg, Psychologie email: helmut.hildebrandt@uni-oldenburg.de

Mehr

Neue Diagnostik für akute myeloische Leukämie

Neue Diagnostik für akute myeloische Leukämie Neue Diagnostik für akute myeloische Leukämie Neuherberg (9. März 2011) - Wissenschaftler des Helmholtz Zentrums München und der Ludwig-Maximilians-Universität München haben eine Methode entwickelt, mit

Mehr

Patientinnen-/ Patienten-Information für die Studie Neurofeedback-Behandlung bei akustischen Halluzinationen

Patientinnen-/ Patienten-Information für die Studie Neurofeedback-Behandlung bei akustischen Halluzinationen Universitäre Psychiatrische Dienste Bern (UPD) Universitätsklinik für Psychiatrie und Psychotherapie Prof. Dr. Thomas Koenig Bolligenstrasse 111, CH-3000 Bern 60 Tel. 031 930 91 69, Fax 031 930 99 58 email:

Mehr

2. Regensburger Patiententag

2. Regensburger Patiententag 2. Regensburger Patiententag 7. Feb. 2015 Neues aus der Therapie von Leukämien und Lymphomen Wolfgang Herr Innere Medizin III Hämatologie und Onkologie Leukämien und Lymphome entstehen durch Veränderungen

Mehr

Thrombozytopenie: Wann transfundieren?

Thrombozytopenie: Wann transfundieren? Thrombozytopenie: Wann transfundieren? Heiko Rühl Institut für Experimentelle Hämatologie und Transfusionsmedizin Universitätsklinikum Bonn IAKH Jahreskongress 2013 Thrombozytopenie: Wann transfundieren?

Mehr

Chromosomen & Populationsgenetik (1)

Chromosomen & Populationsgenetik (1) Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: 1 Karyogramme Chromosomen & Populationsgenetik (1) Bestimmen Sie den Karyotyp der folgenden

Mehr

Arbeit und Krebs Aus der Sicht der Medizin

Arbeit und Krebs Aus der Sicht der Medizin Arbeit und Krebs Aus der Sicht der Medizin Thomas Cerny, Präsident Krebsforschung Schweiz KFS Interessenskonflikte keine Inhalt 1. Krebs: was ist das? 2. Ursachen von Krebs 3. Krebs am Arbeitsplatz 4.

Mehr

Alzheimer Demenz. Demenz - Definition. - Neueste Forschungsergebnisse - Neuropathologie der Demenz n=1050. Alzheimer Krankheit: Neuropathologie

Alzheimer Demenz. Demenz - Definition. - Neueste Forschungsergebnisse - Neuropathologie der Demenz n=1050. Alzheimer Krankheit: Neuropathologie Demenz - Definition Alzheimer Demenz - Neueste Forschungsergebnisse - Beeinträchtigung von geistigen (kognitiven) Funktionen (z.b. Gedächtnis, Sprache, Orientierung) dadurch bedingte deutliche Beeinträchtigung

Mehr

Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus Update TKI-STOP

Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus Update TKI-STOP Höhepunkte des Amerikanischen Hämatologie-Kongresses Orlando, 2015 Dr. Sebastian Saur, Med. Klinik II, Universitätsklinik Tübingen Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus

Mehr

Pathohysiologie und Androgendeprivationtstherapie(ADT) des kastrationsresistenten Prostatakarzinoms

Pathohysiologie und Androgendeprivationtstherapie(ADT) des kastrationsresistenten Prostatakarzinoms Pathohysiologie und Androgendeprivationtstherapie(ADT) des kastrationsresistenten Prostatakarzinoms KASTRATIONSRESISTENTES PROSTATAKARZINOM (CRPC) Patienten sprechen im Allgemeinen gut auf eine ADT an.

Mehr

Intel igenzminderung

Intel igenzminderung Intelligenzminderung Intelligenzminderung ist eine sich in der Entwicklung manifestierende, stehen gebliebene oder unvollständige Entwicklung der geistigen Fähigkeiten, mit besonderer Beeinträchtigung

Mehr

deutsche gesellschaft für humangenetik e.v.. Leitlinien für die molekulare und zytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom

deutsche gesellschaft für humangenetik e.v.. Leitlinien für die molekulare und zytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom deutsche gesellschaft für humangenetik e.v.. Leitlinien für die molekulare und zytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom Deutsche Gesellschaft für Humangenetik e.v. Veröffentlicht

Mehr

Bericht aus Kiel. Prof. Dr. Wolfram Klapper (Sektion Hämatopathologie, Kiel)

Bericht aus Kiel. Prof. Dr. Wolfram Klapper (Sektion Hämatopathologie, Kiel) Bericht aus Kiel Prof. Dr. Wolfram Klapper (Sektion Hämatopathologie, Kiel) Was ist passiert? Wo wollen wir hin? Was ist passiert? Wo wollen wir hin? Die KKI-Labore in Kiel 1992 Hämatopathologie und Lymphknotenregister

Mehr

Menschen mit Demenz im Wandel der therapeutischen Möglichkeiten

Menschen mit Demenz im Wandel der therapeutischen Möglichkeiten Menschen mit Demenz im Wandel der therapeutischen Möglichkeiten Alexander Kurz Klinik für Psychiatrie und Psychotherapie Klinikum rechts der Isar Technische Universität München 1 Was ist eine Demenz? Eine

Mehr

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen Quelle: scientopia.org Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen 30. Januar 2014 ChrisEna Spilker Intelligenz Charakter Gedächtnis Plas5zität beruht auf der chemischen Zwiesprache

Mehr

Auswertung von Unterschieden der Androgene bei SBMA-Patienten

Auswertung von Unterschieden der Androgene bei SBMA-Patienten Auswertung von Unterschieden der Androgene bei SBMA-Patienten Nicholas Di Prospero, MD, PhD National Institute of Neurological Disorders and Stroke NIH Von der Genetik zu einem Gen Spinale und Bulbäre

Mehr

Kinderneurologie - STIM-CP

Kinderneurologie - STIM-CP Kinderneurologie - STIM-CP Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS 1603 NCT02097693 Effekt der Tiefen Hirnstimulation im Globus Pallidus internus auf die Lebensqualität von jungen Patienten

Mehr

Faktenbox Medikamentöse Therapie bei Agoraphobie mit und ohne Panikstörung

Faktenbox Medikamentöse Therapie bei Agoraphobie mit und ohne Panikstörung Faktenbox Medikamentöse Therapie bei Agoraphobie mit und ohne Panikstörung Nutzen und Risiken im Überblick Jede medizinische Behandlung bringt Nutzen und Risiken mit sich. Diese Faktenbox kann Sie bei

Mehr

Vorhofflimmern und Blutverdünnung: Wann Marcumar und wann eine der neuen Substanzen? (Dabigatran, Rivaroxaban, Apixaban)

Vorhofflimmern und Blutverdünnung: Wann Marcumar und wann eine der neuen Substanzen? (Dabigatran, Rivaroxaban, Apixaban) Die Kontroverse: Schlaganfall Verhinderung (10% 2%) Blutungs Risiko (> 1%) Keine Antikoagulation Vitamin K Antagonisten 64,6% Medicare Kohorte, USA (n = 23657) Birman Deych E et al. Stroke 2006; 37:

Mehr

Evaluationsergebnisse des AOK-START-Vertrages

Evaluationsergebnisse des AOK-START-Vertrages Medizinische Fakultät Institut für Medizinische Informatik und Biometrie Arbeitsgruppe Epidemiologie und Versorgungsforschung Evaluationsergebnisse des AOK-START-Vertrages - 1. Zwischenauswertung - Dipl.-Ing.

Mehr

Basisstationen und Notwendigkeit epidemiologischer Untersuchungen

Basisstationen und Notwendigkeit epidemiologischer Untersuchungen Basisstationen und Notwendigkeit epidemiologischer Untersuchungen Dr. med. Bernhard Aufdereggen, Aertzinnen und Aerzte für Umweltschutz Meine Sicht ist geprägt durch: Meine Erfahrung als Arzt Meine Erfahrung

Mehr

Neues vom ASCO beim metastasierten Mammakarzinom

Neues vom ASCO beim metastasierten Mammakarzinom Neues vom ASCO 2008 beim metastasierten Mammakarzinom 04.07.2008 Dorit Lässig Medizinische Klinik und Poliklinik III (Direktor: Prof. Dr. med. W. Hiddemann) Universität München - Standort Großhadern Übersicht

Mehr

Entdecken Sie. Chiropraktik!

Entdecken Sie. Chiropraktik! Entdecken Sie Chiropraktik! Was ist so anders daran? Das Hauptaugenmerk der traditionellen Gesundheitsvorsorge richtet sich auf Krankheitserreger und Blutwerte. In der Chiropraktik ist das anders. Die

Mehr

Die Heilkraft des Wassers

Die Heilkraft des Wassers Die Heilkraft des Wassers. von Innen Sie sind nicht krank, sie sind durstig Dr. med. Batmanghelidj Dr. Markus Stöcher 3 Wassermangel als Krankheitsursache Dr. med. Batmanghelidj Datum 4 Quellwasser Was

Mehr

Das Lennox- Gastaut-Syndrom

Das Lennox- Gastaut-Syndrom Prof. Dr. med. Ulrich Stephani Das Lennox- Gastaut-Syndrom Diagnose, Behandlung und Unterstützung im Alltag Inhalt Vorwort 5 Was ist das Lennox-Gastaut-Syndrom? 6 Was ist Epilepsie? 6 Was ist ein Epilepsiesyndrom?

Mehr

Sport bei Leukämie und Lymphomerkrankungen

Sport bei Leukämie und Lymphomerkrankungen Sport bei Leukämie und Lymphomerkrankungen DLH-Patientenkongress 3./4. Juli 2004 Ulm Annette Hildebrand Jürgen M. Steinacker Sektion Sport- und Rehabilitationsmedizin, Abt. Innere Medizin II - Sport

Mehr

Anlage zur Akkreditierungsurkunde D-ML-13294-03-00 nach DIN EN ISO 15189:2007

Anlage zur Akkreditierungsurkunde D-ML-13294-03-00 nach DIN EN ISO 15189:2007 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13294-03-00 nach DIN EN ISO 15189:2007 Gültigkeitsdauer: 17.12.2014 bis 19.02.2017 Ausstellungsdatum: 17.12.2014 Urkundeninhaber:

Mehr

Leitliniengerechte Therapie bei metastasiertem kolorektalem Karzinom

Leitliniengerechte Therapie bei metastasiertem kolorektalem Karzinom Leitliniengerechte Therapie bei metastasiertem kolorektalem Karzinom Case Report NZW Dresden 2010 Stefan Schalbaba stefan.schalbaba@klinikum-memmingen.de Patientenidentität und Subjektive Daten Patient

Mehr

Pathophysiologie 3 Möglichkeiten werden diskutiert: 1. Entzündung Dolor Rubor Tumor Calor Schmerz Rötung Schwellung Wärme 2. Sympathische Störungen

Pathophysiologie 3 Möglichkeiten werden diskutiert: 1. Entzündung Dolor Rubor Tumor Calor Schmerz Rötung Schwellung Wärme 2. Sympathische Störungen Pathophysiologie 3 Möglichkeiten werden diskutiert: 1. Entzündung Dolor Rubor Tumor Calor Schmerz Rötung Schwellung Wärme 2. Sympathische Störungen ausgeprägte autonome Störungen beim CRPS 3. Maladaptive

Mehr

Transgenerationale Weitergabe von traumatischen Beziehungserfahrungen -

Transgenerationale Weitergabe von traumatischen Beziehungserfahrungen - Transgenerationale Weitergabe von traumatischen Beziehungserfahrungen - Psychosoziale Belastung, soziale Unterstützung und kognitive Entwicklung im ersten Lebensjahr TRANS-GEN Köhler-Dauner, F.; Kolassa,

Mehr

Alzheimer und andere Demenzformen

Alzheimer und andere Demenzformen Alzheimer und andere Demenzformen Antworten auf die häufigsten Fragen von Günter Krämer, Hans Förstl Neuausgabe Enke 2008 Verlag C.H. Beck im Internet: www.beck.de ISBN 978 3 8304 3444 3 Zu Leseprobe schnell

Mehr

Übung 9. a) In welchem Teil eines Operons führen Mutationen zur Veränderungen der produzierten Menge eines Enzyms?

Übung 9. a) In welchem Teil eines Operons führen Mutationen zur Veränderungen der produzierten Menge eines Enzyms? Bitte schreiben Sie Ihre Antworten direkt auf das Übungsblatt. Falls Sie mehr Platz brauchen verweisen Sie auf Zusatzblätter. Vergessen Sie Ihren Namen nicht! Abgabe der Übung bis spätestens 19. 05. 08-16:30

Mehr

Amyotrophe Lateralsklerose. Referat von Eva Montag

Amyotrophe Lateralsklerose. Referat von Eva Montag Amyotrophe Lateralsklerose Referat von Eva Montag http://p5.focus.de/img/incoming/origs3195325/5738838139-w630-h412-o-q75-p5/wissen-hawking.jpg Inhalt 1. Definition Was genau ist ALS? 2. Verlauf und Symptomatik

Mehr

Epigenetik Epimutationen bei menschlichen Erkrankungen

Epigenetik Epimutationen bei menschlichen Erkrankungen Epimutationen bei menschlichen Erkrankungen Bernhard Horsthemke Institut für Humangenetik, Essen Zusammenfassung Nach Aktivierung oder Inaktivierung eines Gens durch einen Transkriptionsfaktor wird der

Mehr

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Über FoundationOne Bei dem validierten umfassenden Tumorprofil von FoundationOne wird die gesamte codierende Sequenz von 315 krebsassoziierten Genen

Mehr

Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger

Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger Charité-Universitätsmedizin Berlin Adipositas- und Stoffwechselzentrum Campus Benjamin Franklin Hindenburgdamm 30 12200 Berlin The New Yorker

Mehr

Wissen wächst Bedürfnisse bleiben: Wozu Demenz die Wissenschaft herausfordert

Wissen wächst Bedürfnisse bleiben: Wozu Demenz die Wissenschaft herausfordert Wissen wächst Bedürfnisse bleiben: Wozu Demenz die Wissenschaft herausfordert Erkenntnisse, Fortschritte, offene Fragen und Herausforderungen Elmar Gräßel Friedrich-Alexander-Universität Erlangen-Nürnberg

Mehr

Molekulare Diagnostik in der Zytologie

Molekulare Diagnostik in der Zytologie Molekulare Diagnostik in der Zytologie Nicole Pawlaczyk Karsten Neumann Institut für Pathologie Pneumologische Onkologie Lungenkarzinom häufigste krebsbedingte Todesursache für beide Geschlechter dritthäufigste

Mehr

Grundlagen der Medizinischen Klinik I + II. Dr. Friedrich Mittermayer Dr. Katharina Krzyzanowska

Grundlagen der Medizinischen Klinik I + II. Dr. Friedrich Mittermayer Dr. Katharina Krzyzanowska Grundlagen der Medizinischen Klinik I + II Dr. Friedrich Mittermayer Dr. Katharina Krzyzanowska 1 Was ist Bluthochdruck? Der ideale Blutdruck liegt bei 120/80 mmhg. Bluthochdruck (Hypertonie) ist eine

Mehr

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4 S 4 M 2 Studien an eineiigen Zwillingen Was ist für die Unterschiede bei eineiigen Zwillingen verantwortlich? Aufgaben 1. Fassen Sie die Informationen des Textes zusammen. 2. Wie sind die im Text beschriebenen

Mehr

ACS Versorgungssituation in Deutschland

ACS Versorgungssituation in Deutschland ACS Versorgungssituation in Deutschland ipb Initiative eine Patientenorientierte Strategie Dr. R. Schulz Herz-Kreislauferkrankungen: der Killer Nr. 1 Häufigkeit der Todesursachen Dr. R. Schulz Die Dimension

Mehr

Demenz Hintergrund und praktische Hilfen Dr. med. Christine Wichmann

Demenz Hintergrund und praktische Hilfen Dr. med. Christine Wichmann Demenz Hintergrund und praktische Hilfen Dr. med. Christine Wichmann Lebenserwartung in Deutschland 100 80 Männer Frauen 60 40 20 0 1871 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000

Mehr

deutsche gesellschaft für humangenetik e.v.. Leitlinien für die molekulare und zytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom

deutsche gesellschaft für humangenetik e.v.. Leitlinien für die molekulare und zytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom deutsche gesellschaft für humangenetik e.v.. Leitlinien für die molekulare und zytogenetische Diagnostik bei Prader-Willi-Syndrom und Angelman-Syndrom Deutsche Gesellschaft für Humangenetik e.v. Veröffentlicht

Mehr

AMNOG: Wenn Innovation aufs System trifft: Ist das AMNOG System fit für Innovation- Beispiel Onkologie

AMNOG: Wenn Innovation aufs System trifft: Ist das AMNOG System fit für Innovation- Beispiel Onkologie AMNOG: Wenn Innovation aufs System trifft: Ist das AMNOG System fit für Innovation- Beispiel Onkologie Dr. Jutta Wendel-Schrief Direktor Market Access MSD SHARP & DOHME GMBH Was sind Innovationen? Neue

Mehr

Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater

Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater NIPTs verwenden zellfreie DNA. Blutprobe von der Mutter Mütterliche cfdna Fötale cfdna NIPTs verwenden zellfreie

Mehr

Gerontopsychiatrie. Dr. medic. Ligia Comaniciu Leyendecker

Gerontopsychiatrie. Dr. medic. Ligia Comaniciu Leyendecker Gerontopsychiatrie ligley66@gmail.com ligley66@gmail.com Gerontopsychiatrie 1 / 19 Outline 1 Demenz 2 Demenz bei Alzheimerkrankheit 3 Vaskuläre Demenz 4 Andere Demenzformen 5 Diagnostische Verfahren 6

Mehr