Vorlesungsfolien abrufen

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Vorlesungsfolien abrufen"

Transkript

1 Vorlesungsfolien abrufen Benutzername: Password: student-viro1 viro-rbw

2 Virale Expressionsstrategien Ziel: Abruf der im Genom gespeicherten Information zur richtigen Zeit und in der richtigen Menge

3 Genomgrössen von verschiedenen sequenzierten Organismen Amoeba dubia 670 billion (= 10 9 ) bp Plasmodium falciparum billion bp

4 Genomgroessen von verschiedenen Viren : DNA Viren DNA Virus: Mimivirus Wirt: Amoeba DS DNA Genom 1.2 x 10 6 BP 911 Gene > 400 nm ø. DNA Virus: Circovirus Wirte: Schwein, Vögel ES (-) DNA Genom x 10 3 Basen nm ø;.

5 Genomgroessen von verschiedenen Viren: RNA Viren Coronavirus Wirt: Säugetiere SS (+) RNA Genom x 10 3 Basen Picornavirus Wirt:Wirbeltiere, Insekten nm ø; Behüllt. ES (+)RNA Genom x 10 3 Basen 28-30nm ø; Unbehüllt.

6 Baltimore Klassifikation zur Einteilung der Viren.

7 DNA Viren der Wirbeltiere: Baltimore Klassen I-II Properties Family name Virion polymerase Virion ø(nm) Genome size (kbp) Classification Criteria Nucleic Acid Capsid Symmetry Naked or enveloped Genome architecture Baltimore class From Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

8 RNA Viren der Wirbeltiere: Baltimore Klassen III-V From Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

9 Retroviren: Baltimore Klasse VI Beispiel HIV Classification criteria Properties Nucleic Acid RNA Symmetry of capsid? conical morphology Naked or enveloped enveloped Genome architecture (+) SS Baltimore class VI Family name Retro Virion polymerase Yes Virion diameter (nm) 145 ± 25 Genome size (kbp) ~10

10 Anforderungen an Informationspeicherung und -Abruf bei Viren Maximale Ausnutzung der Speicherkapazität des Genoms; Zeitliche Koordination der Synthese viraler Bestandteile; Behauptung in der Konkurrenz um zelluläre Ressourcen; Erhaltung der Virusfamilie: Vermehrung; Erhaltung auch unter ungünstigen Bedingungen;

11 Maximale Ausnutzung der Speicherkapazität des Genoms Beispiel HIV: 1 Gen ergibt 15 Proteine vif

12 Maximale Ausnutzung der Speicherkapazität des Genoms Beispiel HIV: Überlappende Leseraster LTR Gag Pol Vif Vpr Vpu Rev Tat envenv Nef LTR

13 Der Preis: Veränderung eines Nukleotids kann sich auf mehrere Proteine auswirken Env Rev Tat... C T C C C A A T C L GTTTCAGACCCACCTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAA Env (gp 41) F Q T H L P I P R G P D R P E G Rev Exon 2 D P P P N P E G T R Q A R R N Tat Exon 2 P T S Q S R G D P T G P K E Substitution: C -> T S P P Q N GTTTCAGACCCACCTCCT AAT CCCGAGGGGACCCGACAGGCCCGAAGGAA Env (gp 41) F Q T H L L I P R G P D R P E G Rev Exon 2 D P P P N P E G T R Q A R R N Tat Exon 2 P T S I Auswirkungen: Env (gp 41) CCA -> CAA P -> Q Rev Exon 2 CCC -> CCA kein Effekt Tat Exon 2 CAA -> AAA Q -> K

14 Strategien zum Abruf und zur Umsetzung der im Genom gespeicherten Information RNA-Prozessierung Alternatives Splicing von einem Primär-Transkript Beispiele: Adenoviridae Orthomyxoviridae Papillomaviridae Polyomaviridae Retroviridae From Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

15 Voraussetzung: mrnas müssen in den Zellkern Balt. Genom 1 Familien RNA Klasse (Beispiele) Syntheseort 2 I dsdna Herpesviridae K Adenoviridae K Papovaviridae K Poxviridae Z II esdna Parvovoridae K III dsrna Reoviridae Z (segmentiert) IV (+) esrna Picornaviridae Z Coronaviridae Z Flaviviridae Z Togaviridae Z V (-)ssrna Orthomyxoviridae K (segmentiert) unsegm. Paramyxoviridae Z Rhabdoviridae Z VI RNA ->DNA Retroviridae K VII DNA 3 ->RNA Hepadnaviridae K 1 Ds: doppelsträngig; es: einzelsträngig. 2 Z = Zytoplasma; K = Kern 3 DNA-Viren mit RNA als Zwischenstufe

16 Strategien zum Abruf und zur Umsetzung der im Genom gespeicherten Information RNA-Synthese Überlappende Transkriptionseinheiten: Bildung von verschiedenen Primär-Transkripten Beispiele: Adenoviridae Hepadnaviridae From Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

17 Strategien zum Abruf und zur Umsetzung der im Genom gespeicherten Information RNA-Prozessierung Editieren der RNA Sequenz: Gezielte Veränderung des Ribonukleotids während oder nach Synthese Beispiele: Paramyxoviridae: Filoviridae: Hepatitis delta Satelliten virus: Ko-transkriptionell Ko-transkriptionell Post-transkriptionell

18 Strategien zum Abruf und zur Umsetzung der im Genom gespeicherten Information Proteinsynthese Leaky Scanning: Start der Translation an verschiedenen Start-Kodons möglich Beispiele: Orthomyxoviridae Paramyxoviridae Polyomaviridae Retroviridae

19 Strategien zum Abruf und zur Umsetzung der im Genom gespeicherten Information Proteinsynthese Wiederbeginn der Translation an einem stromabwärts gelegenen Start-Kodon: Voraussetzung: Strom-Aufwärts gelegenes Start Codon. Beispiele: Orthomyxoviridae Herpesviridae

20 Strategien zum Abruf und zur Umsetzung der im Genom gespeicherten Information Proteinsynthese IRES (internal ribosmal entry site): Bindung von Ribosomen an interne Sequenzen des Transkripts Beispiele: Flaviviridae Picornaviridae

21 Strategien zum Abruf und zur Umsetzung der im Genom gespeicherten Information Proteinsynthese Überlesen von Translations-Stop-Signale Beispiele: Alphaviruses Retroviridae

22 Translationsstrategien von Viren Proteinsynthese von poly-cistronischen mrnas UTR: Untranslated region ORF: Open reading frame Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

23 Regulation der Initiation der Translation: Translationsinitation von zellulären mrnas: Vorrangiger Mechanismus Interaktion der 40S Untereinheit der Ribosomen mit verschiedenen Initiationsfaktoren und mit Met-tRNA i ; Interaktion des Prä-Initiationskomplexes mit der mrna; Scanning der mrna bis zum Start-Codon (oft das erste ATG) Freisetzung der Initiationsfaktoren und Zusammenbau des vollständigen Ribosoms Proteinsynthese

24 Regulation der Initiation der Translation Das RNA Cap : Essentiell für die Translation von vielen mrnas in eukaryotischen Zellen 5 Ende der mrna

25 Regulation der Initiation der Translation: Fig. 11.3A. Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

26 Regulation der Initiation der Translation: Leaky Scanning : Überlesen des ersten Start-Kodons beim Scanning Beispiele: Viral Source Identifier Sequence Proteins flanking first AUG codon SV40 Late 19S mrna UCCaugG VP2 u. VP3 Cellular Hepatitis B Virus capsid proteins 2.1 kb mrna GCCaugC Middle and small surface proteins HIV-1 Spliced mrna CCUaugG Rev and Nef regulatory proteins Glucocorticoid receptor gene Optimal sequence human CUGaugG Long and short trans-activators GCCR*CCaugG Kozak M., Gene 299, 1-34 *R = Purine (A oder G)

27 Regulation der Initiation der Translation: Wiederbeginn der Translation durch erneute Gewinnung von mettrnai durch die an RNA gebundenen 40 S Untereinheit. Voraussetzungen: Stromaufwärts-gelegener offene Leseraster; CMV gp48 Influenza B Virus RNA Segment 7 Stop Start Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

28 Alternative Strategien zur Translationsinitiation IRES: Internal Ribosomal Entry Site Initiation der Translation ist abhängig von einer RNA- Sekundärstruktur, nicht von der CAP-Struktur.

29 Alternative Strategien zur Translationsinitiation: IRES Type I: Poliovirus Type II: Encephalomyocarditis virus From Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

30 Alternative Strategien zur Translationsinitiation: IRES Cap-abhängige Initiation IRES-gesteuerte Initiation Bei Poliovirus: Spaltung von eif4g durch virale protease 2A pro : => Hemmung der zellulären mrna Synthese; Stimulation der Translation an der IRES Fig. 11.3C. Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

31 Schematic representation of the cap-dependent ribosome scanning (left panel) and internal initiation (right panel) pathways for the formation of 80 S initiation complexes Komar, A. A. et al. J. Biol. Chem. 2005;280: ITAF: IRES trans-acting factors

32 Alternative Strategien zur Translationsinitiation: IRES Hepatitis C Virus: Typ III IRES Direkte Bindung von 40S Untereinheit mit IRES Konformationsänderung der 40S Untereinheit => Positionierung des ATG; Bindung von Met-tRNAieiF2-GTP Komplex Translationsstart Fig and 11.3A,C. Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

33 Verwendung von IRES fuer die Molekularbiologie: Koexpression von Selektions-Bzw. Markergenen. Box Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

34 Leserasterverschub Problem: Gag und Protease bzw. Gag und Protease und Pol werden von unterschiedlichen Lesrastern kodiert. Lösung: kontrolliertes Rutschen der Ribosomen in ein anderes Leseraster.

35 Programmierter -1 Leserasterverschub Gag-Protein Leserasterverschub: Gag-Protease-Pol Gag; 1. Leserasterverschub: Gag-Protease 2. Leserasterverschub: Gag-Protease-Pol

36 FIGURE 1. Overview of programmed -1 ribosomal frameshifting Linker Region Rutsch-Stelle: X XXY YYZ G GGA AAC XXX: 3 identische Nukleotide YYY: 3 identische Nukleotide Z: A,C oder U; nicht G Ribosom pausiert während der Elongation Pseudoknoten Verlagerung des Ribosoms um eine Position in 5 Richung EWAN P. PLANT et al. RNA 2003; 9: Verschiebung des Leserasters; Auflösen des Pseudoknotens

37 Leserasterverschub bei dem SARS-Coronavirus. S: Spike; E: Envelope; N: Nucleocapsid; M: membrane protein; ORF, X: weitere Leseraster. Ramos, FD et al., 2004, BiochemSoc Transact.32,

38 RNA Pseudoknoten Strukturen in verschiedenen Coronaviren. Ramos, FD et al., 2004, BiochemSoc Transact.32,

39 Modell für den Beitrag von Pseudoknoten zum Leserasterverschub. EWAN P. PLANT et al. RNA 2003; 9:

40 Überlesen vom Terminations-Kodon: Murines Leukämie Virus Gag Pro Pol Pseudoknoten Staple DW and Butcher SE 2005.PLoS 3, Fig Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

41 Die Wunderwaffe der Viren Regulationsfaktoren Aufgaben: Aktivierung/Hemmung der Expression von viralen Proteinen; Priming der Zelle für die Virusreplikation; Zeitliche Koordination der Virusreplikation Gemeinsame Eigenschaften Multifunktionell; Interagieren mit vielen verschiedenen Proteinen

42 Virale Transkriptionsaktivatoren Beispiele von viralen Transkriptions-Regulatoren, die keine Sequenz-spezifische DNA Bindung zeigen. Faktor Virus Interaktion mit Effekt zellulären DNAbindenden Proteinen E1A Adenovirus TFIID Aktivierung/Repression (289; 243 AS) Tax HTLV CREB VP16 Herpes OCT-1 Aktivierung simplex virus EBNA2 EBV RBP-J Aktivierung

43 Virale Transkriptionsaktivatoren Beispiele von viralen Transkriptions-Regulatoren, die an spezifische Nukleinsäure Signale binden. Faktor Virus Wirkung Effekt durch direkte Bindung an Signale in Nukleinsäuren ICP4 Herpesvirus DNA Aktivierung/Repression T-Antigen Polyomavirus DNA Aktivierung (spät Gene); Repression (frühe Gene) Tat HIV RNA Aktivierung

44 Einige Grundlagen zur Transkription: Der Promoter Aus Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

45 Einige Grundlagen zur Transkription: Beipiele für virale Promotoren Fig. 8.4 Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

46 Beispiel eines wichtigen zellulären Transkriptionsfaktors: NFkappaB Fig. 8.6A aus Principles of Virology ;SJ. Flint, L.W. Enquist, V.R. Racaniello, A.M. Skalka;ASM Press; 2004; 2nd Edition

47 Beispiel eines wichtigen zellulären Transkriptionsfaktors Beispiele für virale Promotoren die durch NFkappaB aktiviert werden: HTLV-I HIV-1 SV40

48 Beispiel eines viralen Transkriptionsregulators: Polyoma T-Antigen Aus Fields Virology, D.M.Knipe, P.M. Howley, Lippincott Williams & Wilkins.2001, p

49 Die Kontrollregion im SV40 Genom Aus Fields Virology, D.M.Knipe, P.M. Howley, Lippincott Williams & Wilkins.2001, p

50 Beispiel eines viralen Transkriptionsregulators: HSV VP16 VP molecules α-genes Immediate early Latency β-genes early + - γ-genes late Virus particle:http://www.stdgen.lanl.gov/stdgen/bacteria/hhv1/herpes.html

51 VP16 funktioniert als Komplex mit zellularen Faktoren Acidic activation domain HCF-1: human factor C1 Oct-1: Octamer 1 transcription factor Wysocka J and Herr W TIBS 28, POU domains

52 VP16 Domänen AD: Transkriptions-Aktivierungsdomäne Core-Domäne: Essentiell für die Bildung von VIC (VP16-induced complex); Interagiert mit Oct-1 und HCF-1; Nur schwache DNA Bindung alleine; Sequenz konserviert zwischen verschiedenen α-herpesviren; Wysocka J and Herr W TIBS 28,

53 Zelluläre Partner von VP16: der POU-Transkriptionsfaktor Oct-1 POU-Homeo Domain POU-Specific Domain flexibler Linker Wysocka J and Herr W TIBS 28,

54 Zelluläre Partner von VP16: HCF-1 POU-Homeo Domain POU-Specific Domain flexibler Linker Wysocka J and Herr W TIBS 28,

55 Spezifität der Transkriptions-Aktivierung der Expression von α-genen durch VIC Spezies-Spezifische DNA Bindung durch Vp16 Spezifische Interaktion mit Oct-1, nicht OCT-2 Spezifische Aktivierung mit HCF-1, nicht HCF-2 Wysocka J and Herr W TIBS 28,

56 VIC: Warum so kompliziert? Mögliche Erklärung: Oct-1 und HCF-1 sind wichtig für die Zellproliferation; Durch die Interaktion mit diesen beiden Faktoren tastet VP16 die Bereitschaft der Zelle für die Virusreplikation ab (lytische Phase).

Virale Expressionsstrategien

Virale Expressionsstrategien Virale Expressionsstrategien Ziel: Abruf der im Genom gespeicherten Information zur richtigen Zeit und in der richtigen Menge Genomgrössen von verschiedenen sequenzierten Organismen Amoeba dubia 670 billion

Mehr

Translationsstrategien

Translationsstrategien Translationsstrategien Hans-Georg Kräusslich Abteilung Virologie, Universitätsklinik Heidelberg 16.5.2006 Mechanismen eukaryontischer Translation Cap-abhängige Initiation IRES-Elemente und cap-unabhängige

Mehr

RNA-Prozessierung Hans-Georg Kräusslich Abteilung Virologie 08.05.07

RNA-Prozessierung Hans-Georg Kräusslich Abteilung Virologie 08.05.07 RNA-Prozessierung Hans-Georg Kräusslich Abteilung Virologie 08.05.07 Hinzufügen von Sequenzen 5 cap 3 PolyA Einige nt durch Editing Entfernen von Sequenzen Splicing von Introns Degradation Sequenzänderung

Mehr

Pathogenese und Virus-Zell-Interaktionen

Pathogenese und Virus-Zell-Interaktionen Pathogenese und Virus-Zell-Interaktionen Capsid (Protein) Nukleokapsid Virion Genom (Nukleinsäure) Nukleokapsid Virion Envelope (Hülle) (Assembly) (Assembly) (Release) (Assembly) (Release) (Budding)

Mehr

M. Müller, SoSe 2005 AUFBAU UND STRUKTUR

M. Müller, SoSe 2005 AUFBAU UND STRUKTUR AUFBAU UND STRUKTUR AUFBAU UND STRUKTUR VIREN SIND EINFACH AUFGEBAUT RNA DNA Capsid = Coat (Protein) Membran = Envelope (Glykoproteine, Lipide, Reste von Wirtszell- Membran) AUFBAU UND STRUKTUR VIRUSGENOME:

Mehr

Inhalt. 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien

Inhalt. 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien Viren Inhalt 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien Einleitung 1 VERÄNDERLICHKEIT Infektion Genom Struktur - Viren infizieren alle Lebensformen: Archea, Eubakterien, Eukaryoten (Einzeller,

Mehr

Inhalt. Picornaviren Human Rhinovirus. 1 Einleitung. 3 Die Polyproteinsynthese 4 Die 3C Protease und ihre Funktionen 5 Zusammenfassung 6 Glossar

Inhalt. Picornaviren Human Rhinovirus. 1 Einleitung. 3 Die Polyproteinsynthese 4 Die 3C Protease und ihre Funktionen 5 Zusammenfassung 6 Glossar 04.05.2009 Picornaviren Human Rhinovirus Dagmar Kuhn 1 Einleitung Inhalt 2 Aufbau und Funktion des Human Rhinovirusi 3 Die Polyproteinsynthese 4 Die 3C Protease und ihre Funktionen 5 Zusammenfassung 6

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Adenoviridae. Genera. Spezies

Adenoviridae. Genera. Spezies Adenoviridae Davison AJ et al., 2003, JGenVirol 84, 2895-2908; Fig. 1 Spezies Genera Wirtsorgansimen: B: Bovine C: canine D: duck E :equine F: fowl Fr:frog H: human M: murine O: ovine P: porcine Po: possum

Mehr

Der Replikationszyklus Virusreplikation kann in 8 Phasen eingeteilt werden

Der Replikationszyklus Virusreplikation kann in 8 Phasen eingeteilt werden 1MULTIPLICATION Der Replikationszyklus Virusreplikation kann in 8 Phasen eingeteilt werden Anlagerung -Anheftung -Adsorption Eindringen -Penetration Freisetzung der viralen Nukleinsäuren -Uncoating Expression

Mehr

O H C N S

O H C N S Virus-Replikation C 332.662 H 492.338 N 98.245 O 131.196 P 7.500 S 2.340 Capsid (Protein) Nukleokapsid Virion Genom (Nukleinsäure) Nukleokapsid Virion Envelope (Hülle) Virus-Replikation Replikation =

Mehr

Virale Infektionen Infektionsmuster. Zellbiologische Definitionen

Virale Infektionen Infektionsmuster. Zellbiologische Definitionen Virale Infektionen Zellbiologische Definitionen 1. Infektion: Eintritt eines Replikations-fähigen viralen Genoms in die Zelle. Die Infektion kann aber muss nicht zur Vermehrung des Virus führen. Epitheliale

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Der Replikationszyklus Virusreplikation kann in 8 Phasen eingeteilt werden

Der Replikationszyklus Virusreplikation kann in 8 Phasen eingeteilt werden 1MULTIPLICATION Der Replikationszyklus Virusreplikation kann in 8 Phasen eingeteilt werden Anlagerung -Anheftung -Adsorption Eindringen -Penetration Freisetzung der viralen Nukleinsäuren -Uncoating Expression

Mehr

Virusgenome und virale Replikationsstrategien

Virusgenome und virale Replikationsstrategien Virusgenome und virale Replikationsstrategien Hans-Georg Kräusslich, Abteilung Virologie http://virology.hyg.uni-heidelberg.de 2. Mai 2006 Grundzüge der viralen Replikation Genomaufbau und Replikationsstrategien

Mehr

Adenoviridae. Genera. Spezies

Adenoviridae. Genera. Spezies Adenoviridae Davison AJ et al., 2003, JGenVirol 84, 2895-2908; Fig. 1 Spezies Genera Wirtsorgansimen: B: Bovine C: canine D: duck E :equine F: fowl Fr:frog H: human M: murine O: ovine P: porcine Po: possum

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

RNA DNA VIREN SIND EINFACH AUFGEBAUT. Membran = Envelope (Glykoproteine, Lipide, Reste von Wirtszell- Membran) Capsid = Coat (Protein)

RNA DNA VIREN SIND EINFACH AUFGEBAUT. Membran = Envelope (Glykoproteine, Lipide, Reste von Wirtszell- Membran) Capsid = Coat (Protein) VIREN SIND EINFACH AUFGEBAUT RNA DNA Capsid = Coat (Protein) Membran = Envelope (Glykoproteine, Lipide, Reste von Wirtszell- Membran) AUFBAU UND STRUKTUR VIRUSGENOME: DNA ODER RNA SS = Einzelsträngig +

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Polyomaviridae. Taxonomie Ehemals Unterfamilie der Papovaviridae; Jetzt unabhängige Virusfamilie mit 13 Mitgliedern

Polyomaviridae. Taxonomie Ehemals Unterfamilie der Papovaviridae; Jetzt unabhängige Virusfamilie mit 13 Mitgliedern Polyomaviridae Taxonomie Ehemals Unterfamilie der Papovaviridae; Jetzt unabhängige Virusfamilie mit 13 Mitgliedern Mitglieder der Polyomaviridae Virus Wirt Polyomavirus (PyV) Maus K-Papovavirus (KPV) Simian

Mehr

Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende

Mehr

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird..

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird.. Proteinbiosynthese Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Alle Proteine, sind über die DNA codiert Wobei jeweils eine AS von 3 Basen codiert wird.. GENETISCHER CODE

Mehr

Transkription Teil 2. - Transkription bei Eukaryoten -

Transkription Teil 2. - Transkription bei Eukaryoten - Transkription Teil 2 - Transkription bei Eukaryoten - Inhalte: Unterschiede in der Transkription von Pro- und Eukaryoten Die RNA-Polymerasen der Eukaryoten Cis- und trans-aktive Elemente Promotoren Transkriptionsfaktoren

Mehr

Infos zur Virologie und Zellbiologie: Internet

Infos zur Virologie und Zellbiologie: Internet Infos zur Virologie und Zellbiologie: Internet http://www.ncbi.nlm.nih.gov/entrez/query.fcgi Infos zur Virologie und Zellbiologie: Weitere Bücher VORLESUNGSPLAN Thema Datum Stunden/Lektor Ort Transformation

Mehr

Infos zur Virologie und Zellbiologie: Internet

Infos zur Virologie und Zellbiologie: Internet Infos zur Virologie und Zellbiologie: Internet http://www.ncbi.nlm.nih.gov/entrez/query.fcgi Infos zur Virologie und Zellbiologie: Weitere Bücher VORLESUNGSPLAN Thema Datum Stunden/Dozent Transformation;

Mehr

Molekulargenetik der Eukaryoten WS 2014/15, VL 11. Erwin R. Schmidt Institut für Molekulargenetik

Molekulargenetik der Eukaryoten WS 2014/15, VL 11. Erwin R. Schmidt Institut für Molekulargenetik Molekulargenetik der Eukaryoten WS 2014/15, VL 11 Erwin R. Schmidt Institut für Molekulargenetik Abhängig von der Genklasse: Genstruktur der Eukaryoten 1. RNA Pol I Gene: 18S, 5,8S, 28S rrna 2. RNA Pol

Mehr

Infos zur Virologie und Zellbiologie: Internet

Infos zur Virologie und Zellbiologie: Internet Infos zur Virologie und Zellbiologie: Internet http://www.ncbi.nlm.nih.gov/entrez/query.fcgi Infos zur Virologie und Zellbiologie: Weitere Bücher VORLESUNGSPLAN Thema Datum Stunden/Lektor Ort Transformation;

Mehr

KV: Translation Michael Altmann

KV: Translation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Translation Michael Altmann Herbstsemester 2008/2009 Übersicht VL Translation 1.) Genexpression 2.) Der genetische Code ist universell 3.) Punktmutationen

Mehr

Viren, Retroviren und endogene Retroviren

Viren, Retroviren und endogene Retroviren Viren, Retroviren und endogene Retroviren Biochemie Tabakmosaic- Virus Bakteriophage T4 1 Arten von Viren I DNA-Viren: Doppelsträngige DNA Viren: Herpes/Adeno-Viren Einzelsträngige DNA Viren: Parvoviren

Mehr

Posttranskriptionale RNA-Prozessierung

Posttranskriptionale RNA-Prozessierung Posttranskriptionale RNA-Prozessierung Spaltung + Modifikation G Q Spleissen + Editing U UUU Prozessierung einer prä-trna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende

Mehr

Einführung in die Virologie

Einführung in die Virologie Allgemeine Pathologie Einführung in die Virologie 2. Jahr Vetsuisse Curriculum FS 2017 cornel.fraefel@uzh.ch Programm 1. Was sind Viren Wie sind sie aufgebaut? Wie vermehren sie sich? 2. Wie machen Viren

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Polyomaviridae. Taxonomie Ehemals Unterfamilie der Papovaviridae; Jetzt unabhängige Virusfamilie mit 13 Mitgliedern

Polyomaviridae. Taxonomie Ehemals Unterfamilie der Papovaviridae; Jetzt unabhängige Virusfamilie mit 13 Mitgliedern Polyomaviridae Taxonomie Ehemals Unterfamilie der Papovaviridae; Jetzt unabhängige Virusfamilie mit 13 Mitgliedern Mitglieder der Polyomaviridae Virus Wirt Polyomavirus (PyV) Maus K-Papovavirus (KPV) Simian

Mehr

Kai Lieder (Autor) Interface-Peptide der viralen Protease von HIV-1 als gentherapeutisch einsetzbare antivirale Substanzen

Kai Lieder (Autor) Interface-Peptide der viralen Protease von HIV-1 als gentherapeutisch einsetzbare antivirale Substanzen Kai Lieder (Autor) Interface-Peptide der viralen Protease von HIV-1 als gentherapeutisch einsetzbare antivirale Substanzen https://cuvillier.de/de/shop/publications/3410 Copyright: Cuvillier Verlag, Inhaberin

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht

Mehr

GV III, WS11/12 Teil Virologie

GV III, WS11/12 Teil Virologie GV III, WS11/12 Teil Virologie Prof. Ralf Bartenschlager Department Infektiologie, Molekulare Virologie, Med. Fakultät Heidelberg www.klinikum.uni-heidelberg.de/molecular-virology R.B. Mi 18.1.12 Geschichte

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler

Mehr

BCDS - Biochemische Datenbanken und Software

BCDS - Biochemische Datenbanken und Software BCDS - Biochemische Datenbanken und Software Seminarinhalte Bioinformatische Genom- und Proteomanalyse Literaturrecherche und Zitation Naturwissenschaftliche Software Termine 25. Mai, 1. Juni, 8. Juni,

Mehr

Grundlagen Virologie J. Kühn

Grundlagen Virologie J. Kühn Grundlagen Virologie J. Kühn Virosphäre Häufigkeit von Viren wird dramatisch unterschätzt ca. 3x10 9 Viruspartikel/l Meerwasser ca. 4x10 30 Viruspartikel in den Ozeanen dies entspricht ca. 8x10 8 Tonnen

Mehr

DNA Viren 5 Familien mit ds-dna Genom

DNA Viren 5 Familien mit ds-dna Genom DNA Viren 5 Familien mit ds-dna Genom Papovaviridae* kubisch nackt Adenoviridae * ds umhüllt Herpesviridae * komplex umhüllt Poxviridae * DNA partiell ds kubisch umhüllt Hepadnaviridae * ss kubisch nackt

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011 Institut für Biochemie und Molekulare Medizin Lecture 1 Translational components Michael Altmann FS 2011 Gene Expression Fliessdiagramm der eukaryotischen Genexpression Die Expression eines Gens kann auf

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Inhalt. Entdeckung und allgemeine Informationen. Klassifizierung. Genom Viren untypische Gene Tyrosyl-tRNA Synthetase. Ursprung von grossen DNA Viren

Inhalt. Entdeckung und allgemeine Informationen. Klassifizierung. Genom Viren untypische Gene Tyrosyl-tRNA Synthetase. Ursprung von grossen DNA Viren Mimivirus Inhalt Entdeckung und allgemeine Informationen Klassifizierung Genom Viren untypische Gene Tyrosyl-tRNA Synthetase Ursprung von grossen DNA Viren Entstehung von Eukaryoten Entdeckung 1992 in

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Genexpressionsregulation

Genexpressionsregulation Genexpressionsregulation Genexpressionsregulation Different tissue types 1 2 3 4 5 6 7 8 Taken from Caron et al., 2001 Verschiedene Ebenen der Genexpressionsregulation Epigenetic mechanisms Transkriptionskontrolle

Mehr

Zentrales Dogma der Biologie

Zentrales Dogma der Biologie Zentrales Dogma der Biologie Transkription: von der DNA zur RNA Biochemie 01/1 Transkription Biochemie 01/2 Transkription DNA: RNA: Biochemie 01/3 Transkription DNA: RNA: Biochemie 01/4 Transkription RNA:

Mehr

1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie:

1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: 1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: - 5 UTR (leader) - 3 UTR (trailer) - Terminator - Stopp-Kodon - Initiationskodon - Transkriptionsstartstelle

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Philipp Odermatt Inhalt. Das Virion Replikation DNA Injektion

Philipp Odermatt Inhalt. Das Virion Replikation DNA Injektion 11.05.2009 Philipp Odermatt 12.5.2009 Inhalt Allgemeine Informationen Das Virion Replikation DNA Injektion 1 11.05.2009 Allgemeine Informationen Familie: Podoviridae ds DNA Virus (~40000 bp) Infiziert

Mehr

Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt. Abb. aus Stryer (5th Ed.)

Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt. Abb. aus Stryer (5th Ed.) Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt Die Initiation der Translation bei Eukaryoten Der eukaryotische Initiationskomplex erkennt zuerst das 5 -cap der mrna und

Mehr

Human Papilloma Virus

Human Papilloma Virus Human Papilloma Virus Gliederung Allgemeine Informationen Virusstruktur Infektion Verschiedene Arten des Infektionsverlaufs nach Infizierung mit HPV Lebenszyklus des HPV Tumorinduktion Virusstruktur Papillomaviren

Mehr

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird Molekularbiologie 6c Proteinbiosynthese Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird 1 Übersicht: Vom Gen zum Protein 1. 2. 3. 2 Das Dogma

Mehr

Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Informationsgehalt von DNA

Informationsgehalt von DNA Informationsgehalt von DNA Topics Genes code, gene organisation, signals, gene detection Genomes genome organisation, nucleotide patterns, junk DNA DNA als Informationsträger DNA Building Blocks Desoxyribose

Mehr

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren...

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... Molekulargenetik Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... 2 Beschreiben, wie die DNA aufgebaut ist... 3 Den Ablauf der Replikation erklären und dabei die

Mehr

Christian Thoma: Schnelle Regulation durch Translationskontrolle

Christian Thoma: Schnelle Regulation durch Translationskontrolle Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/christian-thoma-schnelleregulation-durch-translationskontrolle/ Christian Thoma: Schnelle Regulation durch Translationskontrolle

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Die Familie der Herpesviridae

Die Familie der Herpesviridae Die Familie der Unterfamile Genus Vertreter (Mensch) α-herpesvirinae Simplexvirus Humanes Herpesvirus 1 (Herpessimplex-Virus-1) Humanes Herpesvirus 2 (Herpessimplex-Virus-2) Varicellovirus Humanes Herpesvirus

Mehr

Tobler Ackermann Fraefel Allgemeine Virologie. basics

Tobler Ackermann Fraefel Allgemeine Virologie. basics Tobler Ackermann Fraefel Allgemeine Virologie basics 20 Einführung in die Virologie GFP-Fluoreszenz auch in lebenden Zellen nachgewiesen werden. GFP kann mit den meisten anderen Proteinen (auch Virusproteinen),

Mehr

KV: Genexpression und Transkription Michael Altmann

KV: Genexpression und Transkription Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Genexpression und Transkription Michael Altmann Herbstsemester 2008/2009 Übersicht VL Genexpression / Transkription 1.) Was ist ein Gen? 2.) Welche Arten

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Kriterien der Einteilung von RNA Viren entsprechend Ihrer Genomorganisation

Kriterien der Einteilung von RNA Viren entsprechend Ihrer Genomorganisation Kriterien der Einteilung von RNA Viren entsprechend Ihrer Genomorganisation einzelsträngig (+)-Polarität (-)-Polarität ambisense Poliovirus segmentiert Arenavirus Influenza A Virus nicht segmentiert vesicular

Mehr

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien helmut.dolznig@meduniwien.ac.at www.meduniwien.ac.at/medizinische-genetik

Mehr

Ultrastruktur von Viren

Ultrastruktur von Viren PD Dr. Jürgen Stech juergen.stech@fli.de Ultrastruktur von Viren QUELLEN: Fields Virology 5 th Edition Flint Principles of Virology Bozzola & Russell Electron Microscopy Rolle & Mayr PDF der Vorlesung

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Papillomaviridae. Typ. 16 Genera 118 Typen. Spezies. Papillomaviridae. Molekulare Virologie

Papillomaviridae. Typ. 16 Genera 118 Typen. Spezies. Papillomaviridae. Molekulare Virologie Typ 16 Genera 118 Typen Spezies 45-60 % 60-70 % 75-90 % > 90 % De Villiers et al.,2004, Virology 324,17-27. Papillomavirus Besonderes Merkmal: Sehr ausgeprägte Wirts- und Gewebe-Spezifität: Replikation

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Genaktivierung und Genexpression

Genaktivierung und Genexpression Genaktivierung und Genexpression Unter Genexpression versteht man ganz allgemein die Ausprägung des Genotyps zum Phänotyp einer Zelle oder eines ganzen Organismus. Genotyp: Gesamtheit der Informationen

Mehr

Phage-Display. Übersicht. Allgemeine Einführung Phage M13 Vektoren Bibliotheken Selektionsablauf Anwendungsmöglichkeiten.

Phage-Display. Übersicht. Allgemeine Einführung Phage M13 Vektoren Bibliotheken Selektionsablauf Anwendungsmöglichkeiten. Phage-Display Thomas Haarmann AG Dietrich Methodenseminar Biochemie II 20.01. und 10.02.2009 Übersicht Allgemeine Einführung Phage M13 Vektoren Bibliotheken Selektionsablauf Anwendungsmöglichkeiten Phage-Display

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion

Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion Modifiziertes Funktion Funktionen Protein des Target Ubiquitinierung Phytochrom Polyubi.: (Ubiquitylierung) AUX/IAA EIN2 Auxin-Signaltransduktion Transkriptionsfaktor in der Ethylen-Signaltransduktion

Mehr

Inhalt Genexpression Microarrays E-Northern

Inhalt Genexpression Microarrays E-Northern Inhalt Genexpression Microarrays E-Northern Genexpression Übersicht Definition Proteinbiosynthese Ablauf Transkription Translation Transport Expressionskontrolle Genexpression: Definition Realisierung

Mehr

Genregulation bei Eukaryoten II

Genregulation bei Eukaryoten II Genregulation bei Eukaryoten II Aktivierung und Repression der Transkription erfolgen durch Protein-Protein-Wechselwirkungen Protein-Protein-Wechselwirkungen spielen bei der Genregulation der Eukaryoten

Mehr

Promotor kodierende Sequenz Terminator

Promotor kodierende Sequenz Terminator 5.2 Genexpression Sequenz in eine RNA-Sequenz. Die Enzyme, die diese Reaktion katalysieren, sind die DNA-abhängigen RNA-Polymerasen. Sie bestehen aus mehreren Untereinheiten, die von den Pro- bis zu den

Mehr

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01.

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. Thema: Eukaryotische Genregulation und RNA- Prozessierung Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. 2013 Worin unterscheiden sich die Gene bzw. die Genprodukte von Eukaryoten

Mehr

Mechanismen funktioneller Varianten: die Liste wächst

Mechanismen funktioneller Varianten: die Liste wächst Mechanismen funktioneller Varianten: die Liste wächst Martin Hersberger Abteilung für Klinische Chemie und Biochemie Universitäts-Kinderspital Zürich Genetische Varianten gestern Funktionelle Varianten

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation

Mehr

Transkription 3. Teil. Posttranskriptionale Modifikationen

Transkription 3. Teil. Posttranskriptionale Modifikationen Transkription 3. Teil Posttranskriptionale Modifikationen Gliederung des Vortrags 1. Reifung der t-rna 2. Modifikationen der Prä-mRNA 5 Capping 3 Schwanzbildung RNA-Editing Spleißen Alternatives Spleißen

Mehr

Vorlesung. Virologie

Vorlesung. Virologie Vorlesung Allgemeiner Teil Geschichtlicher Überblick Virus: Definition, Aufbau, Einteilung Virusvermehrung / Replikation Pathogenese / Zellschädigung Immortalisierung / Transformation Kurzversion: Immunologie

Mehr

Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: http://tinyurl.com/modul-mms http://www.pnas.org/content/111/14/5427/f1.large.jpg neues Modell

Mehr

05_10_Genes_info.jpg

05_10_Genes_info.jpg Übertragung der Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2 Molecular Biology of the

Mehr

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.)

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.) Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen Die verschiedenen Ribosomen-Komplexe können im Elektronenmikroskop beobachtet werden Durch Röntgenkristallographie wurden

Mehr

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz 1. Nennen Sie die verschiedenen RNA-Typen, die bei der Translation wichtig sind. Erklären Sie die Funktion der verschiedenen RNA-Typen. Skizzieren Sie die Struktur der verschiedenen RNA-Typen und bezeichnen

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Transformation und Onkogenese

Transformation und Onkogenese Molekulare Mechanismen der Pathogenese bei Infektionskrankheiten Transformation und Onkogenese Ralf Bartenschlager Abteilung Molekulare Virologie, Hygiene Institut INF345, 1. OG http://molecular-virology.uni-hd.de

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

Medizinische Virologie

Medizinische Virologie Medizinische Virologie Grundlagen, Diagnostik, Prävention und Therapie viraler Erkrankungen Bearbeitet von Hans W. Doerr, Wolfram Gerlich 1. Auflage 2009. Buch. XVI, 760 S. Hardcover ISBN 978 3 13 113962

Mehr