Mechanismen der Pasteurella multocida Toxin vermittelten Modulation des Osteoimmunsystems

Größe: px
Ab Seite anzeigen:

Download "Mechanismen der Pasteurella multocida Toxin vermittelten Modulation des Osteoimmunsystems"

Transkript

1 Mechanismen der Pasteurella multocida Toxin vermittelten Modulation des Osteoimmunsystems Gutachter Prof. Dr. Alexander Dalpke Prof. Dr. Ralf Bartenschlager

2 Inhaltsverzeichnis 1 Zusammenfassung 1 2 Einleitung Osteoimmunologie Pasteurella m ultocida Pasteurella multocida Toxin Aufbau von P M T Intrazellulärer Wirkmechanismus von P M T Der mtor-signalweg und P M T PMT und das Skelettsystem Osteoklastogenese Vorläufer der Osteoklastendifferenzierung Signaltransduktionsachsen der Osteoklastendifferenzierung Hämatopoese und zelluläre P lastizität Z ielsetzung Material und Methoden M aterial G eräte Verbrauchsmaterial C hem ikalien Puffer und Lösungen Kommerzielle Puffer, Lösungen und Reagenzien Hergestellte Puffer und Lösungen Kommerzielle K its A ntikörper Western Blot Antikörper AutoMACS A ntikörper Immunfluoreszenz Antikörper Durchflußzytometrie A n tik ö rp er S tim u li Inhibitoren Primer für die real-time P C R S o ftw a re IV

3 3.2 M ethoden Zellkultur Zelllinien L929 Z e lle n RAW Zellen U266 und KMS12.BM Zellen Murine Primärzellen Isolierung von Knochenmarkszellen Differenzierung von Makrophagen (BM M $) Differenzierung von Osteoklasten Differenzierung von dendritischen Zellen Isolierung von CD45R-positiven B -Z ellen Proteinbiochemische M eth o d en Immunoblots Anfertigung von Totallysaten Anfertigung von subzellulären Extrakten (Nukleus und Zytoplasma) Proteinbestimmung (BCA Assay) SDSPAGE Semi-Dry Western B lo t Wet Western B l o t Immunpräzipitation ELISA Durchflußzytometrie Makrophagen Phagozytose Test Konfokale M ikroskopie Analyse der Differenzierung von Osteoklasten und deren Quantifizierung Immunfluoreszenzfärbungen TRA P-Färbung Kathepsin K Aktivitäts-Test Zellulärer Viabilitätstest Zellulärer Apoptosetest Proteom ik Bestimmung des Sekretoms Bestimmung des Proteoms mit der DIGE Technik Molekularbiologische M ethoden mrna Expressionsanalysen RNA Isolation cdna Synthese aus m R N A s quantitative Real-time-PCR zur mrna Expressionsanalyse 54 V

4 mirna Expressionsanalysen Isolierung von m ir N A cdna Synthese aus m ir N A quantitative Real-time-PCR zur mirna Expressionsanalyse Statistik Ergebnisse Einfluss von B-Zellen auf die PMT-induzierte Osteoklastendifferenzierung Visualisierung PMT-induzierter O steoklasten Identifikation des B-Zell Sekretom s PMT stimulierte B-Zellen (CD45R+) differenzieren zu Osteoklasten PMT generiert eine bipotente B-Zell-Population, die B-Zell- und Osteoklasten- Marker zugleich exprimiert Signalwege und Differenzierungsmechanismen, die von B-Zellen und Osteoklasten geteilt w erden PMT aktiviert die Blimp-l-Bcl-6 A ch se PMT-induzierte Aktivierung der mirna21 als potenzieller molekularer Schalter Aktivierung von klassischen Osteoklastogenese-bezogenen Signalwegen mit PMT Analyse des Proteoms von Osteoklasten-Vorläufern und O steoklasten PMT induzierte Osteoklastogenese ist mtor abhängig Der mtor-signalweg wird in Makrophagen mit PMT a k tiv ie rt mtor spielt keine Rolle für die Zytokinproduktion mit PMT in RAW264.7 Makrophagen Untersuchung der zellulären Effekte der mtor-aktivierung mit PMT PMT stimuliert die Differenzierung von RAW264.7 Zellen zu Osteoklasten und die mtor Kinase ist daran beteiligt PMT aktiviert viele Signalwege, die als mtorcl-aktivatoren bekannt sind PMT-induzierte Signalwege aktivieren mtorcl in synergistischer Weise PMT aktiviert mtor-abhängig die Transkription von Osteoklasten-spezifischen Genen durch den Transkriptionsfaktor A P Diskussion Interaktionen des B-Zell-und des Skelettsystems nach PMT Stimulation PMT und die klassische Osteoklastendifferenzierung von Monozyten/Makrophagenvorläufem Ausblick

5 6 Literatur Abkürzungsverzeichnis Abbildungsverzeichnis Tabellenverzeichnis Anhang Identifizierte Proteine der DIGE-Analyse Vergrößerte Darstellung der Abbildung Veröffentlichungen Präsentationen Vorträge Posterpräsentationen P re is e Stipendien V ll

I. Inhaltsverzeichnis I. II. Abbildunqsverzeichnis. III. Tabellenverzeichnis. IV. Abkürzunasverzeichnis. V. Zusammenfassung XIII. 1.

I. Inhaltsverzeichnis I. II. Abbildunqsverzeichnis. III. Tabellenverzeichnis. IV. Abkürzunasverzeichnis. V. Zusammenfassung XIII. 1. I. Inhaltsverzeichnis I II. Abbildunqsverzeichnis III. Tabellenverzeichnis IV. Abkürzunasverzeichnis VII IX X V. Zusammenfassung XIII VI. Abstract XVIII 1. Einleitung 1 1.1 Zielstellung der Arbeit 1 1.2

Mehr

Gewebeprotektive Eigenschaften von. lnterleukin-22 in der Leber

Gewebeprotektive Eigenschaften von. lnterleukin-22 in der Leber Gewebeprotektive Eigenschaften von lnterleukin-22 in der Leber Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften vorgelegt beim Fachbereich Biochemie, Chemie und Pharmazie der Johann

Mehr

Abkürzungen...VI. 1 Einleitung Das Immunorgan Darm Das Immunsystem des Darms (GALT)...2

Abkürzungen...VI. 1 Einleitung Das Immunorgan Darm Das Immunsystem des Darms (GALT)...2 Inhaltsverzeichnis Abkürzungen...VI 1 Einleitung... 1 1.1 Das Immunorgan Darm... 1 1.1.1 Anatomischer und histologischer Aufbau des Darms... 1 1.1.2 Das Immunsystem des Darms (GALT)...2 1.1.3 Das intestinale

Mehr

Untersuchungen zur Wirkung von Pasteurella multocida Toxin

Untersuchungen zur Wirkung von Pasteurella multocida Toxin Institut fiir Experimentelle und Klinische Pharmakologie und Toxikologie der Albert-Ludwigs-Universitat Freiburg Untersuchungen zur Wirkung von Pasteurella multocida Toxin Dissertation zur Erlangung des

Mehr

Chemokin-Rezeptor-Modulation während der T-Zell-Aktivierung: Untersuchung zur Funktion der GTPase Ras

Chemokin-Rezeptor-Modulation während der T-Zell-Aktivierung: Untersuchung zur Funktion der GTPase Ras Aus dem Institut für Immunologie der Universität Heidelberg Geschäftsführender Direktor: Herr Prof. Dr. med. Stefan Meuer Chemokin-Rezeptor-Modulation während der T-Zell-Aktivierung: Untersuchung zur Funktion

Mehr

Charakterisierung der mirna-expression im großzellig anaplastischen T-Zell-Lymphom

Charakterisierung der mirna-expression im großzellig anaplastischen T-Zell-Lymphom Charakterisierung der mirna-expression im großzellig anaplastischen T-Zell-Lymphom Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität Tübingen zur Erlangung des

Mehr

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...

Mehr

Zusammenfassung. 1 Einleitung. 2 Material & Methoden. 1.1 Hepatitis B Virus (HBV) 1.2 Adeno-Assoziierte Viren (AAV) 1.3 Das humane Immunsystem

Zusammenfassung. 1 Einleitung. 2 Material & Methoden. 1.1 Hepatitis B Virus (HBV) 1.2 Adeno-Assoziierte Viren (AAV) 1.3 Das humane Immunsystem Zusammenfassung 1 Einleitung 1.1 Hepatitis B Virus (HBV) 1.1.1 Epidemiologie des humanen HBV 1.1.2 Partikelaufbau des HBV 1.1.3 Hüllproteine 1.1.4 Genomorganisation 1.1.5 Replikationszyklus 1.2 Adeno-Assoziierte

Mehr

Sophia Buhs. Dissertation. Diplom-Biochemikerin

Sophia Buhs. Dissertation. Diplom-Biochemikerin Beeinflussung Phosphotyrosin-abhängiger Signalwege in humanen unter Einsatz von SH2-Domänen und Phosphatasen in Kombination mit dem TAT-Transduktionssystem Dissertation Zur Erlangung der Würde des Doktors

Mehr

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen

Mehr

Die immunsuppressive Wirkung von Tumormetaboliten auf humane T-Zellen

Die immunsuppressive Wirkung von Tumormetaboliten auf humane T-Zellen Die immunsuppressive Wirkung von Tumormetaboliten auf humane T-Zellen Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) der Naturwissenschaftlichen Fakultät III - Biologie

Mehr

Aus der Klinik und Poliklinik für Urologie und Kinderurologie der Universität Würzburg Direktor: Universitäts-Professor Dr. med. H.

Aus der Klinik und Poliklinik für Urologie und Kinderurologie der Universität Würzburg Direktor: Universitäts-Professor Dr. med. H. Aus der Klinik und Poliklinik für Urologie und Kinderurologie der Universität Würzburg Direktor: Universitäts-Professor Dr. med. H. Riedmiller MicroRNA-221 reguliert PMEPA1 und moduliert den TGFß-Signalweg

Mehr

Gregor Lohmann (Autor) Therapeutische Nutzung der Transkriptions-gekoppelten DNS Reparaturmechanismen zur Überwindung der Resistenz in der CLL

Gregor Lohmann (Autor) Therapeutische Nutzung der Transkriptions-gekoppelten DNS Reparaturmechanismen zur Überwindung der Resistenz in der CLL Gregor Lohmann (Autor) Therapeutische Nutzung der Transkriptions-gekoppelten DNS Reparaturmechanismen zur Überwindung der Resistenz in der CLL https://cuvillier.de/de/shop/publications/6968 Copyright:

Mehr

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen

Mehr

Beeinflussung von Zellphysiologie und mitochondrialer Funktion durch Alzheimer Demenz-assoziiertes Amyloides-ß Peptid

Beeinflussung von Zellphysiologie und mitochondrialer Funktion durch Alzheimer Demenz-assoziiertes Amyloides-ß Peptid Beeinflussung von Zellphysiologie und mitochondrialer Funktion durch Alzheimer Demenz-assoziiertes Amyloides-ß Peptid TECHNISCHE UNIVERSITÄT DARMSTADT Vom Fachbereich Chemie der Technischen Universität

Mehr

Der Einfluss von Vitamin D 3 auf endotheliale Reparaturprozesse im Zusammenhang mit der Präeklampsie

Der Einfluss von Vitamin D 3 auf endotheliale Reparaturprozesse im Zusammenhang mit der Präeklampsie Aus der Klinik für Frauenheilkunde und Geburtshilfe der Medizinischen Hochschule Hannover Der Einfluss von Vitamin D 3 auf endotheliale Reparaturprozesse im Zusammenhang mit der Präeklampsie Dissertation

Mehr

1 Zusammenfassung 1. 2 Einleitung Chemische Genetik Rezeptor-vermittelte Signaltransduktion 7

1 Zusammenfassung 1. 2 Einleitung Chemische Genetik Rezeptor-vermittelte Signaltransduktion 7 Inhaltsverzeichnis 1 Zusammenfassung 1 2 Einleitung 3 2.1 Chemische Genetik 4 2.2 Rezeptor-vermittelte Signaltransduktion 7 2.3 Guaninnukleotid-bindende Proteine (G-Proteine/GTPasen) 7 2.3.1 Kleine GTPasen

Mehr

Kerstin Brachhold (Autor) Das Basalapparat-Subproteom von Chlamydomonas reinhardtii

Kerstin Brachhold (Autor) Das Basalapparat-Subproteom von Chlamydomonas reinhardtii Kerstin Brachhold (Autor) Das Basalapparat-Subproteom von Chlamydomonas reinhardtii https://cuvillier.de/de/shop/publications/1867 Copyright: Cuvillier Verlag, Inhaberin Annette Jentzsch-Cuvillier, Nonnenstieg

Mehr

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR Aus dem Institut für Humangenetik der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Genexpressionsanalyse von DNA-Reparaturgenen in primären Fibroblasten von Tumorpatienten mittels Real

Mehr

https://cuvillier.de/de/shop/publications/6509

https://cuvillier.de/de/shop/publications/6509 Stefanie Franz (Autor) Effekt selektiver und nicht selektiver nichtsteroidaler Antiphlogistika auf die Entzündungsreaktion von durch Ischämie und Reperfusion geschädigtem equinen Jejunum https://cuvillier.de/de/shop/publications/6509

Mehr

Metabolische Veränderungen und Zelltod in neuralen Zellen. durch Advanced Glycation Endproducts -

Metabolische Veränderungen und Zelltod in neuralen Zellen. durch Advanced Glycation Endproducts - Metabolische Veränderungen und Zelltod in neuralen Zellen durch Advanced Glycation Endproducts - Implikationen für die Pathogenese der Alzheimer schen Demenz Dissertation zur Erlangung des naturwissenschaftlichen

Mehr

Charakterisierung von CD25+ regulatorischen T Zellen

Charakterisierung von CD25+ regulatorischen T Zellen Charakterisierung von CD25+ regulatorischen T Zellen Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) eingereicht im Fachbereich Biologie, Chemie,

Mehr

Kontrolle des murinen Cytomegalovirus durch. y6 T-Zellen

Kontrolle des murinen Cytomegalovirus durch. y6 T-Zellen Kontrolle des murinen Cytomegalovirus durch y6 T-Zellen Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt

Mehr

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus Aus dem Institut für Virologie der Tierärztlichen Hochschule Hannover und dem Institut für Virusdiagnostik des Friedrich-Loeffler-Instituts, Insel Riems Etablierung, Validierung und praktische Anwendung

Mehr

Molekulare Mechanismen der p16-vermittelten Anoikisinduktion in humanen Pankreaskarzinom-Zellen

Molekulare Mechanismen der p16-vermittelten Anoikisinduktion in humanen Pankreaskarzinom-Zellen Aus der Medizinischen Klinik mit Schwerpunkt Hepatologie und Gastroenterologie der Charité - Universitätsmedizin Berlin Campus Virchow-Klinikum Leiter: Prof. Dr. Bertram Wiedenmann Arbeitsgruppe Prof.

Mehr

Expression und Funktion. von Neurotransmitterrezeptoren auf Astrozyten im intakten. Hirngewebe der Maus

Expression und Funktion. von Neurotransmitterrezeptoren auf Astrozyten im intakten. Hirngewebe der Maus Expression und Funktion von Neurotransmitterrezeptoren auf Astrozyten im intakten Hirngewebe der Maus Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) von Dipl.-Biochem.

Mehr

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32 Inhaltsverzeichnis 1. Einleitung... 9 1.1 Posttranslationale Modifikationen... 10 1.2 N-Glykosylierung... 11 1.3 O-Glykosylierung... 12 1.4 Veränderungen der Glykosylierung bei der Tumorentstehung... 13

Mehr

Inhaltsverzeichnis... 6. 1 Einleitung... 14. 1.1 ATP-Binding-Cassette Transporter... 14. 1.2 ABC-Transporter Subfamilie A... 16

Inhaltsverzeichnis... 6. 1 Einleitung... 14. 1.1 ATP-Binding-Cassette Transporter... 14. 1.2 ABC-Transporter Subfamilie A... 16 Inhaltsverzeichnis Inhaltsverzeichnis... 6 1 Einleitung... 14 1.1 ATP-Binding-Cassette Transporter... 14 1.2 ABC-Transporter Subfamilie A... 16 1.2.1 ABCA2: Funktion und MDR... 16 1.3 ABC-Transporter Subfamilie

Mehr

https://cuvillier.de/de/shop/publications/2770

https://cuvillier.de/de/shop/publications/2770 Malgorzata Maria Jakubowska (Autor) Positive Regulation der Plasminogen-Aktivator-Inhibitor-1- Genexpression durch Insulin und Glucagon in primären Rattenhepatozyten https://cuvillier.de/de/shop/publications/2770

Mehr

1 EINLEITUNG Epilepsie Fokale Epilepsie und Temporallappen-Epilepsie... 2

1 EINLEITUNG Epilepsie Fokale Epilepsie und Temporallappen-Epilepsie... 2 Inhaltsverzeichnis 1 EINLEITUNG... 1 1.1 Epilepsie... 1 1.2 Fokale Epilepsie und Temporallappen-Epilepsie... 2 1.3 Neuropathologie der Fokalen Epilepsie... 3 1.3.1 Ammonshornsklerose...4 1.3.2 Glioneuronale

Mehr

Characterization o f glioblastoma stem cells upon. triggering o f CD95

Characterization o f glioblastoma stem cells upon. triggering o f CD95 Aus dem Deutschen Krebsforschungszentrum Heidelberg Direktor (kommissarisch): Prof. Dr. rer. nat. Michael Boutros Abteilung für Molekulare Neurobiologie Abteilungsleiterin Prof. Dr. med. Ana Martin-Villalba

Mehr

Pharmazeutische Biologie und Phytochemie. Naturstoffe als Inhibitoren c-myb-abhängiger. Transkriptionsprozesse

Pharmazeutische Biologie und Phytochemie. Naturstoffe als Inhibitoren c-myb-abhängiger. Transkriptionsprozesse Pharmazeutische Biologie und Phytochemie Naturstoffe als Inhibitoren c-myb-abhängiger Transkriptionsprozesse Inaugural-Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften im Fachbereich

Mehr

Eline Biedermann (Autor) Untersuchungen zur Charakterisierung von Prenyltransferasen aus Hypericum-Arten nach Expression in Nicotiana benthamiana

Eline Biedermann (Autor) Untersuchungen zur Charakterisierung von Prenyltransferasen aus Hypericum-Arten nach Expression in Nicotiana benthamiana Eline Biedermann (Autor) Untersuchungen zur Charakterisierung von Prenyltransferasen aus Hypericum-Arten nach Expression in Nicotiana benthamiana https://cuvillier.de/de/shop/publications/7653 Copyright:

Mehr

Untersuchungen zur Funktion von Stärke-Synthasen in der Kartoffel (Solanum tuberosum L.)

Untersuchungen zur Funktion von Stärke-Synthasen in der Kartoffel (Solanum tuberosum L.) Untersuchungen zur Funktion von Stärke-Synthasen in der Kartoffel (Solanum tuberosum L.) Inaugural-Dissertation Erlangung der Doktorwürde im Fachbereich Biologie der Freien Univeisität Berlin vorgelegt

Mehr

1. EINLEITUNG 1 1.1 Angeborene Immunität Die erste Abwehr 1 1.2 Phagozytose und Phagosomenreifung 2 1.2.1 Phagozytose 2 1.2.2 Phagosomenreifung 3 1.3 Die vakuoläre Protonenpumpe (v-atpase) 6 1.3.1 Die

Mehr

Inhaltsverzeichnis. 1 Einleitung... 1

Inhaltsverzeichnis. 1 Einleitung... 1 Inhaltsverzeichnis 1 Einleitung... 1 1.1 G-Protein-gekoppelte Rezeptoren... 3 1.1.1 Klassifizierung und Struktur von G-Protein-gekoppelten Rezeptoren... 6 1.1.2 Purinerge Rezeptoren... 12 1.1.3 Pharmazeutische

Mehr

Biochemie und. chemischer Mechanismus

Biochemie und. chemischer Mechanismus Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München Biochemie und chemischer Mechanismus der Thiomethylierung von RNA Dorothea Maria

Mehr

0 INHALTSVERZEICHNIS... 3

0 INHALTSVERZEICHNIS... 3 0 INHALTSVERZEICHNIS... 3 1 EINLEITUNG... 8 1.1 RELEVANZ TROPISCHER REGENWÄLDER FÜR DIE VIRUSDIVERSITÄT... 8 1.2 EINFLUSS DES MENSCHEN AUF DAS AUFTRETEN NEUARTIGER ERREGER... 8 1.3 MOSKITOS ALS VIRUSRESERVOIR...

Mehr

Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert

Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert Aus dem Institut für Funktionelle und Klinische Anatomie der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert

Mehr

Maike van Ohlen (Autor) Pieris rapae und das Glucosinolat-Myrosinase-System Cyanidentgiftung in Lepidoptera

Maike van Ohlen (Autor) Pieris rapae und das Glucosinolat-Myrosinase-System Cyanidentgiftung in Lepidoptera Maike van Ohlen (Autor) Pieris rapae und das Glucosinolat-Myrosinase-System Cyanidentgiftung in Lepidoptera https://cuvillier.de/de/shop/publications/6781 Copyright: Cuvillier Verlag, Inhaberin Annette

Mehr

Regulation der Carotinoidbiosynthese in Nostoc PCC Dissertation Zur Erlangung des Doktorgrades der Naturwissenschaften

Regulation der Carotinoidbiosynthese in Nostoc PCC Dissertation Zur Erlangung des Doktorgrades der Naturwissenschaften Regulation der Carotinoidbiosynthese in Nostoc PCC 7120 Dissertation Zur Erlangung des Doktorgrades der Naturwissenschaften vorgelegt beim Fachbereich Biowissenschaften der Johann Wolfgang Goethe-Universität

Mehr

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.)

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) UNTERSUCHUNGEN ZUM NICHTVIRALEN GENTRANSFER IN DIE LUNGE IM MAUSMODEL EINFLUSS DER APPLIKATIONSART, MOLEKULARBIOLOGISCHER FAKTOREN UND MAGNETISCHER DRUG TARGETINGMECHANISMEN Dissertation zur Erlangung

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Wirkung der Blockade des Angiotensin II ATi-Rezeptors auf die Funktion und die Struktur des Herzens der Streptozotodn-diabetischen Ratte

Wirkung der Blockade des Angiotensin II ATi-Rezeptors auf die Funktion und die Struktur des Herzens der Streptozotodn-diabetischen Ratte Wirkung der Blockade des Angiotensin II ATi-Rezeptors auf die Funktion und die Struktur des Herzens der Streptozotodn-diabetischen Ratte Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen

Mehr

Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm)

Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Naturwissenschaft Daniel Knobeloch Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Diplomarbeit Bibliografische Information der Deutschen Nationalbibliothek:

Mehr

IN-VITRO- UND IN-VIVO-STUDIEN ZU IL-12-DEFIZIENTEN DENDRITISCHEN ZELLEN VON PRIMATEN

IN-VITRO- UND IN-VIVO-STUDIEN ZU IL-12-DEFIZIENTEN DENDRITISCHEN ZELLEN VON PRIMATEN IN-VITRO- UND IN-VIVO-STUDIEN ZU IL-12-DEFIZIENTEN DENDRITISCHEN ZELLEN VON PRIMATEN Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) eingereicht im

Mehr

Von der Gemeinsamen Naturwissenschaftlichen Fakultät. der Technischen Universität Carolo-Wilhelmina. zu Braunschweig. zur Erlangung des Grades einer

Von der Gemeinsamen Naturwissenschaftlichen Fakultät. der Technischen Universität Carolo-Wilhelmina. zu Braunschweig. zur Erlangung des Grades einer Untersuchungen zu molekularen und zellulären Interaktionen im Prozeß der Eliminierung von Lebermetastasen in einem murinen Zell-vermittelten Therapiemodell Von der Gemeinsamen Naturwissenschaftlichen Fakultät

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

Zusammenfassung Einleitung 3

Zusammenfassung Einleitung 3 Inhaltsverzeichnis Zusammenfassung 1 1. Einleitung 3 1.1. Vorkommen und Bedeutung nichtsegmentierter Negativstrang Viren 3 1.2. Persistierende Infektionen 4 1.2.1. Humanmedizinische Bedeutung 4 1.2.2.

Mehr

Charakterisierung eines Borna Disease Virus-spezifischen T-Zell-Epitops der Lewis Ratte und Einsatz dieses Epitops in Immunisierungsexperimenten

Charakterisierung eines Borna Disease Virus-spezifischen T-Zell-Epitops der Lewis Ratte und Einsatz dieses Epitops in Immunisierungsexperimenten Aus der Bundesforschungsanstalt für Viruskrankheiten der Tiere, Standort Tübingen und dem Institut für Virologie des Fachbereichs Veterinärmedizin der Justus-Liebig-Universität Gießen Betreuer: Prof. Dr.

Mehr

Einfluss von Immunsuppressiva auf die antivirale T-Zellantwort ex vivo

Einfluss von Immunsuppressiva auf die antivirale T-Zellantwort ex vivo Aus der Universitätsklinik für Kinder- und Jugendmedizin Tübingen Abteilung Kinderheilkunde I mit Poliklinik Ärztlicher Direktor: Professor Dr. R. Handgretinger Einfluss von Immunsuppressiva auf die antivirale

Mehr

Inhaltsverzeichnis. Zusammenfassung 1. Summary 4. 1 Einleitung Das Prostatakarzinom Entstehung und Bedeutung von Lymphknotenmetastasen 9

Inhaltsverzeichnis. Zusammenfassung 1. Summary 4. 1 Einleitung Das Prostatakarzinom Entstehung und Bedeutung von Lymphknotenmetastasen 9 Inhaltsverzeichnis Zusammenfassung 1 Summary 4 1 Einleitung 7 1.1 Das Prostatakarzinom 7 1.2 Entstehung und Bedeutung von Lymphknotenmetastasen 9 1.2.1 Das Lymphsystem 9 1.2.2 Lymphknotenmetastasierung

Mehr

Aus dem Johannes-Müller-Centrum für Physiologie der Medizinischen Fakultät der Charité Universitätsmedizin Berlin DISSERTATION

Aus dem Johannes-Müller-Centrum für Physiologie der Medizinischen Fakultät der Charité Universitätsmedizin Berlin DISSERTATION Seite 1 Aus dem Johannes-Müller-Centrum für Physiologie der Medizinischen Fakultät der Charité Universitätsmedizin Berlin DISSERTATION Mechanismen und pathophysiologische Konsequenzen einer hypoxievermittelten

Mehr

5 Zusammenfassung. Zusammenfassung 76

5 Zusammenfassung. Zusammenfassung 76 Zusammenfassung 76 5 Zusammenfassung 1. Aminosäuren sind als Bausteine der Proteine essentiell zur Aufrechterhaltung vitaler Prozesse. Eine besondere Rolle im Zellmetabolismus der Haut spielen dabei kationische

Mehr

Inhaltsverzeichnis. Abbildungsverzeichnis. Tabellenverzeichnis. Abkürzungsverzeichnis

Inhaltsverzeichnis. Abbildungsverzeichnis. Tabellenverzeichnis. Abkürzungsverzeichnis Inhaltsverzeichnis Abbildungsverzeichnis Tabellenverzeichnis Abkürzungsverzeichnis vi viii ix 1. Einleitung 3 1.1. Phage Display................................ 4 1.1.1. Phage-Display-Bibliothekenformate................

Mehr

Expression von Inhibin-Untereinheiten in normalem Plazentagewebe und in Plazenten von HIV-infizierten Patientinnen

Expression von Inhibin-Untereinheiten in normalem Plazentagewebe und in Plazenten von HIV-infizierten Patientinnen Aus der Klinik und Poliklinik für Frauenheilkunde und Geburtshilfe der Ludwig-Maximilians-Universität München Direktor: Prof. Dr. med. Sven Mahner Expression von Inhibin-Untereinheiten in normalem Plazentagewebe

Mehr

Zur Progesteron-abhängigen Differenzierung von Endometrium- und Brustkrebs-Zellen: Molekulare Konzepte und Implikationen für die Klinik

Zur Progesteron-abhängigen Differenzierung von Endometrium- und Brustkrebs-Zellen: Molekulare Konzepte und Implikationen für die Klinik Aus dem Institut für Anatomie und Reproduktionsbiologie des Universitätsklinikums Aachen (Direktor: Universitätsprofessor Dr. med. Dr. rer. nat. Henning M. Beier) Zur Progesteron-abhängigen Differenzierung

Mehr

INHALTSVERZEICHNIS INHALTSVERZEICHNIS ABKÜRZUNGSVERZEICHNIS

INHALTSVERZEICHNIS INHALTSVERZEICHNIS ABKÜRZUNGSVERZEICHNIS INHALTSVERZEICHNIS I ABKÜRZUNGSVERZEICHNIS VI 1 EINLEITUNG 1 1.1 Biofilme 1 1.1.1 Allgemeines 1 1.1.2 Biofilmbildung 4 1.1.2.1 Allgemein 4 1.1.2.2 Der conditioning film oder Die reversible Bindung 5 1.1.2.3

Mehr

Rekombinante Antikorperfragmente fur die. Zoonosediagnostik

Rekombinante Antikorperfragmente fur die. Zoonosediagnostik Rekombinante Antikorperfragmente fur die Zoonosediagnostik Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades eines Doktors

Mehr

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle Angefertigt am Fachbereich 08 - Biologie und Chemie in Zusammenarbeit mit dem Institut für Medizinische Virologie am Fachbereich 11- Medizin der Justus-Liebig-Universität Gießen Die antivirale Therapie

Mehr

p53-menge bei 4197 nach Bestrahlung mit 4Gy Röntgenstrahlung 3,51 PAb421 PAb1801 PAb240 Do-1 Antikörper

p53-menge bei 4197 nach Bestrahlung mit 4Gy Röntgenstrahlung 3,51 PAb421 PAb1801 PAb240 Do-1 Antikörper 1.1 STRAHLENINDUZIERTE P53-MENGE 1.1.1 FRAGESTELLUNG Die Kenntnis, daß ionisierende Strahlen DNA Schäden verursachen und daß das Protein p53 an den zellulären Mechanismen beteiligt ist, die der Manifestation

Mehr

Abbildungsverzeichnis

Abbildungsverzeichnis I INHALTSVERZEICHNIS Abkürzungen VI Abbildungsverzeichnis VIII I. Einleitung 1. Neurone und Axonwachstum 1 2. Oligodendrozyten und Myelin 3 3. Das Proteolipid Protein (PLP) 6 4. Mutationen im PLP-Gen und

Mehr

NFATc2 ist ein Schalter der T-Zell-Rezeptor-abhängigen Aktivierung in humanen CD4 + Th-Zellen

NFATc2 ist ein Schalter der T-Zell-Rezeptor-abhängigen Aktivierung in humanen CD4 + Th-Zellen NFATc2 ist ein Schalter der T-Zell-Rezeptor-abhängigen Aktivierung in humanen CD4 + Th-Zellen Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat) eingereicht

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Untersuchung der differentiellen Genexpression mit DNA-Microarrays bei Akuter Lymphoblastischer Leukämie im Vergleich mit normalen B-Lymphozyten

Untersuchung der differentiellen Genexpression mit DNA-Microarrays bei Akuter Lymphoblastischer Leukämie im Vergleich mit normalen B-Lymphozyten Untersuchung der differentiellen Genexpression mit DNA-Microarrays bei Akuter Lymphoblastischer Leukämie im Vergleich mit normalen B-Lymphozyten Dissertation zur Erlangung des akademischen Grades doctor

Mehr

Abb. 1: Strukturformel von L-Arginin; Molekulargewicht 174,20 g/mol; Summenformel C 6 H 15 N 4 O 2. 6

Abb. 1: Strukturformel von L-Arginin; Molekulargewicht 174,20 g/mol; Summenformel C 6 H 15 N 4 O 2. 6 Abbildungen Abb. 1: Strukturformel von L-Arginin; Molekulargewicht 174,20 g/mol; Summenformel C 6 H 15 N 4 O 2. 6 Abb. 2: Biosynthese von Stickstoffmonoxid aus L-Arginin (nach Nathan, 1992). 8 Abb. 3:

Mehr

Morbus Crohn: Mechanismen der epithelialen Barrierestörung. und der therapeutische Effekt von TNFα-Antikörpern

Morbus Crohn: Mechanismen der epithelialen Barrierestörung. und der therapeutische Effekt von TNFα-Antikörpern Medizinische Fakultät der Charité - Universitätsmedizin Berlin Campus Benjamin Franklin aus der Medizinischen Klinik I, Gastroenterologie, Infektiologie und Rheumatologie Direktor: Prof. Dr. med. M. Zeitz

Mehr

Fachverlag Köhler Giessen VETERINÄRMEDIZIN

Fachverlag Köhler Giessen VETERINÄRMEDIZIN VETERINÄRMEDIZIN Kälteanpassung \bi\ Listeria monocytogenes: Klonierung, D^Ä-Sequenzanalyse und Funktionsstudien der Gene CS/JL, CS/JLB und flar aus dem Wildtypstamm Listeria monocytogenes EGD Eva-Maria

Mehr

Hochdurchsatz Generierung und Analyse von Arabidopsis thaliana-proteinen

Hochdurchsatz Generierung und Analyse von Arabidopsis thaliana-proteinen MAX-PLANCK-INSTITUT FÜR MOLEKULARE GENETIK Hochdurchsatz Generierung und Analyse von Arabidopsis thaliana-proteinen Dissertation zur Erlangung der Doktorwürde des Fachbereichs Biologie, Chemie, Pharmazie

Mehr

Aus der Klinik und Poliklinik für Hals-, Nasen- und Ohren- Krankheiten, plastische und ästhetische Operationen. der Universität Würzburg

Aus der Klinik und Poliklinik für Hals-, Nasen- und Ohren- Krankheiten, plastische und ästhetische Operationen. der Universität Würzburg Aus der Klinik und Poliklinik für Hals-, Nasen- und Ohren- Krankheiten, plastische und ästhetische Operationen der Universität Würzburg Direktor: Professor Dr. Dr. h.c. R. Hagen Untersuchungen zur optimalen

Mehr

Hypothetisches Modell

Hypothetisches Modell Hypothetisches Modell Das Heutige Paper Inhalt: SCF bindet Auxin direkt TIR1 ist ein Auxin Rezeptor Auxin bindet direkt an TIR1, es sind keine zusätzlichen Komponenten nötig Methode Normales Pull down

Mehr

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.)

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) Identifizierung, funktionelle Expression und biochemische Charakterisierung von Isoformen der UDP-N-Acetylglucosamin-2-Epimerase/ N-Acetylmannosaminkinase Dissertation zur Erlangung des akademischen Grades

Mehr

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt

Mehr

Medizinische Immunologie. Vorlesung 6 Effektormechanismen

Medizinische Immunologie. Vorlesung 6 Effektormechanismen Medizinische Immunologie Vorlesung 6 Effektormechanismen Effektormechanismen Spezifische Abwehrmechanismen Effektormechanismen der zellulären Immunantwort - allgemeine Prinzipien - CTL (zytotoxische T-Lymphozyten)

Mehr

Rekombinante Antikorper. fur,,lab-on-chip"

Rekombinante Antikorper. fur,,lab-on-chip Rekombinante Antikorper fur,,lab-on-chip" Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades einer Doktorin der Naturwissenschaften

Mehr

In dieser Doktorarbeit wird eine rezeptorvermittelte Signalkaskade für Thrombin

In dieser Doktorarbeit wird eine rezeptorvermittelte Signalkaskade für Thrombin Diskussion -33-4. Diskussion In dieser Doktorarbeit wird eine rezeptorvermittelte Signalkaskade für Thrombin beschrieben, die zur Differenzierung von neonatalen glatten Gefäßmuskelzellen führt. Thrombin

Mehr

Dissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften an der Universität Konstanz. vorgelegt von Christoph Borchers

Dissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften an der Universität Konstanz. vorgelegt von Christoph Borchers Proteinchemische Umsetzungen in Kombination mit massenspektrometrischen Methoden zur Tertiärstrukturcharakterisierung von Proteinen - Analytische Entwicklung und Anwendung zur Aufklärung der Pharmaka-Bindung

Mehr

Thematik der molekularen Zellbiologie Studienjahr 2004/05. I. Semester

Thematik der molekularen Zellbiologie Studienjahr 2004/05. I. Semester Thematik der molekularen Zellbiologie Studienjahr 2004/05 (Abkürzungen: V. = 45 Min. Vorlesung, S. = 45 Min. Seminar, ds. = doppeltes, 2 x 45 Min. Seminar, Ü. = 90 Min. Übung) I. Semester 1. Woche: d 1.

Mehr

Charité-Universitätsmedizin Berlin Campus Benjamin Franklin Abteilung: Allgemeine Pathologie Geschäftsführender Direktor: Prof. Dr. med. H.

Charité-Universitätsmedizin Berlin Campus Benjamin Franklin Abteilung: Allgemeine Pathologie Geschäftsführender Direktor: Prof. Dr. med. H. Charité-Universitätsmedizin Berlin Abteilung: Allgemeine Pathologie Geschäftsführender Direktor: Prof. Dr. med. H. Stein Bedeutung somatischer Mutationen im nicht-kodierenden Bereich der umgelagerten Immunglobulingene

Mehr

Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax)

Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax) Aus der Abteilung Innere Medizin II der Medizinischen Universitätsklinik der Albert-Ludwigs-Universität Freiburg im Breisgau Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres

Mehr

Männerpolitische Grundsatzabteilung. Vereinbarkeit von Familie und Beruf aus Männersicht

Männerpolitische Grundsatzabteilung. Vereinbarkeit von Familie und Beruf aus Männersicht Männerpolitische Grundsatzabteilung Vereinbarkeit von Familie und Beruf aus Männersicht Vielen Dank den Sponsoren: Inhaltsverzeichnis 4 Inhaltsverzeichnis 5 Inhaltsverzeichnis 6 Vorwort 7 Danksagung 8

Mehr

Th1-Th2-Zytokine bei entzündlicher Herzmuskelerkrankung

Th1-Th2-Zytokine bei entzündlicher Herzmuskelerkrankung Aus der medizinischen Klinik II, Abteilung für Kardiologie und Pulmonologie des Universitätsklinikums Benjamin Franklin der Freien Universität Berlin Direktor: Univ.-Prof. Dr. med. H.-P. Schultheiss Th1-Th2-Zytokine

Mehr

Untersuchungen zur Beziehung von Kohlenstoffund Stickstoffmetabolismus in Spinatpflanzen

Untersuchungen zur Beziehung von Kohlenstoffund Stickstoffmetabolismus in Spinatpflanzen Untersuchungen zur Beziehung von Kohlenstoffund Stickstoffmetabolismus in Spinatpflanzen (Spinacia oleracea L.) Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Mathematisch-Naturwissenschaftlichen

Mehr

Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA

Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA Von der Naturwissenschaftlichen Fakultät der Technischen Universität Carolo-Wilhelmina zu

Mehr

Thema. Vergleich des Respiratory Burst von Monozyten und Granulozyten von HIV-Patienten und Probanden

Thema. Vergleich des Respiratory Burst von Monozyten und Granulozyten von HIV-Patienten und Probanden Aus der medizinischen Klinik und Polyklinik des Universitätsklinikums Benjamin Franklin der Freien Universität Berlin Geschäftsführender Direktor: R. O. Riecken Abteilung für Kardiologie und Pulmonologie

Mehr

Synthese von eukaryotischen RNA-Modifikationen

Synthese von eukaryotischen RNA-Modifikationen Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München Synthese von eukaryotischen RNA-Modifikationen und Quantifizierung nicht kanonischer

Mehr

Intrakoerper II: ( Quelle: https://www.google.com/patents/de t 2?cl=de ) Ansprüche(11)

Intrakoerper II: ( Quelle: https://www.google.com/patents/de t 2?cl=de ) Ansprüche(11) Intrakoerper II: ( Quelle: https://www.google.com/patents/de60012980t 2?cl=de ) Ansprüche(11) Ein Verfahren für Identifikation von Intrakörper Strukturgerüsten oder Intrakörpern wobei geeignete Wirtszellen

Mehr

Pharmakologische und molekularbiologische Charakterisierung eines neuen blutdruckregulierenden Gruppe I P2X-Rezeptors in der Rattenniere

Pharmakologische und molekularbiologische Charakterisierung eines neuen blutdruckregulierenden Gruppe I P2X-Rezeptors in der Rattenniere Aus dem Universitätsklinikum Benjamin Franklin der Freien Universität Berlin Abteilung: Medizinischen Klinik IV / Nephrologie Geschäftsführender Direktor: Univ.-Prof. Dr. med. Walter Zidek Pharmakologische

Mehr

Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen

Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen DISSERTATION der Fakultät für Chemie und Pharmazie der Eberhard-Karls-Universität

Mehr

Entwicklung und Validierung eines automatisierten DNA-Mikroarrays zur Detektion von humanpathogenen Bakterien in Trinkwasser

Entwicklung und Validierung eines automatisierten DNA-Mikroarrays zur Detektion von humanpathogenen Bakterien in Trinkwasser TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Analytische Chemie Institut für Wasserchemie und Chemische Balneologie Entwicklung und Validierung eines automatisierten DNA-Mikroarrays zur Detektion von humanpathogenen

Mehr

Dissertation. von Daniel Heiko Niemiiller aus Osterholz-Scharmbeck

Dissertation. von Daniel Heiko Niemiiller aus Osterholz-Scharmbeck Vergleichende Lokalisation der Homospermidin-Synthase, Eingangsenzym der Pyrrolizidin-Alkaloid-Biosynthese, in verschiedenen Vertretern der Boraginaceae Von der Fakultat fur Lebenswissenschaften der Technischen

Mehr

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher

Mehr

Abteilung für Radioonkologie, Universitätsklinikum Tübingen 2. Abteilung für Zellbiologie, Universität Duisburg-Essen

Abteilung für Radioonkologie, Universitätsklinikum Tübingen 2. Abteilung für Zellbiologie, Universität Duisburg-Essen Die Initiierung der intrinsischen Apoptose in -T- Zellen durch Celecoxib führt zur -Aktivierung nach Freisetzung aus der Interaktion mit den anti-apoptotischen Proteinen und. Justine Rudner 1, Simon Elsässer

Mehr

Proteinbiochemischer Nachweis der Exprimierung von Myosin und Myosin-Light-Chain-Kinase in Trabekelwerkszellen des Auges

Proteinbiochemischer Nachweis der Exprimierung von Myosin und Myosin-Light-Chain-Kinase in Trabekelwerkszellen des Auges Charité Universitätsmedizin Berlin Campus Benjamin Franklin Aus dem Institut für Klinische Physiologie Geschäftsführender Direktor: Prof. Dr. med. Michael Fromm Proteinbiochemischer Nachweis der Exprimierung

Mehr

Untersuchungen zum Einfluss von alpha Defensinen. aus neutrophilen Granulozyten auf die. primäre Hämostase

Untersuchungen zum Einfluss von alpha Defensinen. aus neutrophilen Granulozyten auf die. primäre Hämostase Aus dem Institut für Veterinär-Physiologie der Justus-Liebig-Universität Gießen Betreuer: Prof. Dr. Joachim Roth und Der Abteilung für Experimentelle und Klinische Hämostaseologie, Klinik und Poliklinik

Mehr

Nachweis der Effekte von Endokrinwirksamen

Nachweis der Effekte von Endokrinwirksamen Nachweis der Effekte von Endokrinwirksamen Stoffen Leane Lehmann Lehrstuhl für Lebensmittelchemie Institut für Pharmazie und Lebensmittelchemie Universität Würzburg Berlin 19.10.2012 Endokrine Effekte

Mehr

Aus der Klinik und Poliklinik für Neurologie der Universitätsmedizin der Johannes Gutenberg-Universität Mainz

Aus der Klinik und Poliklinik für Neurologie der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Aus der Klinik und Poliklinik für Neurologie der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Zur Analyse des Zusammenhangs zwischen Schmerzwahrnehmung und dem autonomen Nervensystem unter

Mehr

1. Welche Aussagen zum Immunsystem sind richtig?

1. Welche Aussagen zum Immunsystem sind richtig? 1. Welche Aussagen zum Immunsystem sind richtig? a) Das Immunsystem wehrt körperfremde Substanzen ab b) Die Elimination maligne entarteter Zellen gehört nicht zu den Aufgaben des Immunsystems c) Das Immunsystem

Mehr