Medienmitteilung. Basel, Schweiz, und Cambridge, MA, USA 19. Juni 2012

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Medienmitteilung. Basel, Schweiz, und Cambridge, MA, USA 19. Juni 2012"

Transkript

1 Medienmitteilung Basel, Schweiz, und Cambridge, MA, USA 19. Juni 2012 Roche und Seaside Therapeutics geben wegweisende Partnerschaft zur Entwicklung neuartiger Therapien für Fragile-X-Syndrom und Autismus- Spektrum-Störungen bekannt Roche (SIX: RO, ROG; OTCQX: RHHBY) und Seaside Therapeutics gaben heute den Abschluss einer Kooperationsvereinbarung bekannt, um krankheitsmodifizierende Therapien für das Fragile-X-Syndrom (FXS) und Autismus-Spektrum-Störungen (ASD) zu entwickeln. Beides sind neurologische Entwicklungsstörungen, für die es bisher keine wirksamen pharmakologischen Behandlungen zur Linderung der wichtigsten Symptome gibt. Diese Partnerschaft soll die Forschung und Entwicklung von FXS und ASD beschleunigen und einem grundlegenden Wandel für die Behandlung dieser Krankheiten den Weg bahnen, indem Therapeutika entwickelt werden, die gezielt an den molekularen Grundlagen und damit auch an den Hauptsymptomen dieser Neuroentwicklungsstörungen ansetzen. Gemäss der Vereinbarung wird Roche von Seaside exklusive Patentlizenzen für die Anwendung von mglur5- Antagonisten zur Behandlung neurologischer Entwicklungsstörungen erhalten. Roche wird die Entwicklung und Vermarktung dieser Substanzen für die Behandlung des Fragile-X-Syndroms und von Autismus-Spektrum- Störungen leiten. Für den mglur5-arzneimittelkandidaten RG7090 von Roche werden zurzeit Patienten mit Fragile-X-Syndrom in eine klinische Phase-2-Studie aufgenommen. Seaside wird sein Programm mit GABA-B-Agonisten weiterentwickeln und behält die exklusiven Rechte an bereits erteilten und angemeldeten Patenten für die Anwendung von GABA-B-Agonisten zur Behandlung von Autismus-Spektrum-Störungen und Fragile-X-Syndrom. Für den GABA-B-Wirkstoffkandidaten STX209 von Seaside werden derzeit Patienten in Phase-3-Studien bei Fragile-X-Syndrom aufgenommen, und vor kurzem wurde die Patientenrekrutierung für eine Phase-2b-Studie bei Autismus-Spektrum-Störungen abgeschlossen. Roche kann nach Abschluss bestimmter klinischer Entwicklungsphasen bei FXS und ASD Optionen für die Vermarktung von STX209 ausüben, doch Seaside wird auch weiterhin die Federführung für die klinische Entwicklung dieser Programme behalten. Weitere Bedingungen der Transaktion werden nicht bekannt gegeben. 1/5

2 Roche setzt sich dafür ein, neue Behandlungsmöglichkeiten für Krankheiten zu finden, für die es einen grossen Bedarf an neuen Medikamenten gibt. Dazu gehören z. B. Autismus-Spektrum-Störungen, so Luca Santarelli, globaler Leiter von Roche Neuroscience. Neue Entdeckungen in der Genetik geben Aufschluss über die biologischen Mechanismen, die diesen Krankheiten zugrunde liegen, und schaffen dadurch die Grundlage für eine gezielte Arzneimittelentdeckung. Um eine führende Position in diesem Bereich zu erreichen, vereinbarten wir eine solide Partnerschaft mit Seaside Therapeutics, einem Unternehmen, das erfolgreich neue Wege der Forschung und Entwicklung in diesem noch kaum erforschten Therapiegebiet beschreitet. Diese Zusammenarbeit ist ein echter Gewinn für die Patienten und ihre Betreuer sie vereint führende Forscher und Organisationen in dem erklärten Ziel, bahnbrechende Medikamente für die Behandlung von Autismus und Fragile-X-Syndrom rasch voranzubringen, so Randy Carpenter, MD, Präsident und Chief Executive Officer von Seaside Therapeutics. Wichtig ist auch, dass Seaside durch diese Zusammenarbeit die notwendigen zusätzlichen Mittel erhält, um die Spätphase der klinischen Entwicklung von STX209 erfolgreich abzuschliessen. Wir sind fest davon überzeugt, dass STX209 das Potenzial hat, die Behandlung von Fragile X und Autismus auf eine völlig neue Basis zu stellen und so den Patienten und ihren Angehörigen zu einer besseren Lebensqualität zu verhelfen. Der Begriff Autismus-Spektrum-Störungen (ASD) umfasst eine Gruppe von rätselhaften kognitiven Störungen, darunter Autismus und Asperger-Syndrom, die die soziale Interaktions- und Kommunikationsfähigkeit beeinträchtigen. Das Fragile-X-Syndrom (FXS) ist eine seltene Erbkrankheit, deren Symptome den ASD sehr stark ähneln, weshalb dieser Erkrankung ein ähnlicher ursächlicher Mechanismus zugrunde liegen könnte. Da bisher keine zugelassenen medikamentösen Therapien zur Linderung der Hauptsymptome beider Erkrankungen zur Verfügung stehen, besteht nach wie vor hoher Bedarf an neuen wirksamen Medikamenten. Die von Roche und Seaside Therapeutics entwickelten Substanzen versprechen, die besten Präparate ihrer Klasse zu werden, denn sie greifen zielgerichtet in die Glutamat- und GABA-Signalgebung ein, um die synaptische Übertragung von Nervenimpulsen bei Patienten mit ASD und FXS wiederherzustellen. - ### - Über mglur5 Bei der häufigsten erblichen Form von Autismus spielt ein Gen, das für das Fragile X Mental Retardation Protein (FMRP) kodiert, eine wichtige Rolle. Ein Funktionsverlust von FMRP unterbricht die Signalweiterleitung zwischen Nervenzellen im Gehirn und führt zu ausgedehnten Hirnanomalien und geistiger Retardierung. Normalerweise wird FMRP durch mglur5, einen wichtigen Rezeptor im Gehirn, der an Hirnleistungen wie Lernen und Gedächtnis beteiligt ist, im Gleichgewicht gehalten. Wenn FMRP beeinträchtigt ist, geht dieses Gleichgewicht verloren, da der Gegenspieler der mglur5-aktivität fehlt. Erste Ergebnisse einer klinischen Studie 2/5

3 deuten darauf hin, dass Medikamente, die die Aktivität von mglur5 unterdrücken, Kindern mit Fragile-X- Syndrom helfen können. (Quelle: sfari) Über Seaside Therapeutics Seaside Therapeutics befasst sich mit Therapien, die den Krankheitsverlauf bei Autismus, Fragile-X-Syndrom und anderen neurologischen Entwicklungsstörungen aufhalten oder lindern. Mit diesem Ziel setzt das Unternehmen bahnbrechende Entdeckungen im Bereich der Neurobiologie in Therapeutika um, die das Leben von Patienten und ihrer Angehörigen verbessern. Es gibt zwar Behandlungsmöglichkeiten, die einige Symptome von Neuroentwicklungsstörungen lindern können, doch Medikamente, die an den zugrundeliegenden Ursachen ansetzen, stehen bisher noch nicht zur Verfügung. Seaside Therapeutics setzt auf wissenschaftliche Methoden, um diese unbefriedigten medizinischen Bedürfnisse zu erfüllen und die Arzneimittelentwicklung neu auszurichten. Hierbei konzentriert sich das Unternehmen auf monogenetische Erkrankungen (Ein-Gen-Erkrankungen), die häufig mit Autismus einhergehen, wie z. B. das Fragile-X-Syndrom. Weitere Informationen finden Sie unter Über STX209 von Seaside Therapeutics STX209 ist ein oral verabreichter selektiver Agonist für Rezeptoren von Gammaaminobuttersäure Typ B (GABA-B). Die Krankheitsmerkmale bei bestimmten neurologischen Entwicklungsstörungen, wie z. B. Autismus-Spektrum-Störungen und Fragile-X-Syndrom, werden vermutlich durch eine Überaktivierung von Glutamat-Rezeptoren und ein ungewöhnlich hohes Verhältnis von erregender zu hemmender Neurotransmission (Übertragung von Nervenimpulsen) im Gehirn verursacht. GABA-B-Rezeptoren spielen eine wichtige Rolle bei der Modulation der Freisetzung von Glutamat und der Optimierung des Verhältnisses von erregender zu hemmender Neurotransmission. STX209 hat sich in präklinischen Untersuchungsmodellen als wirksam erwiesen, was darauf hindeutet, dass es die Gehirnfunktionen von Patienten mit Autismus-Spektrum- Störungen und Fragile-X-Syndrom verbessern könnte. Seaside Therapeutics hat mit STX209 die grösste randomisierte, verblindete, placebokontrollierte Studie (Phase 2) bei Patienten mit Fragile-X-Syndrom und eine offene, explorative Phase-2a-Studie bei Patienten mit Autismus-Spektrum-Störungen erfolgreich abgeschlossen. In zwei Phase-3-Studien eine bei Jugendlichen und Erwachsenen (im Alter von 12 bis 50 Jahren) und eine bei Kindern (im Alter von 5 bis 11 Jahren) mit Fragile-X-Syndrom werden zurzeit Teilnehmer rekrutiert. Die Aufnahme der Patienten in eine Phase-2b-Studie bei Kindern, Jugendlichen und Erwachsenen (im Alter von 5 bis 21 Jahren) mit Autismus-Spektrum-Störungen wurde vor kurzem abgeschlossen. Über die Aktivitäten von Roche im Bereich der Autismus-Spektrum-Störungen Roche engagiert sich sehr stark im Bereich der neurologischen Entwicklungsstörungen. Insbesondere für 3/5

4 Autismus-Spektrum-Störungen hat Roche zurzeit drei Wirkstoffe in der klinischen Entwicklung. Eine laufende Phase-2-Studie bei erwachsenen und jugendlichen Fragile-X-Patienten in einem breiten Altersbereich untersucht die Sicherheit und Wirksamkeit des mglur5-antagonisten RG7090 von Roche (weitere Informationen über die Studie finden Sie unter Parallel dazu erforscht Roche geeignete Biomarker, um Patienten zu identifizieren, die am wahrscheinlichsten von dieser Behandlung profitieren. Eine vor kurzem durchgeführte Studie i hat gezeigt, dass die chronische Behandlung mit dem mglur5- Antagonisten von Roche die Fragile-X-Symptome in einem Mausmodell beseitigte, sogar wenn die Behandlung erst nach Ausbruch der Krankheit begonnen wurde. Diese neuen Daten weisen auf vorteilhafte Wirkungen bei einem breiten Spektrum von Symptomen und ein krankheitsmodifizierendes Potenzial für mglur5- Antagonisten beim Fragile-X-Syndrom hin. Roche setzt ausserdem auf die Zusammenarbeit mit führenden akademischen Institutionen und Biotechnologie- Unternehmen. Erst kürzlich hat ein internationales Wissenschaftlerkonsortium unter Federführung von Roche und dem King s College London seine Arbeit im Rahmen der weltweit grössten Einzelbeihilfe für die Autismusforschung der grössten Forschungsbeihilfe, die je für eine neurologische Erkrankung in Europa zur Verfügung gestellt wurde aufgenommen. Nähere Informationen finden Sie hier: European Autism Interventions A Multicentre Study for Developing New Medications (EU-AIMS). Darüber hinaus hat Roche eine Vereinbarung mit dem Harvard Stem Cell Institute der Harvard Medical School, des Children s Hospital Boston und des Massachusetts General Hospital unterzeichnet, um Zellmodelle für Autismus-Spektrum-Störungen zu entwickeln. Die wichtigsten Akteure der Pharmaindustrie im Bereich der ASD-Forschung, darunter auch Seaside Therapeutics, Hochschulen und Patientenorganisationen, trafen sich kürzlich anlässlich des vierten Roche - Nature Medicine Translational Neuroscience Symposiums unter dem Leitmotiv "Autismus-Spektrum- Störungen: Vom biologischen Verständnis zu therapeutischen Strategien" zum Informationsaustausch über die jüngsten Fortschritte auf diesem Forschungsgebiet. Über Roche Roche mit Hauptsitz in Basel, Schweiz, ein führendes, forschungsorientiertes Unternehmen, ist spezialisiert auf die beiden Geschäfte Pharma und Diagnostics. Als weltweit grösstes Biotech-Unternehmen entwickelt Roche klinisch differenzierte Medikamente für die Onkologie, Virologie, Entzündungs- und Stoffwechselkrankheiten und Erkrankungen des Zentralnervensystems. Roche, ein Pionier im Diabetesmanagement, ist auch der weltweit bedeutendste Anbieter von In-vitro-Diagnostik und gewebebasierten Krebstests. Medikamente und Diagnostika, 4/5

5 welche die Gesundheit, die Lebensqualität und die Überlebenschancen von Patienten entscheidend verbessern, sind das strategische Ziel der personalisierten Medizin von Roche beschäftigte Roche weltweit über Mitarbeitende und investierte mehr als 9 Milliarden Franken in die Forschung und Entwicklung. Der Konzern erzielte einen Umsatz von 47,5 Milliarden Franken. Genentech, USA, gehört vollständig zur Roche-Gruppe. An Chugai Pharmaceutical, Japan, hält Roche die Mehrheitsbeteiligung. Für weitere Informationen: Für weitere Informationen: Medienstelle Roche-Gruppe Telefon: / - Alexander Klauser (Leiter) - Silvia Dobry - Daniel Grotzky - Claudia Schmitt Seaside Therapeutics Sarah Cavanaugh/Kari Watson MacDougall Biomedical Communications i Michalon et al., Chronic Pharmacological mglu5 Inhibition Corrects Fragile X in Adult Mice. Neuron - Band 74, Ausgabe 1, 12. April 2012, Seiten (Volltext) 5/5

Studie zeigt, dass Roche-Prüfmedikament gegen Alzheimerkrankheit typische Eiweissablagerungen aus dem Gehirn entfernt

Studie zeigt, dass Roche-Prüfmedikament gegen Alzheimerkrankheit typische Eiweissablagerungen aus dem Gehirn entfernt Medienmitteilung Basel, den 10. Oktober 2011 Studie zeigt, dass Roche-Prüfmedikament gegen Alzheimerkrankheit typische Eiweissablagerungen aus dem Gehirn entfernt Befunde erhellen, wie dieses Prüfmedikament

Mehr

Medienmitteilung. Roche informiert über Phase-III-Studie MARIANNE bei nicht vorbehandeltem, HER2-positivem fortgeschrittenem Brustkrebs

Medienmitteilung. Roche informiert über Phase-III-Studie MARIANNE bei nicht vorbehandeltem, HER2-positivem fortgeschrittenem Brustkrebs Medienmitteilung Basel, 19. Dezember 2014 Roche informiert über Phase-III-Studie MARIANNE bei nicht vorbehandeltem, HER2-positivem fortgeschrittenem Brustkrebs Die MARIANNE-Studie wurde konzipiert, um

Mehr

Roche informiert über die ersten zwei von sechs Phase-III-Studien mit Bitopertin bei Schizophrenie

Roche informiert über die ersten zwei von sechs Phase-III-Studien mit Bitopertin bei Schizophrenie Roche informiert über die ersten zwei von sechs Phase-III-Studien mit Bitopertin bei Schizophrenie - Zwei Phase-III-Studien zur Prüfung von Bitopertin bei anhaltenden, überwiegend negativen Symptomen der

Mehr

ASCO 2015 Neues zur Therapie des HER2-positiven Mammakarzinoms

ASCO 2015 Neues zur Therapie des HER2-positiven Mammakarzinoms ASCO 2015 Neues zur Therapie des HER2-positiven Mammakarzinoms Bonn (16. Juni 2015) - Ein Schwerpunkt des weltweit größten Krebskongresses, der 51. Jahrestagung der American Society of Clinical Oncology

Mehr

Medienmitteilung. Basel, 28. September 2015

Medienmitteilung. Basel, 28. September 2015 Medienmitteilung Basel, 28. September 2015 Ocrelizumab von Roche zeigt als erstes Prüfmedikament Wirkung bei Menschen mit primär progredienter multipler Sklerose in einer grossen Phase-III-Studie Phase-III-Studie

Mehr

Medienmitteilung. ddddddd. Basel, 1. Oktober 2012

Medienmitteilung. ddddddd. Basel, 1. Oktober 2012 Medienmitteilung ddddddd Basel, 1. Oktober 2012 Endergebnisse der Phase-III-Studie HERA bestätigen einjährige Behandlung mit Herceptin als Standardtherapie bei HER2-positivem Brustkrebs im Frühstadium

Mehr

Medienmitteilung. Basel, den 17. November 2012

Medienmitteilung. Basel, den 17. November 2012 Medienmitteilung Basel, den 17. November 2012 Roche-Studie: Avastin als Zusatz zu Bestrahlung und Chemotherapie verlängerte die Überlebenszeit ohne Fortschreiten der Erkrankung bei Patienten mit neu diagnostiziertem

Mehr

Roche-Medikament Avastin als Zusatz zur Chemotherapie erhält positive Empfehlung für EU-Zulassung bei fortgeschrittenem Gebärmutterhalskrebs

Roche-Medikament Avastin als Zusatz zur Chemotherapie erhält positive Empfehlung für EU-Zulassung bei fortgeschrittenem Gebärmutterhalskrebs Medienmitteilung Basel, 27. Februar 2015 Roche-Medikament Avastin als Zusatz zur Chemotherapie erhält positive Empfehlung für EU-Zulassung bei fortgeschrittenem Gebärmutterhalskrebs Die Kombination von

Mehr

Strategien in der Zusammenarbeit. Partnerschaften

Strategien in der Zusammenarbeit. Partnerschaften Strategien in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass Leiter Strategische Gerd Maass, Leiter Strategische Partnerschaften Stratifizierende Medizin Welche Verfahren nützen wem und wer soll

Mehr

mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms

mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms Georg Jaeschke, F. Hoffmann La Roche Fragiles X Syndrom mglur Theorie Martin-Bell Syndrom Fmr1 Gen identifiziert mglu5 MPEP FMRP hemmt Translation

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien 6h Basel, 30. Mai 2009 Vollständige Ergebnisse aus der ersten Phase-III-Studie mit Avastin in der adjuvanten Therapie des Dickdarmkrebses Resultate geben Hoffnung, dass in künftigen

Mehr

Roche gibt bekannt, dass Vemurafenib das Überleben bei Patienten mit metastasierendem Melanom verlängerte, die eine BRAF-V600-Mutation aufwiesen

Roche gibt bekannt, dass Vemurafenib das Überleben bei Patienten mit metastasierendem Melanom verlängerte, die eine BRAF-V600-Mutation aufwiesen Medienmitteilung Basel, den 5. Juni 2011 Roche gibt bekannt, dass Vemurafenib das Überleben bei Patienten mit metastasierendem Melanom verlängerte, die eine BRAF-V600-Mutation aufwiesen Ergebnis der Roche-Strategie

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, 29. Februar 2008 Herceptin wird in Japan zur Frühbehandlung von HER2-positivem Brustkrebs zugelassen Die lebensrettende Standardtherapie mit Herceptin ist nun weltweit verfügbar

Mehr

Medienmitteilung. Basel, den 30. September 2013

Medienmitteilung. Basel, den 30. September 2013 Medienmitteilung Basel, den 30. September 2013 Daten zeigen, dass neue subkutane Form des Medikaments Herceptin von Roche von Patienten bevorzugt wird und Ressourcen in Europas Krankenhäusern einsparen

Mehr

Gazyvaro von Roche in Europa für Patienten mit der häufigsten Form von Leukämie zugelassen

Gazyvaro von Roche in Europa für Patienten mit der häufigsten Form von Leukämie zugelassen Medienmitteilung Basel, 29. Juli 2014 Gazyvaro von Roche in Europa für Patienten mit der häufigsten Form von Leukämie zugelassen Gazyvaro, der erste mittels Glycoengineering hergestellte monoklonale Typ-II-CD20-

Mehr

Medienmitteilung. Basel, 1. Juni 2015

Medienmitteilung. Basel, 1. Juni 2015 Medienmitteilung Basel, 1. Juni 2015 Therapieschema mit Perjeta von Roche verlängerte bei Patientinnen mit HER2- positivem Brustkrebs im Frühstadium das Überleben, ohne dass die Erkrankung wieder auftrat

Mehr

Medienmitteilung. Basel, 14. Mai 2015

Medienmitteilung. Basel, 14. Mai 2015 Medienmitteilung Basel, 14. Mai 2015 Roche-Immuntherapeutikum 3280A verdoppelte die Überlebenswahrscheinlichkeit verglichen mit Chemotherapie bei Patienten mit einer bestimmten Art von Lungenkrebs Resultate

Mehr

Medienmitteilung. Basel, 28. September 2014

Medienmitteilung. Basel, 28. September 2014 Medienmitteilung Basel, 28. September 2014 Roche-Medikament Perjeta verlängert das Leben von Patientinnen mit einer aggressiven Form von metastasierendem Brustkrebs um 15,7 Monate im Vergleich zu einer

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, den 28. Januar 2010 Herceptin jetzt in der EU für Patienten mit HER2-positivem fortgeschrittenem Magenkrebs zugelassen Erste zielgerichtete biologische Therapie die Überlebensvorteil

Mehr

Medienmitteilung. Basel, 1. September 2016

Medienmitteilung. Basel, 1. September 2016 Medienmitteilung Basel, 1. September 2016 Phase-III-Studie zeigte, dass das Krebsimmuntherapeutikum Tecentriq (Atezolizumab) von Roche verglichen mit Chemotherapie das Überleben von Patienten mit einer

Mehr

HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brus

HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brus HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brus HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brustkrebs München

Mehr

FDA erteilt Zulassung für Actemra zur Behandlung der systemischen juvenilen idiopathischen Arthritis (SJIA)

FDA erteilt Zulassung für Actemra zur Behandlung der systemischen juvenilen idiopathischen Arthritis (SJIA) Medienmitteilung Basel, den 18. April 2011 FDA erteilt Zulassung für Actemra zur Behandlung der systemischen juvenilen idiopathischen Arthritis (SJIA) Medikament bietet neue Option für Kinder mit seltener

Mehr

Roche in Österreich. Doing now what patients need next

Roche in Österreich. Doing now what patients need next Roche in Österreich Doing now what patients need next Roche Unsere Mission Wer wir sind Roche wurde am 1. Oktober 1896 von Fritz Hoffmann-La Roche in Basel gegründet. Er hat als einer der ersten erkannt,

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, den 28. Januar 2010 Roche gründet neues medizinisches Forschungsnetzwerk in Singapur Einzigartige öffentlich-private Partnerschaft soll Fortschritt der personalisierten

Mehr

Medienmitteilung. Basel, 5. Juni 2016

Medienmitteilung. Basel, 5. Juni 2016 Medienmitteilung Basel, 5. Juni 2016 Roche-Krebsimmuntherapeutikum Tecentriq (Atezolizumab) liess Tumoren bei Patienten mit zuvor unbehandeltem fortgeschrittenen Blasenkrebs schrumpfen Neue Überlebensdaten

Mehr

Medienmitteilung. Basel, 2. Juni Erste Phase-III-Studie mit Avastin bei dieser schwer zu behandelnden Krebsart

Medienmitteilung. Basel, 2. Juni Erste Phase-III-Studie mit Avastin bei dieser schwer zu behandelnden Krebsart Medienmitteilung Basel, 2. Juni 2013 Roche-Medikament Avastin plus Chemotherapie verlängerte das Überleben bei Frauen mit fortgeschrittenem Gebärmutterhalskrebs verglichen mit Chemotherapie allein Erste

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, 4. Juni 2010 Roche stellt am ASCO-Kongress erste Daten zur nächsten Generation therapeutischer Antikörper und andere zielgerichtete Therapien vor Möglicherweise Antrag auf

Mehr

Roche in der Schweiz

Roche in der Schweiz Roche in der Schweiz Führend in der Welt und zuhause Im letzten Jahr beschäftigte Roche rund 13'000 Mitarbeitende in der Schweiz aus über 90 Nationen. Damit gehört die Schweiz neben den USA und Deutschland

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, 17. Juni 2010 MabThera ist das erste und einzige zugelassene biologische Präparat, das in der Behandlung der rheumatoiden Arthritis (RA) ein gezieltes Vorgehen gegen B-

Mehr

Roche in Deutschland Strategie in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass, Leiter Translational Research Office

Roche in Deutschland Strategie in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass, Leiter Translational Research Office Roche in Deutschland Strategie in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass, Leiter Translational Research Office München, 17. Juni 2013 Roche Ansatz zur Pharma Innovation Diversität in

Mehr

Roche in der Schweiz

Roche in der Schweiz Roche in der Schweiz Führend in der Welt und zuhause Roche ist ein global führendes Healthcare-Unternehmen mit über 88'500 Mitarbeitenden, die in mehr als 150 Ländern tätig sind. Als weltweit grösstes

Mehr

MetMAb in Kombination mit Tarceva verdoppelt für Menschen mit Lungenkrebs die Lebenszeit, in der sich ihr Krankheitszustand nicht verschlechtert

MetMAb in Kombination mit Tarceva verdoppelt für Menschen mit Lungenkrebs die Lebenszeit, in der sich ihr Krankheitszustand nicht verschlechtert Medienmitteilung Basel, den 19. Mai 2011 MetMAb in Kombination mit Tarceva verdoppelt für Menschen mit Lungenkrebs die Lebenszeit, in der sich ihr Krankheitszustand nicht verschlechtert Roche s personalisierter

Mehr

Medienmitteilung. Basel, den 23. März 2012

Medienmitteilung. Basel, den 23. März 2012 Medienmitteilung Basel, den 23. März 2012 Herceptin von Roche als subkutane Injektion ist patientenfreundlicher und reduziert Gesundheitskosten im Vergleich zur gängigen intravenösen Infusion Subkutane

Mehr

Medienmitteilung. Basel, 5. März 2014

Medienmitteilung. Basel, 5. März 2014 Medienmitteilung Basel, 5. März 2014 Lebrikizumab von Roche zeigt in Phase-IIb-Daten eine Reduktion der Asthmaanfälle und Verbesserung der Lungenfunktion bei erwachsenen Patienten mit schwerem unkontrolliertem

Mehr

CHMP empfiehlt EU-Zulassung für Roche-Medikament Avastin in Kombination mit Tarceva bei Patienten mit fortgeschrittenem Lungenkrebs

CHMP empfiehlt EU-Zulassung für Roche-Medikament Avastin in Kombination mit Tarceva bei Patienten mit fortgeschrittenem Lungenkrebs Medienmitteilung Basel, 29. April 2016 CHMP empfiehlt EU-Zulassung für Roche-Medikament Avastin in Kombination mit Tarceva bei Patienten mit fortgeschrittenem Lungenkrebs Avastin plus Tarceva zeigte eine

Mehr

Roche Personalisierte Medizin Strategie für Innovationen. Dr. Horst Kramer, Roche Group Communications

Roche Personalisierte Medizin Strategie für Innovationen. Dr. Horst Kramer, Roche Group Communications Roche Personalisierte Medizin Strategie für Innovationen Dr. Horst Kramer, Roche Group Communications Entwicklung der Gesamt-Überlebenszeit* Fortgeschrittene Krebserkrankungen 2000-2010 Lungenkrebs Glioblastom

Mehr

UNSER ANTRIEB: KREBS HEILEN

UNSER ANTRIEB: KREBS HEILEN UNSER ANTRIEB: KREBS HEILEN Unser Antrieb Bild: Gefärbte rasterelektronenmikroskopische Aufnahme (REM) einer Prostatakrebszelle. Wir sind Takeda Oncology, der Spezialbereich für Krebserkrankungen des Pharmaunternehmens

Mehr

Sorgen um und für Versorgung von "Sorgenkindern" am Beispiel Fragiles-X Syndrom

Sorgen um und für Versorgung von Sorgenkindern am Beispiel Fragiles-X Syndrom Sorgen um und für Versorgung von "Sorgenkindern" am Beispiel Fragiles-X Syndrom Versorgung von Patienten mit SE im Alltag ACHSE/vfa/vfa bio - Berlin, 31.1.2013 Dr. Jörg Richstein Übersicht Sorgenkinder?

Mehr

Evotec und Roche vereinbaren Entwicklung von EVT 101 in der Indikation behandlungsresistente Depressionen

Evotec und Roche vereinbaren Entwicklung von EVT 101 in der Indikation behandlungsresistente Depressionen 9. März 2009 Evotec und Roche vereinbaren Entwicklung von EVT 101 in der Indikation behandlungsresistente Depressionen Hamburg, Deutschland und Basel, Schweiz Evotec AG (Deutsche Börse: EVT; NASDAQ: EVTC)

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, 9. Oktober 2010 Neuer Wirkstoff in Entwicklung, MetMAb, lässt Patienten mit Lungenkrebs länger ohne Fortschreiten der Erkrankung leben Präsentation wichtiger neuer Daten

Mehr

Medienmitteilung. Basel, 7. Dezember 2015

Medienmitteilung. Basel, 7. Dezember 2015 Medienmitteilung Basel, 7. Dezember 2015 Entscheidende Phase-II-Studie zeigte, dass fast 80 Prozent der Patienten mit schwer zu behandelnder Form von chronischer lymphatischer Leukämie auf das Prüfmedikament

Mehr

Medienmitteilung. Roche stellt auf Europäischem Krebskongress Daten zu neuen Therapieansätzen bei Brust-, Haut- und Lungenkrebs vor.

Medienmitteilung. Roche stellt auf Europäischem Krebskongress Daten zu neuen Therapieansätzen bei Brust-, Haut- und Lungenkrebs vor. Medienmitteilung Basel, den 19. September 2011 Roche stellt auf Europäischem Krebskongress Daten zu neuen Therapieansätzen bei Brust-, Haut- und Lungenkrebs vor Rasch wachsendes Verständnis über Krankheitsmechanismen

Mehr

Medienmitteilung. Basel, 9. Oktober 2016

Medienmitteilung. Basel, 9. Oktober 2016 Medienmitteilung Basel, 9. Oktober 2016 Roche-Medikament TECENTRIQ (Atezolizumab) zeigt in Phase-III-Studie bei bestimmter Form von Lungenkrebs signifikanten Überlebensvorteil gegenüber Chemotherapie unabhängig

Mehr

Medienmitteilung. Roche stellt auf europäischem Krebskongress ECC wichtige Daten aus der Onkologie vor. Basel, den 23.

Medienmitteilung. Roche stellt auf europäischem Krebskongress ECC wichtige Daten aus der Onkologie vor. Basel, den 23. Medienmitteilung Basel, den 23. September 2013 Roche stellt auf europäischem Krebskongress ECC wichtige Daten aus der Onkologie vor Daten für etablierte Präparate Avastin, Herceptin, Kadcyla und Zelboraf

Mehr

Welche Behandlungsmöglichkeiten gibt es?

Welche Behandlungsmöglichkeiten gibt es? Welche Behandlungsmöglichkeiten gibt es? Welche Behandlungsmöglichkeiten gibt es? Die Behandlung der Parkinson-Erkrankung setzt sich aus mehreren Elementen zusammen. Dazu gehört zunächst eine Aufklärung

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, 21. September 2015 Neue Daten für Esbriet von Roche zur Therapie von idiopathischer Lungenfibrose werden auf dem Jahreskongress 2015 der European Respiratory Society vorgestellt

Mehr

Erhält Zähne seit über 20 Jahren Straumann Emdogain

Erhält Zähne seit über 20 Jahren Straumann Emdogain Patienteninformationen über die Behandlung von Zahnfleischerkrankungen Mehr als 2 Millionen behandelte Patienten Erhält Zähne seit über 20 Jahren Straumann Emdogain Was wissen Sie über Zahnfleischerkrankungen?

Mehr

Neue Diagnostik für akute myeloische Leukämie

Neue Diagnostik für akute myeloische Leukämie Neue Diagnostik für akute myeloische Leukämie Neuherberg (9. März 2011) - Wissenschaftler des Helmholtz Zentrums München und der Ludwig-Maximilians-Universität München haben eine Methode entwickelt, mit

Mehr

MedTechDialog Das Netzwerk in der MRN Best Practice & Perspektiven: neue Geschäfts modelle in Forschung und Entwicklung

MedTechDialog Das Netzwerk in der MRN Best Practice & Perspektiven: neue Geschäfts modelle in Forschung und Entwicklung www.pwc-event.com/medtechdialog www.medtech-mannheim.de MedTechDialog Das Netzwerk in der MRN Best Practice & Perspektiven: neue Geschäfts modelle in Forschung und Entwicklung 10. Juni 2015, Mannheim In

Mehr

Dimebon Enttäuschend bei Alzheimer, könnte aber bei Huntington funktionieren

Dimebon Enttäuschend bei Alzheimer, könnte aber bei Huntington funktionieren Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Ein neuer Artikel mit aktualisierten Informationen zu diesem Thema

Mehr

Medienmitteilung. Basel, 18. Juli 2016

Medienmitteilung. Basel, 18. Juli 2016 Medienmitteilung Basel, 18. Juli 2016 Roche legt aktualisierte Ergebnisse der Phase-III-Studie mit Gazyva/Gazyvaro bei Patienten mit nicht vorbehandeltem diffusem grosszelligem B-Zell-Lymphom vor Die GOYA-Studie

Mehr

Medienmitteilung. Basel, 27. Mai 2016

Medienmitteilung. Basel, 27. Mai 2016 Medienmitteilung Basel, 27. Mai 2016 Roche-Medikament Gazyva/Gazyvaro zeigte längeres progressionsfreies Überleben als MabThera/Rituxan bei Patienten mit zuvor unbehandeltem follikulären Lymphom Phase-III-Studie

Mehr

Prevenar 13 für Erwachsene von 18 bis 49 Jahren

Prevenar 13 für Erwachsene von 18 bis 49 Jahren Pneumokokken-Schutz jetzt für alle Altersgruppen Europäische Kommission erteilt Zulassung für Prevenar 13 für Erwachsene von 18 bis 49 Jahren Berlin (17. Juli 2013) - Pfizer hat für den 13-valenten Pneumokokken-Konjugatimpfstoff

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen Quelle: scientopia.org Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen 30. Januar 2014 ChrisEna Spilker Intelligenz Charakter Gedächtnis Plas5zität beruht auf der chemischen Zwiesprache

Mehr

Roche Lebens Hilfe. Unterstützung auf Ihrem Weg zurück ins Leben

Roche Lebens Hilfe. Unterstützung auf Ihrem Weg zurück ins Leben Roche Lebens Hilfe Unterstützung auf Ihrem Weg zurück ins Leben Wenn es um Krankheiten geht, gibt es so viele Fragen wie Menschen. Wir haben nicht auf jede Frage eine Antwort aber Wissen, um zu helfen.

Mehr

Medienmitteilung. Basel, 23. September 2009

Medienmitteilung. Basel, 23. September 2009 Medienmitteilung Basel, 23. September 2009 Von inoperabler Krankheit zu potenziell lebensrettender Operation: Neue Studiendaten zu Avastin lassen Patienten mit Dickdarmkrebs und Lebermetastasen hoffen

Mehr

Fettmoleküle und das Gehirn

Fettmoleküle und das Gehirn Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Spezielle "Gehirn Fett Injektion hilft Huntington Mäusen Direktes

Mehr

Kein Hinweis für eine andere Ursache der Demenz

Kein Hinweis für eine andere Ursache der Demenz die später nach ihm benannte Krankheit. Inzwischen weiß man, dass die Alzheimer-Krankheit eine sogenannte primär-neurodegenerative Hirnerkrankung ist. Das bedeutet, dass die Erkrankung direkt im Gehirn

Mehr

Von Patienten für Patienten. Neuropychologische Verlaufsuntersuchungen über Autimus. Forschung über Autismus...

Von Patienten für Patienten. Neuropychologische Verlaufsuntersuchungen über Autimus. Forschung über Autismus... Prof. Dr. Martina Piefke Katharina Glienke, M.Sc. Lehrstuhl für Neurobiologie und Genetik des Verhaltens Department für Psychologie und Psychotherapie Forschung über Autismus... Von Patienten......für

Mehr

Bernhard J. Schmidt Klartext kompakt. Das Asperger Syndrom für Eltern Bernhard J. Schmidt Klartext kompakt. Das Asperger Syndrom für Lehrer

Bernhard J. Schmidt Klartext kompakt. Das Asperger Syndrom für Eltern Bernhard J. Schmidt Klartext kompakt. Das Asperger Syndrom für Lehrer Bücher Autist und Gesellschaft ein zorniger Perspektivenwechsel. Band 1: Autismus verstehen Mit uns reden nicht über uns! Mit uns forschen nicht über uns! Mit uns planen nicht über uns hinweg! Auch nach

Mehr

Diabetes. Zulassungserweiterung: Levemir (Insulin detemir) als Add-on Therapie zu Victoza (Liraglutid) bei Mens

Diabetes. Zulassungserweiterung: Levemir (Insulin detemir) als Add-on Therapie zu Victoza (Liraglutid) bei Mens Zulassungserweiterung Levemir (Insulin detemir) als Add-on Therapie zu Victoza (Liraglutid) bei Menschen mit Typ 2 Diabetes Mainz (16. November 2011) Die Europäische Kommission hat die Zulassung des modernen

Mehr

Medienmitteilung. Basel, 15. März 2016

Medienmitteilung. Basel, 15. März 2016 Medienmitteilung Basel, 15. März 2016 FDA gewährt beschleunigtes Zulassungsverfahren (Priority Review) für Krebsimmuntherapeutikum Atezolizumab von Roche zur Behandlung von fortgeschrittenem Blasenkrebs

Mehr

CureVac, Cancer Research Institute und Ludwig Cancer Research schmieden Allianz für klinische Prüfung von Krebs-Immuntherapien

CureVac, Cancer Research Institute und Ludwig Cancer Research schmieden Allianz für klinische Prüfung von Krebs-Immuntherapien CureVac, Cancer Research Institute und Ludwig Cancer Research schmieden Allianz für klinische Prüfung von Krebs-Immuntherapien TÜBINGEN, NEW YORK, 4. Nov. 2013 Das gemeinnützige Cancer Research Institute

Mehr

22. Oktober 2015, Hotel Bellevue, Bern

22. Oktober 2015, Hotel Bellevue, Bern Psychiatrische Erkrankungen bringen uns individualisierte Therapien weiter? 22. Oktober 2015, Hotel Bellevue, Bern Wissenschaftliche Leitung/Veranstalter: Direktor Universitätsklinik für Psychiatrie und

Mehr

Gesundheit aus der Natur Die Forschung der letzten Jahre hat ganz klar gezeigt, dass sich viele Symptome dank des erheblichen medizinischen

Gesundheit aus der Natur Die Forschung der letzten Jahre hat ganz klar gezeigt, dass sich viele Symptome dank des erheblichen medizinischen Gesundheit aus der Natur Die Forschung der letzten Jahre hat ganz klar gezeigt, dass sich viele Symptome dank des erheblichen medizinischen Fortschritts zwar sehr gut behandeln, die eigentlich zugrunde

Mehr

Roche in Österreich. Doing now what patients need next

Roche in Österreich. Doing now what patients need next Roche in Österreich Doing now what patients need next Wer wir sind Innovation liegt in unseren Genen. Seit über 100 Jahren treiben wir weltweit und interdisziplinär die Forschung voran, um das Leben von

Mehr

ALK-Inhibitor und Immuntherapie zeigen vielversprechende Ergebnisse

ALK-Inhibitor und Immuntherapie zeigen vielversprechende Ergebnisse ALK-Inhibitor und Immuntherapie zeigen vielversprechende Ergebnisse Bonn (16. Juni 2015) - Aktuelle, auf der 51. Jahrestagung der American Society of Clinical Oncology (ASCO) vom 29. Mai bis 2. Juni 2015

Mehr

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten Hilden (10. Januar 2012) - QIAGEN hat von zwei US-amerikanischen Biotechnologieunternehmen weltweit exklusive

Mehr

Alzheimer Demenz: Unser Engagement. Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte

Alzheimer Demenz: Unser Engagement. Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte Alzheimer Demenz: Unser Engagement Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte Wer wir sind und wofür wir stehen Simone Thomsen Im Jahre 1876 gründete Colonel Eli Lilly das heutige

Mehr

Perspektiven mit Tarceva und Avastin

Perspektiven mit Tarceva und Avastin Fortgeschrittenes NSCLC: Perspektiven mit Tarceva und Avastin Mannheim (20. März 2009) - Die Behandlung des fortgeschrittenen nicht-kleinzelligen Lungenkarzinoms (Non Small Cell Lung Cancer, NSCLC) mit

Mehr

Vorzeichen von Multiple Sklerose früh erkennen

Vorzeichen von Multiple Sklerose früh erkennen Sehstörungen bei Kindern und Jugendlichen Vorzeichen von Multiple Sklerose früh erkennen München (29. August 2012) Multiple Sklerose (MS), eine chronisch-entzündliche Erkrankung von Gehirn und Rückenmark,

Mehr

Spitzencluster m 4 Personalisierte Medizin

Spitzencluster m 4 Personalisierte Medizin Spitzencluster m 4 Personalisierte Medizin Bio M Biotech Cluster Development GmbH Der Spitzencluster Wettbewerb Das BMBF fördert Projekte in einer lokalen Ansammlung (Cluster) von Unternehmen einer Branche

Mehr

DEMENZ EIN LEITFADEN FÜR DAS ARZT- PATIENTEN-GESPRÄCH

DEMENZ EIN LEITFADEN FÜR DAS ARZT- PATIENTEN-GESPRÄCH ADDITIONAL SLIDE KIT DEMENZ EIN LEITFADEN FÜR DAS ARZT- PATIENTEN-GESPRÄCH Autoren: Der Leitfaden Demenz wurde durch Schweizer Allgemeinmediziner, Geriater, Neurologen, Neuropsychologen und Psychiater

Mehr

Wissen, worauf es ankommt

Wissen, worauf es ankommt Wissen, worauf es ankommt www.tuev-sued.de/akademie GmbH Westendstraße 160 80339 München Telefon: 089 5791 2389 E-Mail: akademie@tuev-sued.de Bleiben wir in Kontakt! AC46-Pharma-fly-210x297-w-15-07-03

Mehr

Roche Diagnostics Service Oft sind es die kleinen Dinge, die Großes bewegen

Roche Diagnostics Service Oft sind es die kleinen Dinge, die Großes bewegen Roche Diagnostics Service Oft sind es die kleinen Dinge, die Großes bewegen 2 Was wir glauben Roche ist ein weltweit führendes Unternehmen im Bereich der Diagnostik. Wir konzentrieren uns darauf, medizinisch

Mehr

Medienmitteilung. Roche informiert über zwei identische Phase-III-Studien mit Lebrikizumab bei Patienten mit schwerem Asthma. Basel, 29.

Medienmitteilung. Roche informiert über zwei identische Phase-III-Studien mit Lebrikizumab bei Patienten mit schwerem Asthma. Basel, 29. Medienmitteilung Basel, 29. Februar 2016 Roche informiert über zwei identische Phase-III-Studien mit Lebrikizumab bei Patienten mit schwerem Asthma Eine Studie erreichte ihren primären Endpunkt und zeigte,

Mehr

Auswertung von Unterschieden der Androgene bei SBMA-Patienten

Auswertung von Unterschieden der Androgene bei SBMA-Patienten Auswertung von Unterschieden der Androgene bei SBMA-Patienten Nicholas Di Prospero, MD, PhD National Institute of Neurological Disorders and Stroke NIH Von der Genetik zu einem Gen Spinale und Bulbäre

Mehr

Gute Überlebensqualität Trastuzumab beim metastasierten Magenkarzinom

Gute Überlebensqualität Trastuzumab beim metastasierten Magenkarzinom Gute Überlebensqualität Trastuzumab beim metastasierten Magenkarzinom München (24. April 2012) - Mit dem monoklonalen Antikörper Trastuzumab (Herceptin ) steht bislang die einzige zielgerichtete Substanz

Mehr

Per spec tives imp PersPectives MANAGeMeNt JOUrNAL eur 40 innovationslogiken Der ZUKUNFt 03 einzigartigkeit im MANAGeMeNt 3 2011/12 1

Per spec tives imp PersPectives MANAGeMeNt JOUrNAL eur 40 innovationslogiken Der ZUKUNFt 03 einzigartigkeit im MANAGeMeNt 3 2011/12 1 Per spec tives imp perspectives MANAGEMENT JOURNAL EUR 40 INNOVATIONSLOGIKEN DER ZUKUNFT 03 2011/12 1 EINZ I GARTIGKEIT IM MANAGEMENT 3 Output Input IMP Perspectives 124 Roche: Die Innovationskünstler

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Basel, 19. Mai 2016 Roche Medikament GAZYVARO (Obinutuzumab) wird in der Schweiz zur Behandlung von Patienten mit vorbehandeltem follikulärem Lymphom zugelassen Zweite Zulassung

Mehr

Als Krebspatient an einer Studie teilnehmen was sollte man wissen?

Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Krebsinformationsdienst, Heidelberg Dr. Susanne Weg-Remers Seite 2 Grundlage für evidenzbasiertes medizinisches Wissen sind klinische

Mehr

Tinnitus nicht mehr hören. Apotheken-Service für Gesundheit und Wohlbefinden

Tinnitus nicht mehr hören. Apotheken-Service für Gesundheit und Wohlbefinden Tinnitus nicht mehr hören Apotheken-Service für Gesundheit und Wohlbefinden Das sollten Sie wissen Unter Tinnitus versteht man ein permanentes Ohrgeräusch, das als dauerhaftes Pfeifen oder Summen beschrieben

Mehr

Matthias M. Baltisberger, Standortleiter Roche Basel

Matthias M. Baltisberger, Standortleiter Roche Basel Roche in der Schweiz Matthias M. Baltisberger, Standortleiter Roche Basel picture placeholder Roche in der Schweiz Die Standorte Basel und Kaiseraugst, F.Hoffmann-La Roche AG Reinach, Roche Pharma (Schweiz)

Mehr

Lancet: Geringeres Hypoglykämierisiko unter dem ultra-langwirksamen Insulin degludec

Lancet: Geringeres Hypoglykämierisiko unter dem ultra-langwirksamen Insulin degludec Zwei Phase-3-Studien in The Lancet erschienen Geringeres Hypoglykämierisiko unter dem ultra-langwirksamen Insulin degludec Mainz (14. Mai 2012) Das ultra-langwirksame Insulin degludec, ein in der Entwicklung

Mehr

Prof. Dr. Stephan Ludwig. Institut für Molekulare Virologie (IMV)

Prof. Dr. Stephan Ludwig. Institut für Molekulare Virologie (IMV) Cystus052, ein polyphenolreicher Pflanzenextrakt wirkt gegen Grippeviren durch Blockierung des Viruseintritts in die Wirtszelle Prof. Dr. Stephan Ludwig Institut für Molekulare Virologie (IMV) Die Virusgrippe

Mehr

20 von 100. an Krebs erkrankten Kindern sterben immer noch. ehemals KIND UND KREBS

20 von 100. an Krebs erkrankten Kindern sterben immer noch. ehemals KIND UND KREBS 20 von 100 an Krebs erkrankten Kindern sterben immer noch. ehemals KIND UND KREBS Ärzte können es! Die Zahl der an Krebs neu erkrankten Kinder etwa 220 pro Jahr in der Schweiz ist gering, trotzdem sterben

Mehr

Medienmitteilung. Basel, 31. Juli 2015

Medienmitteilung. Basel, 31. Juli 2015 Medienmitteilung Basel, 31. Juli 2015 Roche-Medikament Perjeta in Europa für die präoperative Anwendung bei aggressivem Brustkrebs im Frühstadium zugelassen Die Zulassung stützt sich auf den Vorteil des

Mehr

Montag, 27. Februar 2012

Montag, 27. Februar 2012 Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Huntington Therapie Konferenz 2012 Updates: Tag 1 Tag 1 unserer

Mehr

Europäische Arzneimittelbehörde empfiehlt Aussetzung der Marktzulassung für Raptiva

Europäische Arzneimittelbehörde empfiehlt Aussetzung der Marktzulassung für Raptiva Europäische Arzneimittelbehörde empfiehlt Aussetzung der Marktzulassung für Raptiva Darmstadt (19. Februar 2009) Die Merck KGaA hat heute bekannt gegeben, dass die europäische Arzneimittelbehörde EMEA

Mehr

O f f e n e S t u d i e n - August 2013 -

O f f e n e S t u d i e n - August 2013 - Sehr geehrte Patientinnen und Angehörige, sehr geehrte Ärztinnen und Ärzte, Klinische Studien zur Behandlung des Ovarial-, Tuben-, Endometrium- und Peritonealkarzinoms: bevor antihormonelle, chemotherapeutische

Mehr

Medienmitteilung. Basel, 29. September 2015

Medienmitteilung. Basel, 29. September 2015 Medienmitteilung Basel, 29. September 2015 Neue Daten für Esbriet von Roche zeigen klinischen Nutzen der fortgesetzten Langzeitbehandlung von Patienten mit idiopathischer Lungenfibrose (IPF) Gepoolte Analyse

Mehr

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin Die richtige Therapie für den richtigen Patienten Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin: Was ist denn das? Februar 2011 Personalisierte Medizin:

Mehr

Kognitive Defizite bei der bipolaren Störung

Kognitive Defizite bei der bipolaren Störung Kognitive Defizite bei der bipolaren Störung Einfluss von Schlaf und sub-syndromaler Depression DP Julia Volkert Klinik und Poliklinik für Psychiatrie, Psychosomatik und Psychotherapie Direktor: Prof.

Mehr

Berliner Leberring e.v.

Berliner Leberring e.v. Berliner Leberring e.v. 19. vfa-round-table mit Patienten- Selbsthilfegruppen Gesundheitliche Versorgung in der Zukunft Personalisierte Medizin Welche Chancen und Risiken sehen Patienten? 1 Berliner Leberring

Mehr

Auf der 84. Jahrestagung der Deutschen Gesellschaft für Neurologie (DGN), die noch bis zum 1. Oktober in

Auf der 84. Jahrestagung der Deutschen Gesellschaft für Neurologie (DGN), die noch bis zum 1. Oktober in Restless-Legs-Syndrom: Ein besseres Leben ist möglich Die Qual der ruhelosen Beine ist eine kaum bekannte Volkskrankheit Wiesbaden (29. September 2011) Bis zu zehn Prozent der Bevölkerung sind von einem

Mehr

NRLP12-Assoziiertes Periodisches Fieber

NRLP12-Assoziiertes Periodisches Fieber www.printo.it/pediatric-rheumatology/at/intro NRLP12-Assoziiertes Periodisches Fieber Version von 2016 1. ÜBER NRLP12-ASSOZIIERTES PERIODISCHES FIEBER 1.1 Was ist das? Das NRLP12-assoziierte periodische

Mehr

Aktualisierte Leitlinien für pulmonal (arterielle) Hypertonie (PAH): Zielorientierte PAH-Therapie: Treat to T

Aktualisierte Leitlinien für pulmonal (arterielle) Hypertonie (PAH): Zielorientierte PAH-Therapie: Treat to T Aktualisierte Leitlinien für pulmonal (arterielle) Hypertonie (PAH): Zielorientierte PAH-Therapie: Treat to Target ist das Gebot der Stunde Freiburg (2. März 2010) Seit 2009 gelten die neuen Leitlinien

Mehr

Gazyvaro von Roche in Kombination mit Bendamustin für Patienten mit vorbehandeltem follikulären Lymphom in Europa zugelassen

Gazyvaro von Roche in Kombination mit Bendamustin für Patienten mit vorbehandeltem follikulären Lymphom in Europa zugelassen Medienmitteilung Basel, 16. Juni 2016 Gazyvaro von Roche in Kombination mit Bendamustin für Patienten mit vorbehandeltem follikulären Lymphom in Europa zugelassen Zweite Zulassung in Europa für Gazyvaro

Mehr